CN116179367B - Strawberry disease biocontrol bacterium JSNL-B118 and application thereof - Google Patents
Strawberry disease biocontrol bacterium JSNL-B118 and application thereof Download PDFInfo
- Publication number
- CN116179367B CN116179367B CN202310045242.1A CN202310045242A CN116179367B CN 116179367 B CN116179367 B CN 116179367B CN 202310045242 A CN202310045242 A CN 202310045242A CN 116179367 B CN116179367 B CN 116179367B
- Authority
- CN
- China
- Prior art keywords
- strawberry
- jsnl
- biocontrol
- talaromyces
- kabodanensis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P3/00—Fungicides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Plant Pathology (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Agronomy & Crop Science (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Dentistry (AREA)
- Botany (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Cultivation Of Plants (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application belongs to the technical field of strawberry biocontrol, and discloses a strawberry gray mold and anthracnose biocontrol bacterium and application thereof, wherein the biocontrol bacterium is named as Talaromyces kabotanensisJSNL-B118, and the preservation unit is as follows: china general microbiological culture Collection Center (CGM) with a collection number of CGM CCNO.40438. The biocontrol strain Talaromyces kabotanensisJSNL-B118 provided by the application can obviously reduce the disease severity of the strawberry gray mold and the strawberry anthracnose, the average biocontrol effect reaches 78.81%, and the growth indexes such as plant height and the like are obviously improved.
Description
Technical Field
The application belongs to the technical field of strawberry biocontrol, and relates to strawberry disease biocontrol bacteria JSNL-B118 and application thereof.
Background
Strawberry is an important cash crop in China, but the strawberry diseases cause losses of different degrees every year. Wherein, the gray mold of the strawberries is one of important diseases affecting the yield and quality of the strawberries. The disease is caused by Botrytis cinerea, and mainly infects various plants such as strawberries, grapes, cucumbers, tomatoes, peppers and the like, and has a wide host range. The gray mold has wide distribution, high expansion speed and serious hazard, brings great loss to the yield and quality of the fruits and vegetables worldwide, and ranks the second in ten plant diseases worldwide. Gray mold is a fungal disease which is most serious in damage after strawberry flowering, and the disease mainly infects fruits, also infects leaves, fruit stalks, calyx, petals and petioles, causes rot of flowers and fruits, and the disease fruit rate of infected varieties is generally 30% -60%, even is out of service under serious conditions, and causes huge loss to strawberry production.
Strawberry anthracnose caused by Colletotrichum spp is a major disease of strawberry in recent years, mainly occurring in the seedling stage and the initial stage of colonization of strawberry. The anthrax host has a wide range, and can infect not only strawberries, but also plants such as grapes, apples, peppers, mangoes, oranges, peaches, pears, dendrobium candidum and the like. When strawberry anthracnose occurs, strawberry leaves, petioles, supporting leaves, stolons, petals and fruits can be damaged. The strawberry has high disease risk and high destructive power, generally causes 25% -30% yield reduction of strawberries, and has 80% serious loss even destructive loss. Strawberry anthracnose is the third major disease restricting the strawberry industry in China.
The control of the gray mold and anthracnose of the strawberry in the prior art mainly comprises the following modes: (1) enhancing chemical control. Although the chemical agent can prevent and treat gray mold and anthracnose of strawberries to a certain extent, the use of a large amount of chemical agent brings great threat to ecological environment and food safety; on the other hand, the drug resistance of pathogenic bacteria is continuously enhanced, and the phenomenon that the pesticide control is ineffective occurs. (2) And breeding disease-resistant varieties. The breeding of disease-resistant varieties is the most economical and effective way for controlling the gray mold and anthracnose of strawberries. However, on one hand, the main cultivated strawberry varieties in China are mostly varieties with poor disease resistance from abroad, and the disease resistance resource screening work of the strawberry varieties is still imperfect; on the other hand, the resistance of the strawberry variety is easy to lose due to the complex pathogenic bacteria causing the disease and the pathogenic population.
Therefore, finding an environmentally friendly and effective gray mold and anthracnose control measure is a problem to be solved urgently at present. The endophytic fungi (endophytes) of plants are different from pathogenic bacteria, which cause diseases and reduce the adaptability of host plants, and the endophytic fungi inhabit in asymptomatic host plant tissues, which are one of key factors affecting plant growth, nutrition and health, can help plants obtain nutrients, inhibit plant pathogenic bacteria and resist biotic and abiotic stress. Endophytic fungi and terrestrial plants have interacted for more than 4 billion years. Since endophytic fungi are derived from plants, the endophytic fungi are safe to the plants, are environment-friendly and are not easy to generate drug resistance, and the use of the microorganisms for controlling plant diseases is beneficial to maintaining ecological balance. Therefore, endophytic fungi are a source of novel compounds that promote organic agriculture.
In summary, the prior art lacks a green and efficient probiotic for preventing gray mold and anthracnose of strawberries.
Disclosure of Invention
Aiming at the problems, the application provides a biocontrol bacterium Talaromyces kabodanensis JSNL-B118 capable of effectively preventing and controlling the gray mold and anthracnose of strawberries and application thereof.
In order to achieve the above purpose, the present application adopts the following technical scheme:
in a first aspect, the application provides a biocontrol bacterium for controlling strawberry gray mold caused by strawberry gray mold fungus (Botrytis cinerea) and strawberry anthracnose caused by anthracnose fungus (Colletotrichum siamense), wherein the biocontrol bacterium is named Talaromyces kabodanensis JSNL-B118 and is separated from white rabbit town healthy strawberry leaves in Zhenjiang city sentence-holding city.
Talaromyces kabodanensis JSNL-B118, classified and named Talaromyces kabodanensis, has been registered and preserved in China general microbiological culture Collection center (CGMCC) at 12/8 of 2022, with the preservation number of CGMCC NO.40438 and the preservation address of North Chen Xiyu No. 1/3 in the Chaoyang area of Beijing city.
In a second aspect, the application provides an engineering bacterium comprising the nucleic acid fragment of Talaromyces kabodanensis JSNL-B118 of the first aspect of the application.
Further, the base sequence of the nucleic acid fragment includes SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.
SEQ ID NO.1:
TGGCTTTCGGAGTGCGGGCCTCGCGGCCCACCTCCCACCCTTGTCTCTCTACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCCGGTCGCCGGGGGACGCTCGTCCCCGGGCCCGCGCCCGCCGAAGCGCCCTGTGAACCCTGATGAAGATGGACTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCGGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCTATCAAAAGCGGGAGGAACTCCTTT
SEQ ID NO.2:
TCGCATGTACGACGGACTGACCGAAACAAAGTTGTCGGGACGGAAGAGCTGACCAAAGGGACCAGCGCGGACGGCGTCCATGGTACCGGGCTCCAAGTCGACGAGGACGGCACGGGGGACATATTTGTTGCCGGATGCCTATTCAATTATGAGTTTCGTTCGGTTTATCTGGTGAGTGGTCTAACGCACCTCGTTGAAGTAGACGTTCATACGCTCCAACTGGAGGTCGGAGGAGCCATTGTAGCTGTTGATGATCAGATATTGACGAATTGCAGCTGGATTCGAATCGTGTAATACTTACACACCAGAGCCGTCGAGACCGTGCTCAGCAGAGATGATTTGCCTGAAAAAAAGTCAGCGTGTTGTCGCGACAATTGATACCAAGTTCGGAGTCGAGAGTCAAACTCACCAGAAAGCAGCCCAATT
SEQ ID NO.3:
CCTGACCTTGATTTGTGGTTGTCGCATGTTGTGGTGGGTGGTTAGCTGACTAGCCGTTTTGATGAGTAGGACAAGGATGGAGATGGTGAGTGACCCACGAACACCAACAATACGATCTTTGAATAAAGGCCATTACTCCGAACAGTTATTGACGATATTTCAATAGGTCAAATCACAACCAAGGAACTGGGCACCGTCATGCGTTCCCTCGGCCAGAACCCCTCCGAATCCGAATTGCAGGACATGATCAACGAAGTCGACGCTGACAACAACGGCACAATCGATTTCCCTGGTATGACCCAAACCCGTCTACGCTGGATACAATGGCAGTACTAACTGCTACAGAATTCTTGACAATGATGGCCCGCAAAATGAAGGATACCGACTCCGAGGAAGAGATCCGCGAGGCTTTCAAGGTGTTTGACCGCGACAACAATGGATTCATCTCTGCCGCTGAACTGCGCCACGTCATGACCTCGATTGGCGAGAAGTTGACCGACGACGAGGTTGATGAGATGATTCGTGAGGCTGACCAGGATGGTGATGGAAGGATTGACTGTGCGTTCCCCATGAACGCTTGTACGAAAAAGAGAATTGTTCTAACAAGCATGCTTTCAGACAACGAATTCGCCATCGGGGGGGGGGGGGAAAAAAAAACCCCAAAAACACT
In a third aspect, the application provides a biocontrol microbial inoculum capable of preventing and controlling strawberry gray mold caused by strawberry gray mold bacteria (b.cinerea) and strawberry anthracnose caused by strawberry anthracnose bacteria (c.siamese), wherein the biocontrol microbial inoculum comprises one or more of the following active ingredients:
a1 Talaromyces kabodanensis JSNL-B118 of the first aspect of the application;
a2 One or more of the mycelia, spores or secondary metabolites of Talaromyces kabodanensis JSNL-B118 of the first aspect of the application;
a3 Any one of the engineering bacteria of the second aspect of the application.
Further, the mycelium of Talaromyces kabodanensis JSNL-B118 is prepared by inoculating Talaromyces kabodanensis JSNL-B118 to PDA and OA culture medium for culturing.
Further, the biocontrol microbial inoculum comprises biocontrol chemical fertilizers or biocontrol pesticides.
In a fourth aspect, the application also provides a preparation method of the biocontrol microbial agent in the third aspect, which is characterized by comprising the following steps:
s1, preparing a sterile matrix;
s2, adding mycelium, spores or secondary metabolites of Talaromyces kabodanensis JSNL-B118 into the substrate of the S1;
and S3, culturing the substrate obtained in the step S2 for a plurality of days in a sealing way to obtain the biocontrol microbial agent.
Further, the method comprises the following steps:
a1: the substrate was placed in sterile triangular flasks (250 mL) with vent holes, each flask was filled with 200mL of substrate, and sterilized at 121℃for 20min.
A2: talaromyces kabodanensis JSNL-B118 was inoculated into a PDA medium having a diameter of 9cm and containing 15mL, and cultured at 25℃in the absence of light for 3-5 days.
A3: cutting mycelia with length of 3mm×3mm from colony edge of Talaromyces kabodanensis JSNL-B118, transferring into liquid matrix under aseptic condition, sealing, and culturing at 25deg.C and 160rpm for 7d to obtain Talaromyces kabodanensis JSNL-B118 liquid fermentation inoculum.
In a fifth aspect, the application also provides the application of the biocontrol bacterium, the engineering bacterium or the biocontrol microbial inoculum in preventing and controlling strawberry gray mold caused by strawberry gray mold bacteria (B.cinerea) and strawberry anthracnose caused by strawberry anthracnose bacteria (C.siamense).
In a sixth aspect, the application also provides a method for controlling gray mold and anthracnose of strawberry, which comprises applying the biocontrol bacteria, engineering bacteria or biocontrol microbial agents provided by the application to a plant growth environment.
Further, the plant growing environment is plant seedling root or leaf.
Compared with the prior art, the biocontrol bacterium Talaromyces kabodanensis JSNL-B118 provided by the application can obviously reduce the disease severity of the gray mold and the anthracnose of the strawberries, the average biocontrol effect reaches 78.81%, and the growth indexes such as plant height and the like are obviously improved.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.
FIG. 1 is a graph showing the effect of Talaromyces kabodanensis JSNL-B118 on inhibiting the growth of B.cinerea (left) and C.siamese (right) hyphae on a plate in example 1;
FIG. 2 shows the inhibitory activity of Talaromyces kabodanensis JSNL-B118 on B.cinerea (left) and C.siamense (right) in example 1;
FIG. 3 is a graph showing the effect of Talaromyces kabodanensis JSNL-B118 on root length of strawberry plants in example 3;
FIG. 4 is a graph showing the effect of Talaromyces kabodanensis JSNL-B118 on B.cinerea-induced gray mold in strawberry in example 4;
FIG. 5 is the effect of Talaromyces kabodanensis JSNL-B118 on C.siamense-induced strawberry anthracnose in example 4.
Detailed Description
Embodiments of the technical scheme of the present application will be described in detail below with reference to the accompanying drawings. The following examples are only for more clearly illustrating the technical aspects of the present application, and thus are merely examples, which should not be construed as limiting the scope of the present application. It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this application belongs.
As used herein, the term "biocontrol bacteria" refers to beneficial microorganisms, primarily bacteria, fungi and actinomycetes, which control plant diseases.
As described in the present application, the term "engineering bacteria" refers to novel microorganisms processed by modern biological engineering technology, and has the characteristics of multifunction, high efficiency, strong adaptability, etc.
As used herein, the term "gray mold of strawberry (b.cinerea)" is classified as: fungi kingdom (Fungi), ascomycota (Ascomycota), glossomycetes (leotomycete), molluscles (Helotiales), sclerotiniaceae (Sclerotiniaceae), sporotrichum (botryotoinia). Is mainly distributed in the united states, sweden, germany, france, china, brazil, japan, korea, argentina, india, chile, etc.
As used herein, the term "strawberry anthracnose" (c.siamese) is classified as: mycota (eumycin), phylum half (deuteromyctina), class of cavitys (coelomycetes), order of Colletotrichum (melanocardiales), family of collectaceae (melanoceae), genus anthrax (Colletotrichum). Is mainly distributed in the united states, canada, australia, japan, uk, china, belgium, germany, india, vietnam, korea, brazil, panama, mexico, russia, israel, etc.
EXAMPLE 1 screening of bacteria Talaromyces kabodanensis JSNL-B118
1. Isolation of potential biocontrol bacteria
1.1, obtaining a test material: healthy strawberry plants with good growth vigor are selected from the field (Jiangsu nong Boyuan), and leaf tissues are taken.
1.2 endophytic fungi of strawberry leafIs characterized by comprising the steps of (1) separating and culturing: cutting strawberry leaf tissue, mixing uniformly, weighing 2g, and carrying out surface disinfection. To ensure removal of all the periphyton, 100mL of sterile water and 2 drops of tween 20 were added, and the mixture was shaken at 220rpm for 20min at 25 ℃ for 20s,70% (v/v) ethanol for 30s,2.5% (v/v) sodium hypochlorite solution for 2min, and finally rinsed 3-4 times with sterile water, and the surface water was blotted with sterile absorbent paper. The leaves were further cut under aseptic conditions into smaller pieces (0.5 cm 2 ) Each sample was randomly selected from 5 blocks placed on PDA plate medium containing ampicillin (50 mg/L) and rifampicin (50 mg/L). The dishes were sealed and incubated at 25℃for 1-2d in the dark. When mycelium emerges from leaf tissue, small pieces of medium grown on the edge of the medium are carefully transferred to a new PDA plate along with the mycelium.
2. Screening for antagonistic bacteria by plate counter method
Plates containing 15mL PDA medium with a diameter of 9cm were symmetrically inoculated with 3-5d of B.cinerea and C.siamese bacterial cakes (diameter 5 mm) and endophytic fungi cakes to be tested, respectively, at a distance of 2cm from the edge, using the PDA plate counter method, and plates inoculated with only B.cinerea and C.siamese bacterial cakes were used as controls. The plates were incubated at 25℃in the dark. After 5d, B.cinerea and C.siamese colony radii were measured and inhibition rates calculated. The inhibition rate is calculated according to the formula: inhibition ratio = (control colony radius-treatment colony radius)/control colony radius x 100%.
Finally, 1 strain with good antagonistic activity to both B.cinerea and C.siamense on a flat plate is obtained through screening, and the strain is particularly characterized in that the growth of pathogenic bacteria hypha is strongly inhibited, and the number is JSNL-B118.
As shown in FIG. 1, the left graph shows that JSNL-B118 is opposite to the B.cinerea strain, the colony of the B.cinerea strain of the experimental group is obviously smaller than that of the control, the inhibition rate reaches 73.47%, the right graph shows that the JSNL-B118 is opposite to the C.siamese strain, the colony of the C.siamese strain of the experimental group is obviously smaller than that of the control, the inhibition rate reaches 53.33%, and the hypha growth of the B.cinerea strain and the C.siamese strain are inhibited.
As shown in fig. 2, the optical microscopic observation results show that: the appearance of the cinerea mycelium is regular, and the content is uniformly distributed in the mycelium cell wall and is transparent; after 7 days of facing JSNL-B118, B.cinerea hyphae were coagulated and malformed due to uneven hyphae thickness (left panel), and were unable to grow normally. Normal c.siamense hyphae are regular in appearance, grow straight and have uniform distribution of hyphae cell wall contents; after 7d against JSNL-B118, the C.siamense mycelium inner material aggregated and distributed more disordered (right panel), and was unable to grow normally.
3. Molecular biological identification of the resulting strains
3.1 genomic DNA of strain JSNL-B118 was extracted using TIANGEN kit (DP 320-03).
3.2 amplification of ITS gene, benA gene and CAL gene of genomic DNA, respectively. DN A was amplified using a reaction volume of 30. Mu.L containing 15. Mu.L 2X EasyTaq PCR SuperMix (+dyne), 1. Mu.L (10. Mu.M) of each primer F/R, 2. Mu.L of template DNA and 11. Mu.L of ddH 2 O, PCR amplification procedure conditions were as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 54℃for 45s, elongation at 72℃for 60s for 35 cycles; finally, the extension is carried out for 10min at 72 ℃.
3.3, after the amplified PCR product is subjected to 1% agarose gel electrophoresis, observing under an ultraviolet lamp, and sending the PCR product with a target band to Nanjing qing department biotechnology Co., ltd for sequencing, wherein the sequencing result is as follows: the ITS gene sequence of the strain JSNL-B118 obtained by screening in the step 2 is SEQ ID NO.1, the BenA gene sequence is SEQ ID NO.2, and the CAL gene sequence is SEQ ID NO.3.
3.4, three sequences of SEQ ID NO.1, SEQ ID NO.2 and SE Q ID NO.3 were aligned on NCBI database website. The comparison results are shown in Table 1. Based on the results of Table 1, it was estimated that the biocontrol strain JSNL-B118 of the present application was Talaromyces kabodanensis and was named Talaromyces kabodanensis JSNL-B118.
Table 1SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 sequence alignment
Example 2 influence of Talaromyces kabodanensis JSNL-B118 extracellular metabolites on B.cinerea and C.siamese
1. The B.cinerea and C.siamense and Talaromyces kabodanensis JSNL-B118 were inoculated into 9cm diameter dishes containing 15mL PDA medium, respectively, and incubated at 25℃in the absence of light for 5d. When pathogenic bacteria grow on the culture dish, a puncher (diameter of 5 mm) is used for punching holes on the edge of the bacterial colony to prepare the bacterial dish.
2. Acquisition of extracellular metabolites secreted by Strain JSNL-B118
Cutting mycelium blocks with the length of 3mm multiplied by 3mm from the edge of a JSNL-B118 colony growing for 5d, transferring 30 mycelium blocks into a 200mLPDB liquid culture medium under the aseptic condition, culturing for 7d under the conditions of 25 ℃ and 160rpm in darkness, filtering mycelium blocks in a culture solution by using two layers of aseptic gauze, centrifuging at 10000rpm for 30min at normal temperature, and taking a supernatant; the supernatant was filtered through a 0.45 μm bacterial filter and then through a 0.22 μm bacterial filter to completely remove JSNL-B118 cells, thereby obtaining a sterile filtrate.
3. Under aseptic operation, 30mL and 60mL of the aseptic filtrate are respectively measured, poured into 100mL of PDA culture medium (cooled to about 50 ℃), rapidly and uniformly mixed to prepare flat plates containing JSNL-B118 aseptic filtrate with the concentration of 30mL/100mL and 60mL/100mL, and sterile water is used for replacing the aseptic filtrate by contrast to prepare aseptic horizontal plates with corresponding concentrations respectively.
4. The pathogen dishes were picked up in an ultra clean bench with the inoculating needle and inoculated into the plates prepared as described above, with the mycelium facing down, 3 replicates for each concentration (sterile filtrate and sterile water).
5. The inoculated culture dish is placed in a 25 ℃ incubator for 3-5d of light-proof culture, and the colony size is measured by a crisscross method. The inhibition rate is calculated according to the formula: inhibition ratio = (control colony diameter-treatment colony diameter)/control colony diameter x 100%.
The results are shown in Table 2
TABLE 2 inhibition of pathogenic bacteria by extracellular metabolites secreted by strain JSNL-B118
Wherein, the numerical expression mode of the colony diameter in the table is as follows: mean ± standard error.
From the data in Table 2, it is clear that the extracellular metabolite secreted by the strain JSNL-B118 has a certain inhibitory effect on both pathogenic bacteria, and the inhibitory effect tends to increase with increasing extracellular metabolite concentration.
Example 3 influence of Talaromyces kabodanensis JSNL-B118 on strawberry self-growth
1. Strain JSNL-B118 was inoculated into 9cm diameter petri dishes (containing 15ml PDA medium) and incubated at 25℃in the dark for 7d.
2. A pot having a diameter of 12cm was selected, and the medium of Talaromyces kabodanensis JSNL-B118 cultured for 7 days was cut into plates of 0.5 cm. Times.0.5 cm. Test set 2, control: 2 PDA flat plates with the length of 0.5cm multiplied by 0.5cm are added into each pot; the experimental group is: 2 flat plates of Talaromyces kabodanensis JSNL-B118 of 0.5cm by 0.5cm were added to each pot. Mixing various flat blocks with sterile water and sterilized vermiculite, adding into the pot to 1/3 position, transplanting 3 healthy strawberry seedlings (with the variety of sweet), and covering with a layer of mixture of thin mycelium blocks and vermiculite. 3 replicates were set for each treatment.
3. Each group of strawberries was irrigated with sterile water and after 30d the root length, plant height, root weight and fresh weight of the strawberries were counted.
The results are shown in FIG. 3 and Table 3.
TABLE 3 statistical results of strawberry plant height, root length, root weight and fresh weight
Wherein, the numerical expression modes of plant height, root length, root weight and fresh weight in the table are as follows: mean ± standard error.
From the data in fig. 3 and table 3, the plant height of the experimental group is obviously superior to that of the control group, and Talaromyces kabodanensis JSNL-B118 has growth promotion effect on strawberry plants.
Example 4 effects of Talaromyces kabodanensis JSNL-B118 on strawberry gray mold caused by B.cinerea and strawberry anthracnose caused by C.siamense
1. Effect of Strain JSNL-B118 on strawberry gray mold caused by B.cinerea
1.1, talaromyces kabodanensis JSNL-B118 and B.cinerea were inoculated into 9cm diameter petri dishes containing 15mL PDA medium, and incubated at 25℃in the absence of light for 5d.
1.2, a pot having a diameter of 12cm was selected, and the medium of Talaromyces kabodanensis JSNL-B118 cultured for 5 days was cut into flat plates of 0.5 cm. Times.0.5 cm. Test set 2, control: 2 PDA flat plates with the length of 0.5cm multiplied by 0.5cm are added into each pot; the experimental group is: 2 flat plates of JSNL-B118 of 0.5cm by 0.5cm were added to each bowl. Mixing various flat blocks with sterile water and sterilized vermiculite, adding into the pot to 1/3 position, transplanting 3 healthy strawberry seedlings (variety is peach fumigation) with consistent growth vigor into each pot, and covering a layer of mixture of thin mycelium blocks and vermiculite. 3 replicates were set.
1.3, repeatedly washing the surface of the B.cinerea PDA plate growing for 5 days by using sterile water, so that the conidium is uniformly scattered in the water. Filtering the obtained conidium suspension with double-layer gauze, counting with a hemocytometer under an optical microscope, calculating the concentration of B.cinerea spore suspension, and adjusting to 1.0X10 6 The sample was kept at one/mL.
1.4, irrigating each group of strawberries every other day with sterile water, spraying and inoculating 2 drops of tween 20 into the B.cinerea spore suspension obtained in 1.3 to each treated plant by using a small sprayer after 7d, enabling the leaves and petioles to be full of water drops but not drop, and covering a plastic film for airtight moisture preservation after inoculation. The incidence was recorded 1 week after inoculation, and the incidence and disease index of the leaves were calculated.
Wherein, leaf disease progression grading criteria: 0: no disease spots; 1: the area of the disease spots accounts for less than 5% of the area of the whole leaf (fruit); 2: the area of the disease spots accounts for 6% -15% of the area of the whole leaf (fruit); 3: the area of the disease spots accounts for 16% -30% of the area of the whole leaf (fruit); 4: the area of the disease spots accounts for 31% -50% of the area of the whole leaf (fruit); 5: the area of the disease spots accounts for more than 50% of the area of the whole leaf (fruit).
Incidence (%) = number of diseased leaves (petiole, stolons, flowers, fruits) per total leaves (petiole, stolons, flowers, fruits) x 100; disease index= [ Σ (number of onset at each stage×number of disease stages)/(number of highest onset stages×total number of investigation) ]×100; control effect (%) = (control group disease index-experimental group disease index) ×100.
The results are shown in FIG. 4 and Table 4.
TABLE 4 statistical results of strawberry gray mold incidence, disease index and control effect
As can be seen from the graph 4 and the table 4, the biocontrol bacterium Talaromyces kabodanensis JSNL-B118 can obviously reduce the disease severity of plant gray mold, and the biocontrol effect reaches 83.49%, which shows that Talaromyces kabodanensis JSNL-B118 has the effect of preventing or controlling the strawberry gray mold caused by B.cinerea.
2. Effect of strain JSNL-B118 on strawberry anthracnose caused by c.siamense
2.1, talaromyces kabodanensis JSNL-B118 and C.siamense were inoculated into 9cm diameter dishes containing 15mL of DA medium, and incubated at 25℃in the absence of light for 5d.
2.2, setting two groups of treatment transplanted strawberries by adopting the method of the step 1.2. The strawberry variety is mauve 21.
2.3 preparing a C.siamese spore suspension by the method of step 1.3, adjusting to 1.0X10 5 The sample was kept at one/mL.
2.4, irrigating each group of strawberries every other day with sterile water, spraying and inoculating 2 drops of tween 20 into each treated plant with the C.siamese spore suspension obtained in 2.3 by using a small sprayer after 14d, enabling the leaves and petioles to be full of water drops but not drop, and covering a plastic film after inoculation for airtight moisture preservation. After 1 week of inoculation, the onset of disease was recorded, and the incidence and index of disease of leaves, petioles and stolons were calculated.
Wherein, leaf disease progression grading criteria: 0: no disease spots; 1: brown spots with the size of the needle point are arranged on the edge of the leaf blade, or brown disease spots appear on the leaf blade, and the area of the disease spots accounts for less than 5 percent of the area of the leaf blade; 3: nearly circular or spindle-shaped gray brown lesions appear, and the area of the lesions accounts for 6% -10% of the area of the leaves; 5: black necrotic spots appear in the center of the disease spots, or local disease spots of the leaf are connected, and the area of the disease spots accounts for 11% -25% of the area of the leaf; 7: typical disease spots, enlarged black necrotic spots or dead leaf edges, and the disease spot area accounts for 26% -50% of the leaf area; 9: the area of the disease spots accounts for more than 50% of the area of the leaf, or the leaf is dead.
Stage number grading criteria for petioles and stolons: 0: no disease spots; 1: pale red and faded halos appear at the affected part, or reddish brown spots, and the length of the spots is less than 3.0mm;2, enlarging the disease spots to form fusiform depressions with blackish brown, wherein the length of the disease spots is 3-10.0mm;3: typical spindle-shaped lesions, with a length of 11-20.0 mm, encircling the petioles or stolons; 4: blackening of petiole or stolon parts, drying shrinkage, and necrosis of the whole petiole, wherein the length of a disease spot is more than 20.0 mm; 5: the rootstock is necrotic and the plant dies.
Incidence (%) = number of diseased leaves (petiole, stolons, flowers, fruits) per total leaves (petiole, stolons, flowers, fruits) x 100; disease index= [ Σ (number of onset at each stage×number of disease stages)/(number of highest onset stages×total number of investigation) ]×100; control effect (%) = (control group disease index-experimental group disease index) ×100.
The results are shown in FIG. 5 and Table 5.
TABLE 5 statistical results of strawberry anthracnose morbidity, disease index and control effect
From fig. 5 and table 5, it can be known that the biocontrol bacterium Talaromyces kabodanensis JSNL-B118 of the application can obviously reduce the disease severity of plant anthracnose, and the average biocontrol effect reaches 74.14%, which indicates that Talaromyces kabodanensis JSNL-B118 has the effect of preventing or controlling strawberry anthracnose caused by c.siamense.
The numerical values set forth in these examples do not limit the scope of the present application unless specifically stated otherwise. In all examples shown and described herein, unless otherwise specified, any particular value is to be construed as exemplary only and not as limiting, and thus, other examples of exemplary embodiments may have different values.
Claims (6)
1. The biocontrol bacteria for the gray mold and the anthracnose of the strawberries are Talaromyces kabodanensis JSNL-B118, and are characterized in that the biocontrol bacteria are the storage units: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO.40438.
2. A biocontrol microbial inoculum capable of preventing and controlling strawberry gray mold caused by B.cinerea and strawberry anthracnose caused by C.siamese is characterized in that the biocontrol microbial inoculum comprises one or more of the following active ingredients: a1 Talaromyces kabodanensis JSNL-B118 of claim 1;
a2 Talaromyces kabodanensis JSNL-B118 of claim 1).
3. The biocontrol microbial agent of claim 2, wherein said mycelia of Talaromyces kabodanensis JSNL-B118 are prepared by inoculating Talaromyces kabodanensis JSNL-B118 to PDA and OA media for culturing.
4. A method for preparing the biocontrol microbial agent of any one of claims 2-3, which is characterized by comprising the following steps:
s1, preparing a sterile matrix;
s2, adding mycelium or spores of Talaromyces kabodanensis JSNL-B118 into the substrate of the S1;
and S3, culturing the substrate obtained in the step S2 for a plurality of days in a sealing way to obtain the biocontrol microbial agent.
5. Use of the biocontrol bacterium of claim 1 or the biocontrol bacterium agent of any one of claims 2-3 for controlling strawberry gray mold caused by b.cinerea and strawberry anthracnose caused by c.siamese.
6. A method for controlling gray mold of strawberry and anthracnose of strawberry, which comprises applying the biocontrol bacterium of claim 1 or the biocontrol microbial agent of any one of claims 2 to 3 to a plant growth environment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310045242.1A CN116179367B (en) | 2023-01-30 | 2023-01-30 | Strawberry disease biocontrol bacterium JSNL-B118 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310045242.1A CN116179367B (en) | 2023-01-30 | 2023-01-30 | Strawberry disease biocontrol bacterium JSNL-B118 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116179367A CN116179367A (en) | 2023-05-30 |
| CN116179367B true CN116179367B (en) | 2023-08-25 |
Family
ID=86447187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310045242.1A Active CN116179367B (en) | 2023-01-30 | 2023-01-30 | Strawberry disease biocontrol bacterium JSNL-B118 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116179367B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116240113B (en) * | 2023-02-08 | 2023-08-25 | 江苏农林职业技术学院 | Biocontrol bacterium JSNL-B47 for inhibiting strawberry anthracnose and application thereof |
| CN117903955A (en) * | 2024-01-29 | 2024-04-19 | 江苏农林职业技术学院 | Biocontrol fungus dark penicillium chrysogenum (Penicillium citreonigrum) JSNL-B16, biocontrol fungus agent, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011188761A (en) * | 2010-03-12 | 2011-09-29 | Mie Univ | Novel microorganism having preventive effect on strawberry anthracnose |
| CN112195120A (en) * | 2020-09-27 | 2021-01-08 | 基因赛奥(大连)生物科技发展有限公司 | Biocontrol strain G2C3 for preventing and treating powdery mildew of strawberries and application thereof |
-
2023
- 2023-01-30 CN CN202310045242.1A patent/CN116179367B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011188761A (en) * | 2010-03-12 | 2011-09-29 | Mie Univ | Novel microorganism having preventive effect on strawberry anthracnose |
| CN112195120A (en) * | 2020-09-27 | 2021-01-08 | 基因赛奥(大连)生物科技发展有限公司 | Biocontrol strain G2C3 for preventing and treating powdery mildew of strawberries and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 微生物制剂对草莓重要真菌病害的作用研究;赵玳琳;陶刚;卯婷婷;王廿;赵兴丽;娄璇;孙漫红;李世东;;中国生物防治学报(第03期);152-158 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116179367A (en) | 2023-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN116179367B (en) | Strawberry disease biocontrol bacterium JSNL-B118 and application thereof | |
| Nırmaladevı et al. | Cultural, morphological, and pathogenicity variation in Fusarium oxysporum f. sp. lycopersici causing wilt of tomato | |
| CN116555041B (en) | Strawberry biocontrol endophytic fungus JSNL-B124 and application thereof | |
| CN111424004A (en) | Pseudomonas linusii and application thereof | |
| CN116286393B (en) | Biocontrol bacterium JSNL-C1 capable of efficiently inhibiting botrytis cinerea and anthrax and application thereof | |
| CN110964644A (en) | Penicillium, and fermentation method and application thereof | |
| CN111378595B (en) | Burkholderia agricultural biocontrol strain Ba1 and application thereof | |
| CN114836329B (en) | Trichoderma harzianum HB40609 and application thereof | |
| CN115305221B (en) | Composite microbial agent, preparation method thereof and application thereof in preventing and treating empty heart disease of strawberries | |
| CN114480143B (en) | Trichoderma harzianum M6 for preventing and treating sclerotinia sclerotiorum of sunflower and application thereof | |
| CN111454848B (en) | Actinomucor elegans GD48, fermentation product, microbial inoculum and application thereof | |
| CN113817613B (en) | Trichoderma asperellum 6S-2 and application thereof in relieving apple continuous cropping obstacle | |
| CN116121079B (en) | Biocontrol bacterium JSNL-TX60 for gray mold and anthracnose of strawberries and application thereof | |
| CN111876337B (en) | Fusarium oxysporum and fermentation method and application thereof | |
| CN111996126B (en) | Violet purpurea capable of being used for preventing and treating root-knot nematode and application thereof | |
| CN116333891B (en) | Biocontrol bacterium JSNL-TX55 for gray mold and anthracnose of strawberries and application thereof | |
| CN116240113B (en) | Biocontrol bacterium JSNL-B47 for inhibiting strawberry anthracnose and application thereof | |
| CN112961784A (en) | Endophytic Alternaria Aa-Lcht and application thereof in preventing and treating apple tree canker | |
| CN117844652B (en) | Strawberry root rot biocontrol bacterium JSNL-B44 and application thereof | |
| CN118562631B (en) | Aspergillus awamori JS2-74 and application thereof | |
| CN114774291B (en) | Trichoderma asperellum 10564 strain and application thereof in biocontrol of tomato fusarium wilt | |
| CN115029268B (en) | Streptomyces venezuelae and application thereof in crop disease control | |
| CN114134051B (en) | Penicillium citrinum YW322, culture method, microbial inoculum and application thereof | |
| CN114891645B (en) | Trichoderma asperellum HB40619 and application thereof | |
| CN116286536B (en) | Bacillus cereus YZ-228 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |