CN116179586A - Expression cassette and strain for producing L-lysine by fermentation and application of expression cassette and strain - Google Patents

Abstract

The invention discloses an expression cassette and a strain for producing L-lysine by fermentation and application thereof. The expression cassette comprises a promoter and a vitreoscilla hemoglobin vhb gene, wherein the promoter comprises Peftu or Psod. The invention also discloses nucleic acid containing the expression cassette, a recombinant expression vector containing the nucleic acid, genetic engineering bacteria containing the nucleic acid or the recombinant expression vector and application thereof. The invention also discloses a preparation method of the genetically engineered bacterium and a method for preparing L-lysine by fermenting the genetically engineered bacterium. The invention improves the absorption and transportation functions of the strain to oxygen by endowing the corynebacterium glutamicum with the hemoglobin function, obviously shortens the fermentation time and improves the yield of L-lysine.

Description

Expression cassette and strain for producing L-lysine by fermentation and application of expression cassette and strain

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an expression cassette and a strain for producing L-lysine by fermentation and application thereof.

Background

Lysine (lysine), also known as 2, 6-diaminocaproic acid, belongs to the basic amino acid. Lysine has important nutrition physiological functions and is widely applied in the industries of medicine, food and feed. At the same time, it can also be used as a precursor substance for synthesizing nylon polymer materials. The production path of lysine mainly comprises three methods of a protein hydrolysis method, a chemical synthesis method and a fermentation method, wherein the microbial fermentation method has the characteristics of low production cost, high production strength, high specificity, small environmental pollution and the like, and becomes the method with the widest application of industrial production of lysine.

The prokaryotic microorganism for producing lysine mainly includes corynebacteria, brevibacterium, nocardia, pseudomonas, escherichia, bacillus, etc. Corynebacterium glutamicum (c.glutamicum) is the most important and safe strain for fermentative production of amino acids, and improving its ability to excessively synthesize various amino acids by metabolic engineering has been a hot spot of research. For example, overexpression of a gene involved in lysine synthesis pathway and a gene involved in desensitization of feedback inhibition, or enhancement of energy supply pathway from glucose metabolism and optimization of lysine transporter on cell membrane, etc. are effective in improving productivity of lysine.

In addition to constantly enhancing metabolic pathways for lysine production, fermentation methods that open other bypasses to non-lysine metabolism are also worth the deep excavation. Oxygen binding proteins of hemoglobin are widely found in animals, plants and microorganisms and are capable of storing and transporting oxygen. Three classes of hemoglobin are found in bacteria, including single domain hemoglobin, flavohemoglobin, and truncated hemoglobin. For example, vitreoscilla hemoglobin (Vitreoscilla Hemoglobin, VHb) contains two identical subunit molecules, and each molecule contains two heme b. The expression of the hyaluronidase hemoglobin genes (Vitreoscilla hemoglobin gene, vhb) in different hosts can improve the synthesis of proteins and metabolites in various hosts, thereby achieving the purpose of promoting growth. At present, the application of hemoglobin in lysine production by corynebacterium glutamicum has not been reported yet.

Disclosure of Invention

Aiming at the defect that a high-yield L-lysine production genetically engineered bacterium is lacked in the prior art, the invention provides an expression cassette capable of improving the yield of L-lysine of corynebacterium glutamicum and the genetically engineered bacterium for efficiently producing L-lysine. The production of L-lysine by Corynebacterium glutamicum has not been reported from the viewpoint of hemoglobin. The invention improves the absorption and transportation functions of the strain to oxygen by endowing the corynebacterium glutamicum with the hemoglobin function, obviously shortens the fermentation time and improves the yield of L-lysine.

In order to solve the technical problems, one of the technical schemes provided by the invention is as follows: an expression cassette comprising a promoter and a vitreoscilla hemoglobin vhb gene, e.g., a codon optimized vhb gene, the promoter comprising Peftu or Psod.

The expression cassette according to one of the technical schemes, wherein the amino acid sequence of the encoding vhb gene and the nucleotide sequence of the vhb gene are respectively shown as SEQ ID NO. 20 and SEQ ID NO. 1. Or may have at least 95% or more identity with SEQ ID NO. 20 and SEQ ID NO. 1, further such as 97% or more, 99% or more, all considered to fall within the scope of protection of this patent.

The expression cassette according to one of the technical schemes, the nucleotide sequence of the Peftu promoter is shown as SEQ ID NO. 2, and/or the nucleotide sequence of the Psod promoter is shown as SEQ ID NO. 3.

In order to solve the technical problems, the second technical scheme provided by the invention is as follows: an isolated nucleic acid comprising an expression cassette according to one of the claims.

In order to solve the technical problems, the third technical scheme provided by the invention is as follows: a recombinant expression vector comprising an expression cassette according to one of the claims, or comprising a nucleic acid according to the second of the claims.

In a preferred embodiment of the present invention, the backbone plasmid of the recombinant expression vector may be pK18mob.

In order to solve the technical problems, the fourth technical scheme provided by the invention is as follows: a genetically engineered bacterium into which the expression cassette according to one of the claims, the nucleic acid according to the second of the claims, or the recombinant expression vector according to the third of the claims has been transferred.

Preferably, the starting strain of the genetically engineered bacterium is corynebacterium glutamicum.

In some preferred embodiments, the starting bacterium is c.glutamicum B253. Although the strain C.glutamicum B253 which is tolerant to the straw hydrolysate is selected as the starting strain in the embodiment of the invention, the effect of producing L-lysine by the genetically engineered bacterium is better than that of the starting strain when the culture medium is a prepared glucose culture medium, namely, the toxicity of the inhibitor which is tolerant to the straw hydrolysate is not the condition which is necessary for the starting strain. Other Corynebacterium glutamicum may also be selected as the starting strain.

The genetically engineered bacterium according to claim IV, wherein the expression cassette according to claim IV, the nucleic acid according to claim II, or the recombinant expression vector according to claim III is integrated into the genome of the starting bacterium by homologous recombination or is present in the starting bacterium in a non-integrated form after the expression cassette according to claim IV, or the nucleic acid according to claim II, or the recombinant expression vector according to claim III is introduced into the starting bacterium.

In a preferred embodiment of the present invention, when the genetically engineered bacterium comprises the expression cassette, the expression cassette is integrated on the genome of the starting bacterium.

The genetically engineered bacterium according to claim IV, which preferably does not express lactate dehydrogenase (lactate dehydrogenase, LDH), e.g., the LDH gene thereof is knocked out.

In a preferred embodiment of the present invention, the expression cassette according to one of the claims, or the nucleic acid according to the second of the claims, or the recombinant expression vector according to the third of the claims, is integrated into its genome at the ldh gene locus when introduced into the starting organism. The locus_tag of the ldh gene is SB89_13725.

In order to solve the technical problems, the fifth technical scheme provided by the invention is as follows: a method for producing L-lysine, which comprises fermenting the genetically engineered bacterium according to the fourth aspect in a fermentation medium.

The conditions of the fermentation according to the present invention may be conventional in the art, for example, the fermentation medium is a medium containing not less than 25g/L glucose, and/or the conditions of the fermentation are: the temperature is 28-32 ℃, and/or the ventilation is 1.0-1.7vvm, and/or the pH is 6.8-7.2, and/or the stirring is carried out during fermentation, and the stirring rotating speed is 400-800rpm.

In a preferred embodiment of the invention, the fermentation medium contains 80-150g/L glucose, the fermentation temperature is 30 ℃, the pH is 7.0, the aeration rate is 1.4vvm, and the stirring speed is 600rpm.

The fermentation medium of the invention can be conventional in the art, and the fermentation medium of the invention is preferably a medium containing glucose, such as straw hydrolysate, wherein the straw hydrolysate is a hydrolysate formed by degrading macromolecular carbohydrates such as cellulose, hemicellulose, lignin and the like in crop straws into micromolecular carbohydrates such as glucose after enzymatic saccharification.

Ammonium sulfate, methionine and threonine may be added to the hydrolysate as is conventional in the art. In a preferred embodiment of the invention, 15 to 25g/L ammonium sulphate and 2 to 8g/L methionine and 2 to 8g/L threonine are added to the hydrolysate.

Further, according to the conventional art, the crop straw may be subjected to pretreatment, for example, including screening, impurity removal, dry acid pretreatment and/or detoxification treatment, before being subjected to enzymatic saccharification to prepare a hydrolysate, so as to improve saccharification efficiency of the crop straw and reduce contents of impurities such as acetic acid, furfural, 5-hydroxybenzaldehyde and the like. The detoxification treatment may be a biological detoxification treatment. Removing the inhibitor toxic to the fermentation cells by detoxification treatment.

In order to solve the technical problems, the sixth technical scheme provided by the invention is as follows: the method for preparing a genetically engineered bacterium according to the third aspect, comprising the steps of (not in the order of:

(1) Introducing the expression cassette according to one of the above-mentioned aspects or the nucleic acid according to the second of the above-mentioned aspects or the recombinant expression vector according to the third of the above-mentioned aspects into a starting bacterium;

(2) Knocking out the ldh gene to obtain the genetically engineered bacterium.

In a preferred embodiment of the present invention, the expression cassette according to the third aspect or the nucleic acid according to the second aspect or the recombinant expression vector according to the third aspect is introduced into the starting bacterium c.glutamicum B253, and the ldh gene is knocked out, thereby obtaining the genetically engineered bacterium.

In order to solve the technical problems, the seventh technical scheme provided by the invention is as follows: the expression cassette according to one of the technical schemes, the nucleic acid according to the second technical scheme, the recombinant expression vector according to the third technical scheme or the genetically engineered bacterium according to the fourth technical scheme are applied to the preparation of L-lysine.

On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.

The reagents and materials used in the present invention are commercially available.

The invention has the positive progress effects that:

the invention improves the absorption and transportation functions of the strain to oxygen by endowing the corynebacterium glutamicum with the hemoglobin function, obviously shortens the fermentation time and improves the yield of L-lysine. Further, the Peftu and Psod are used as promoters of vhb in the expression cassette, so that the Peftu and Psod can be expressed efficiently, the utilization rate of oxygen by cells is improved, the oxygen absorption rate of engineering bacteria is improved, the utilization rate of glucose is improved, and the yield of L-lysine is further improved. When the straw hydrolysate is used, the lysine yield of the genetically engineered bacterium is obviously improved compared with that of the starting bacterium. The genetically engineered bacterium provided by the invention can effectively utilize agricultural wastes such as straw and the like for fermentation, and has good application prospect.

Detailed Description

The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

1. Strains used in the present invention

Coli e.coli DH5 a was used for construction of expression and knockout plasmids.

Corynebacterium glutamicum c.glutamicum B253: purchased from Shanghai Industrial microbiota.

In this experiment, c.glutamicum B253 was mainly used as a starting strain.

2. Reagent and culture medium

Cellulase CTec 2.0 was used to hydrolyze cellulose and hemicellulose in lignocellulose and was purchased from novelin (china) corporation of beijing, china. The cellulase enzyme activity was 203.2FPU/mL according to the method in the NREL LAP-006 guide, the cellobiase activity was 4900.0CBU/mL, and the protein concentration was 87.3mg/mL according to the Bradford method. Restriction enzymes were used to cleave plasmids or gene fragments to generate cohesive ends, available from Thermo Scientific (Wilmington, DE, USA). DNA polymerase is used to amplify the gene fragment, DNA ligase is used to ligate the digested gene fragment and plasmid vector, both of which are available from Takara (Otsu, japan). The seamless cloning kit was used to ligate gene fragments containing homologous fragments to plasmid vectors available from han-heng biotechnology company (nanjin, china). Plasmid extraction kits, PCR product purification recovery kits and gel recovery kits were all purchased from Shanghai swirley biotechnology company (Shanghai, china). Other reagents were purchased from local suppliers.

The culture medium used for culturing the escherichia coli is Luria-Bertani (LB) culture medium, and the specific components are as follows: 10.0g/L sodium chloride, 10.0g/L peptone and 5.0g/L yeast extract.

The specific components of the culture medium used for culturing corynebacterium glutamicum are as follows:

(1) Seed culture medium: 25g/L glucose, 1.5g/L potassium dihydrogen phosphate, 2.5g/L urea and 0.6g/L magnesium sulfate, 25g/L corn steep liquor.

(2) Fermentation medium: 1g/L potassium dihydrogen phosphate, 3g/L urea, 0.6g/L magnesium sulfate, 20g/L corn steep liquor, and optionally glucose as a carbon source.

Example 1: starting strain C.glutamicum B253

The glutamic acid amide B253 is a strain for producing lysine, is used as a starting strain in the experiment, and the prior art discloses that the C.glutamic acid amide B253 can resist toxicity inhibitors (acetic acid, furfural, 5-hydroxybenzaldehyde and the like) in straw hydrolysate and perform normal growth and lysine production.

Example 2: construction of Peftu_vhb expression cassette

Firstly, constructing an integrated plasmid of a hemoglobin gene vhb, wherein the specific construction method is as follows: amplifying the genome of the C.glutamicum serving as a template by using a Peftu-F (shown as SEQ ID NO: 5) primer and a Peftu-R (shown as SEQ ID NO: 6) primer by a PCR method to obtain a Peftu promoter (shown as SEQ ID NO: 2); the hemoglobin vhb gene after codon optimization is used as a template, and a vhb fragment (shown as SEQ ID NO: 1) is obtained by PCR amplification through a vhb-F (shown as SEQ ID NO: 7) and a vhb-R (shown as SEQ ID NO: 8) primer; peftu_vhb fusion fragments (shown as SEQ ID NO: 9) are obtained by overlapping extension PCR using Peftu-F and vhb-R primers as templates.

Peftu-F:gaaatcaggaagtgggatcgaaacgaaaagcaatttgcttttcgacg SEQ ID NO:5

Peftu-R:tgtatgtcctcctggacttcgtg SEQ ID NO:6

vhb-F:ccacgaagtccaggaggacatacaatgctggaccagcagaccatc SEQ ID NO:7

vhb-R:ttactcaacagcctgagcgtac SEQ ID NO:8

Example 3: integration of the Peftu_vhb expression cassette into the ldh Gene locus

Amplifying the genome of the C.glutamicum serving as a template by using a ldh-up-F (shown as SEQ ID NO: 10) primer and a ldh-up-R (shown as SEQ ID NO: 11) primer by a PCR method to obtain a ldh-up fragment (shown as SEQ ID NO: 12); amplifying by PCR method with genome of C.glutamicum as template and using ldh-down-F (shown as SEQ ID NO: 13) and ldh-down-R (shown as SEQ ID NO: 14) primer to obtain ldh-down fragment (shown as SEQ ID NO: 15); the fusion fragment of Deltaldh:: vhb is obtained by means of overlap extension PCR using the ldh-up fragment, peftu_vhb and ldh-down fragment as templates and the ldh-up-F and ldh-down-R primers, and treated with EcoRI and HindIII endonucleases, and inserted into the pK18mob plasmid by means of T4 ligase (see http:// www.biovector.net/product/1089.Html for purchase route) to obtain the plasmid pK 18-. DELTA.ldh:: vhb. During this time, successfully ligated plasmids can be selected using seed culture plates containing kanamycin resistance.

lhd-up-F:tcccccgggggaacaccatgcgattaaggtgc SEQ ID NO:10

lhd-up-R:caaattgcttttcgtttcgatcccacttcctgatttccctaac SEQ ID NO:11

lhd-down-F:tacgctcaggctgttgagtaaatctttggcgcctagttggc SEQ ID NO:13

lhd-down-R:gtaagcttgtctgggacgttgatgacgctg SEQ ID NO:14

Then, the integrative plasmid pK18- Δldh:vhb was transferred into C.glutamicum by electrotransformation, which integrates at the site of locus_tag as SB89_13725. Then, the strain which has undergone the correct homologous recombination is selected by PCR verification to obtain recombinant Corynebacterium glutamicum which is designated as cg_vhb01.

Example 4: performance analysis of lysine production by genetically engineered bacteria

The performance of the genetically engineered strain in lysine production was evaluated by shake flask fermentation. The fermentation process is as follows: the fermentation medium included 1g/L potassium dihydrogen phosphate, 3g/L urea, 0.6g/L magnesium sulfate, 20g/L corn steep liquor, and 120g/L glucose as a carbon source, 25. Mu.g/mL of calicheamicin was added. The fermentation was carried out in 250mL shake flasks at 30℃and 200rpm for 48h. After nuclear magnetic resonance detection, the glucose-lysine conversion rates of the original strain and the genetically engineered strain are respectively 24.78% and 33.15%, which shows that the lysine conversion rate of the strain is improved after the vhb protein is introduced.

Example 5: fermentation of genetically engineered bacteria constructed by Psod promoter

The preparation of genetically engineered bacteria was the same as in examples 2 and 3, except that in example 5, the promoter was replaced with Psod (nucleotide sequence shown as SEQ ID NO: 3), and the primers used were Psod-F/Psod-R (shown as SEQ ID NO:16 and SEQ ID NO: 17).

Psod-F:gaaatcaggaagtgggatcgaaaagcggtaaccatcacgggttc SEQ ID NO:16

Psod-R:gggtaaaaaatcctttcgtaggtttcc SEQ ID NO:17

Comparative example 1: fermentation of genetically engineered bacteria constructed by PH36 promoter

The preparation of the genetically engineered bacterium was the same as in examples 2 and 3 except that the promoter was replaced with PH36 (nucleotide sequence shown as SEQ ID NO: 4) in comparative example 1, and the primers used were PH36-F/PH36-R (shown as SEQ ID NO:18 and SEQ ID NO: 19).

PH36-F:gaaatcaggaagtgggatcgaaacaaaagctgggtacctctatctg SEQ ID NO:18

PH36-R:ggatcccatgctactcctaccaac SEQ ID NO:19

The fermentation process of example 5 and comparative example 1 is described with reference to example 4 and the results of the fermentation are shown in Table 1. The effect achieved when the hemoglobin is regulated by the promoters Peftu and Psod is found to be better, and the Peftu promoter is more preferable.

TABLE 1 expression promoter screening

Example 6: lysine fermentation of modified strain in lignocellulose hydrolysate

Crushing wheat straw, sieving with a sieve with the diameter of 10 mm, washing the sieved straw with water to remove impurities such as soil, stones and metals, drying in a 105 ℃ oven to constant weight, and storing in a closed plastic bag for later use. And separating to obtain wheat straw hydrolysate which contains 95.4g/L glucose after dry acid pretreatment, biological detoxification and enzymolysis saccharification. 20g/L ammonium sulfate, 5g/L methionine and 5g/L threonine are added into the hydrolysate, the strain cg_vhb01 obtained by modification of the example 3 and the starting strain C.glutamicum B253 are cultivated in the wheat straw hydrolysate for fermentation comparison, the fermentation temperature is 30 ℃, the pH is controlled to 7.0 by ammonia water, the ventilation amount is 1.4vvm, the rotating speed is 600rpm, and the glucose consumption is used as the fermentation termination time. Lysine production was measured by nuclear magnetic resonance.

The results show that when the wheat straw hydrolysate is used as a culture medium, the two strains have obvious differences in fermentation time during fermentation, wherein the starting strain needs 72 hours to metabolize all glucose, but the recombinant strain cg_vhb01 finishes fermentation within 56 hours, namely the time required for fermentation is reduced by 16 hours. In addition, the final lysine yield of the recombinant strain was 26.4g/L, which was 9.54% higher than that of the control strain. Therefore, the recombinant strain obtained by the invention has stronger inhibitor tolerance and high-efficiency lysine production capacity, and has good application prospect.

The foregoing specifically describes an operation example of the technical solution of the present invention, and is not to be construed as limiting the application of the present invention. All equivalent substitutions of operating conditions are within the scope of the present invention.

SEQUENCE LISTING

<110> Shanghai Kaisei Biotechnology Co., ltd

CIC Energy Center

<120> expression cassette for fermentative production of L-lysine, strain and use thereof

<130> P21018212C

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 441

<212> DNA

<213> Artificial Sequence

<220>

<223> vhb nucleotide sequence

<400> 1

atgctggacc agcagaccat caacatcatc aaggctaccg ttccagttct gaaggagcac 60

ggcgttacca tcaccaccac cttctacaag aacctgttcg ctaagcaccc agaggttcgc 120

ccactgttcg acatgggccg ccaggagtcc ctggagcagc caaaggctct ggctatgacc 180

gttctggctg ctgctcagaa catcgagaac ctgccagcta tcctgccagc tgttaagaag 240

atcgctgtta agcactgcca ggctggcgtt gctgctgctc actacccaat cgttggccag 300

gagctgctgg gcgctatcaa ggaggttctg ggcgacgctg ctaccgacga catcctggac 360

gcttggggca aggcttacgg cgttatcgct gacgttttca tccaggttga ggctgacctg 420

tacgctcagg ctgttgagta a 441

<210> 2

<211> 335

<212> DNA

<213> Artificial Sequence

<220>

<223> Peftu promoter

<400> 2

cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60

tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120

ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180

aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240

tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300

agtcgtagcc accacgaagt ccaggaggac ataca 335

<210> 3

<211> 288

<212> DNA

<213> Artificial Sequence

<220>

<223> Psod promoter

<400> 3

agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa tgttcctttc 60

gaaaattgag gaagccttat gccctacaac cctacttagc tgccaattat tccgggcttg 120

tgacccgcta cccaataaat aggtgggctg aaaaatttcg ttgcaatatc aacaaaaagg 180

cctatcattg ggaagtgtcg caccaagtac ttttgcgaag cgccatctga cggattttca 240

aaagatgtat atgctcggtg cggaaaccta cgaaaggatt ttttaccc 288

<210> 4

<211> 95

<212> DNA

<213> Artificial Sequence

<220>

<223> PH36 promoter

<400> 4

caaaagctgg gtacctctat ctggtgccct aaacggggga atattaacgg gcccagggtg 60

gtcgcacctt ggttggtagg agtagcatgg gatcc 95

<210> 5

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> Peftu-F

<400> 5

gaaatcagga agtgggatcg aaacgaaaag caatttgctt ttcgacg 47

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Peftu-R

<400> 6

tgtatgtcct cctggacttc gtg 23

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> vhb-F

<400> 7

ccacgaagtc caggaggaca tacaatgctg gaccagcaga ccatc 45

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> vhb-R

<400> 8

ttactcaaca gcctgagcgt ac 22

<210> 9

<211> 776

<212> DNA

<213> Artificial Sequence

<220>

<223> Peftu_vhb

<400> 9

cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60

tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120

ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180

aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240

tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300

agtcgtagcc accacgaagt ccaggaggac atacaatgct ggaccagcag accatcaaca 360

tcatcaaggc taccgttcca gttctgaagg agcacggcgt taccatcacc accaccttct 420

acaagaacct gttcgctaag cacccagagg ttcgcccact gttcgacatg ggccgccagg 480

agtccctgga gcagccaaag gctctggcta tgaccgttct ggctgctgct cagaacatcg 540

agaacctgcc agctatcctg ccagctgtta agaagatcgc tgttaagcac tgccaggctg 600

gcgttgctgc tgctcactac ccaatcgttg gccaggagct gctgggcgct atcaaggagg 660

ttctgggcga cgctgctacc gacgacatcc tggacgcttg gggcaaggct tacggcgtta 720

tcgctgacgt tttcatccag gttgaggctg acctgtacgc tcaggctgtt gagtaa 776

<210> 10

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> lhd-up-F

<400> 10

tcccccgggg gaacaccatg cgattaaggt gc 32

<210> 11

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> lhd-up-R

<400> 11

caaattgctt ttcgtttcga tcccacttcc tgatttccct aac 43

<210> 12

<211> 943

<212> DNA

<213> Artificial Sequence

<220>

<223> ldh-up

<400> 12

ggaacaccat gcgattaagg tgcgctgctt gaattgcaga attatgcaag atgcgccgca 60

acaaaacgcg atcggccaag gtcaaagtgg tcaatgtaat gaccgaaacc gctgcgatga 120

aactaatcca cggcggtaaa aacctctcaa ttaggagctt gacctcatta atgctgtgct 180

gggttaattc gccggtgatc agcagcgcgc cgtaccccaa ggtgccgaca ctaatgcccg 240

cgatcgtctc cttcggtcca aaattcttct gcccaatcag ccggatttgg gtgcgatgcc 300

tgatcaatcc cacaaccgtg gtggtcaacg tgatggcacc agttgcgatg tgggtggcgt 360

tgtaaatttt cctggatacc cgccggttgg ttctggggag gatcgagtgg attcccgtcg 420

ctgacgcatg ccccaccgct tgtaaaacag ccaggttagc agccgtaacc caccacggtt 480

tcggcaacaa tgacggcgag agagcccacc acattgcgat ttccgctccg ataaagccag 540

cgcccatatt tgcagggagg attcgcctgc ggtttggcga cattcggatc cccggaacca 600

gctctgcaat cacctgcgcg ccgagggaag cgaggtgggt ggcaggtttt agtgcgggtt 660

taagcgttgc caggcgagtg gtgagcagag acgctagtct ggggagcgaa accatattga 720

gtcatcttgg cagagcatgc acaattctgc agggcataga ttggttttgc tcgatttaca 780

atgtgatttt ttcaacaaaa ataacacatg gtctgaccac attttcggac ataatcgggc 840

ataattaaag gtgtaacaaa ggaatccggg cacaagctct tgctgatttt ctgagctgct 900

ttgtgggttg tccggttagg gaaatcagga agtgggatcg aaa 943

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> lhd-down-F

<400> 13

tacgctcagg ctgttgagta aatctttggc gcctagttgg c 41

<210> 14

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> lhd-down-R

<400> 14

gtaagcttgt ctgggacgtt gatgacgctg 30

<210> 15

<211> 959

<212> DNA

<213> Artificial Sequence

<220>

<223> ldh-down

<400> 15

atctttggcg cctagttggc gacgcaagtg tttcattgga acacttgcgc tgccaacttt 60

ttggtttacg ggcaaaatga aactgttgga tggaatttaa agtgtttgta gcttaaggag 120

ctcaaatgaa tgagtttgac caggacattc tccaggagat caagactgaa ctcgacgagt 180

taattctaga acttgatgag gtgacacaaa ctcacagcga ggccatcggg caggtctccc 240

caacccatta cgttggtgcc cgcaacctca tgcattacgc gcatcttcgc accaaagacc 300

tccgtggcct gcagcaacgc ctctcctctg tgggagctac ccgcttgact accaccgaac 360

cagcagtgca ggcccgcctc aaggccgccc gcaatgttat cggagctttc gcaggtgaag 420

gcccacttta tccaccctca gatgtcgtcg atgccttcga agatgccgat gagattctcg 480

acgagcacgc cgaaattctc cttggcgaac ccctaccgga tactccatcc tgcatcatgg 540

tcaccctgcc caccgaagcc gccaccgaca ttgaacttgt ccgtggcttc gccaaaagcg 600

gcatgaatct agctcgcatc aactgtgcac acgacgatga aaccgtctgg aagcagatga 660

tcgacaacgt ccacaccgtt gcagaagaag ttggccggga aatccgcgtc agcatggacc 720

ttgccggacc aaaagtacgc accggcgaaa tcgccccagg cgcagaagta ggtcgcgcac 780

gagtaacccg cgacgaaacc ggaaaagtac tgacgcccgc aaaactgtgg atcaccgccc 840

acggctccga accagtccca gcccccgaaa gcctgcccgg tcgccccgct ctgccgattg 900

aagtcacccc agaatggttc gacaaactag aaatcggcag cgtcatcaac gtcccagac 959

<210> 16

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> Psod-F

<400> 16

gaaatcagga agtgggatcg aaaagcggta accatcacgg gttc 44

<210> 17

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Psod-R

<400> 17

gggtaaaaaa tcctttcgta ggtttcc 27

<210> 18

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> PH36-F

<400> 18

gaaatcagga agtgggatcg aaacaaaagc tgggtacctc tatctg 46

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> PH36-R

<400> 19

ggatcccatg ctactcctac caac 24

<210> 20

<211> 146

<212> PRT

<213> Artificial Sequence

<220>

<223> vhb amino acid sequence

<400> 20

Met Leu Asp Gln Gln Thr Ile Asn Ile Ile Lys Ala Thr Val Pro Val

1 5 10 15

Leu Lys Glu His Gly Val Thr Ile Thr Thr Thr Phe Tyr Lys Asn Leu

20 25 30

Phe Ala Lys His Pro Glu Val Arg Pro Leu Phe Asp Met Gly Arg Gln

35 40 45

Glu Ser Leu Glu Gln Pro Lys Ala Leu Ala Met Thr Val Leu Ala Ala

50 55 60

Ala Gln Asn Ile Glu Asn Leu Pro Ala Ile Leu Pro Ala Val Lys Lys

65 70 75 80

Ile Ala Val Lys His Cys Gln Ala Gly Val Ala Ala Ala His Tyr Pro

85 90 95

Ile Val Gly Gln Glu Leu Leu Gly Ala Ile Lys Glu Val Leu Gly Asp

100 105 110

Ala Ala Thr Asp Asp Ile Leu Asp Ala Trp Gly Lys Ala Tyr Gly Val

115 120 125

Ile Ala Asp Val Phe Ile Gln Val Glu Ala Asp Leu Tyr Ala Gln Ala

130 135 140

Val Glu

145

Claims (12)

1. An expression cassette comprising a promoter and a vitreoscilla hemoglobin vhb gene, the promoter comprising Peftu or Psod.

2. The expression cassette of claim 1, wherein the amino acid sequence encoding the vitreoscilla hemoglobin vhb gene is set forth in SEQ ID No. 20;

preferably, the nucleotide sequence of the vitreoscilla hemoglobin vhb gene is shown as SEQ ID NO. 1.

3. The expression cassette of claim 1, wherein the nucleotide sequence of the Peftu promoter is shown in SEQ ID No. 2 and/or the nucleotide sequence of the Psod promoter is shown in SEQ ID No. 3.

4. An isolated nucleic acid comprising the expression cassette of any one of claims 1-3.

5. A recombinant expression vector comprising the expression cassette of any one of claims 1-3, or comprising the nucleic acid of claim 4;

preferably, the backbone plasmid of the recombinant expression vector is pK18mob.

6. A genetically engineered bacterium into which the expression cassette of any one of claims 1 to 3, or the nucleic acid of claim 4, or the recombinant expression vector of claim 5 has been transferred;

preferably, the starting strain of the genetically engineered bacterium is corynebacterium glutamicum;

more preferably, the starting bacterium is c.glutamicum B253.

7. The genetically engineered bacterium of claim 6, wherein the expression cassette of any one of claims 1-3, or the nucleic acid of claim 4, or the recombinant expression vector of claim 5, is integrated on the genome of the genetically engineered bacterium by homologous recombination after being transferred into the starting bacterium, or is present in the genetically engineered bacterium in a non-integrated form;

preferably, the expression cassette is integrated on the genome of the genetically engineered bacterium.

8. The genetically engineered bacterium of claim 6 or 7, wherein the genetically engineered bacterium does not express lactate dehydrogenase, e.g., its ldh gene is knocked out;

preferably, the expression cassette according to any one of claims 1 to 3, or the nucleic acid according to claim 4, or the recombinant expression vector according to claim 5 is transferred into the starting organism, so that the expression cassette is integrated into its genome at the ldh gene locus, the locus_tag of which is SB89_13725.

9. A method for producing L-lysine, comprising fermenting the genetically engineered bacterium of any one of claims 6 to 8 in a fermentation medium;

the fermentation medium is a medium containing not less than 25g/L glucose, and/or the conditions of the fermentation are: at a temperature of 28-32 ℃, and/or a ventilation of 1.0-1.7vvm, and/or a pH of 6.8-7.2, and/or stirring during fermentation at a rotation speed of 400-800rpm;

preferably, the fermentation medium contains 80-150g/L glucose, the fermentation temperature is 30 ℃, the pH is 7.0, the ventilation is 1.4vvm, and the stirring speed is 600rpm.

10. The method according to claim 9, wherein the fermentation medium is a lignocellulose hydrolysate, such as a straw hydrolysate, which is formed by enzymatic saccharification of crop straw, and/or ammonium sulfate, methionine and threonine are added to the hydrolysate;

preferably, 15-25 g/L ammonium sulfate, 2-8 g/L methionine and 2-8 g/L threonine are added into the hydrolysate; optionally, the crop straw is subjected to pretreatment before being subjected to enzymolysis saccharification to prepare hydrolysate, wherein the pretreatment comprises screening, impurity removal, dry acid pretreatment and/or detoxification treatment.

11. The preparation method of the genetically engineered bacterium is characterized by comprising the following steps of:

1) Introducing the expression cassette according to any one of claims 1 to 3, or the nucleic acid according to claim 4, or the recombinant expression vector according to claim 5 into a starting bacterium;

2) Knocking out the ldh gene to obtain the genetically engineered bacterium;

preferably, in the preparation method, the expression cassette according to any one of claims 1 to 3, the nucleic acid according to claim 4, or the recombinant expression vector according to claim 5 is introduced into the starting strain c.glutamicum B253, and the ldh gene is knocked out, thereby obtaining the genetically engineered strain.

12. Use of the expression cassette according to any one of claims 1 to 3, the nucleic acid according to claim 4, the recombinant expression vector according to claim 5, the genetically engineered bacterium according to any one of claims 6 to 8 for the preparation of L-lysine.