CN1161716A - Isoamylase gene from flaviobacterium sp. compositions contg. it, and method using it - Google Patents

Abstract

A method of producing plant products containing modified starch content, including higher ratios of amylose to amylopectin, increase in intermediate material, or amylopectin having fewer branches or altered branching pattern. Also provided are DNA constructs and transformed plant cells useful in that method. The preferred method uses isoamylase from a Flavobacteriumsp., more preferrably in combination with a gene encoding ADPglucose pyrophosphorylase. Also disclosed are the gene from Flavobacteriumsp. and transformed bacterial and plant cells containing a derivative thereof.

Description

New isoamylase gene contains the composition of this isoamylase gene and uses the method for isoamylase

Background of invention

Most of plant amylums are by two kinds of polysaccharide parts, and amylopectin and amylose starch are formed.According to the plant origin difference, the starch amylopectin is generally in the 70-85% scope, and amylose starch is equivalent to 15-30%.Hyperbranchedization and be brush shape amylopectin by α-1, the D-glucosyl residue linear chain that the 4-key connects constitutes, average every 20-25 D-glucosyl residue is by α-1 usually, the 6-glucoside bond divides branching together.The amylose starch part is by linear α-1, and the D-glucose polymer that the 4-key connects is formed, and average per 1000 linear D-glucosyl residues have a α-1,6-D-glucoside bond.The basic linear behaviour of amylose starch makes its formation and lipid acid, low-molecular-weight alcohol and iodine compound spirane structure.The amylopectin molecular weight is approximately 10 ⁷, the polymerization degree is several thousand or bigger, and the amylose molecule amount approximately is 10 ⁵, polymerization degree scope by W-Gum about 900 to 4000 of yam starch.In addition, contain slight minute branching, be construed to the third part of intermediate material from the starch of some plant varieties.Although do not characterized widely, this middle portion is similar to amylopectin and amylose starch, and it has the polymerization degree less than 1000, and can by four or five chain lengths be 50 or the branch branched chain of longer glucosyl residue constitute.

In known a lot of plant species mutant is arranged, wherein amylose starch increases with the ratio of amylopectin.The starch products of this mutant has commercial value, but because a lot of problems comprise the staple crop of finding this mutant, i.e. the low yield of total amount starch in corn and the rice, and limited to production.Three kinds of corn embryosperm mutants are arranged, amylose starch supplement type (amylose extender) (ae), dim type (du-1) and sugar-containing type (su-1), the amylose starch that contains increase in its particle, but obviously much lower starch productive rate (Press, J. " biological chemistry of crop " TheBiochemistry of Plants V.14, New York is arranged, year publishes, and 1988).The also known cold storage properties of various potatos (ND 860-2) with straight chain content of increase with raising.

The starch of high amylose starch composition has the film that has mainly brought by having given the gel-strength of beat all increase because of the amylose starch retrogradation and generates and the gelation critical nature, advantage comprises a) the outer field oil number of reduction friedcake mashed prod, b) gelification faster (time of drying of reduction), with enhanced structure and quality in candy and the soft fruit jelly soft sweets, and c) prevent that microwave food is underbaked and excessive clear-cut.And the amylose content that increases in food such as potato and the corn can bring the remarkable reduction of fried potato or corn product card Louis value, mainly is to absorb by reducing oil.At last, the increase content of amylose starch is to the useful influence of non-edible purposes of starch, as in papermaking, packing, in textile industry, for paper feeding and cardboard gluing, for drenched pulp additive, for wrinkling paperboard laminate.

Isoamylase (glycogen 6-glucose lytic enzyme, E (3,2,1,68) α-1 of hydrolyzed starch, glycogen and deutero-oligosaccharides, the 6-D-glucoside bond, it is considered to direct debranching factor, because the glycogen and the starch of its contact unmodified, on the contrary, it is initial polymer-modified that enzyme that non-direct debranching factor need have earlier causes.Isoamylase is different from other main starch-debranching enzyme, and Starch debranching enzyme is because all α-1 of its energy cracking glycogen, 6 keys, but α-1,6 key that can not the cracking amylopectin, and Starch debranching enzyme becomes trisaccharide maltose with the amylopectin complete hydrolysis, but the debranching activity on its glycogen is limited.The bacterium of known generation isoamylase comprises pseudomonas SMP1, Pseudomonas amyloderomosa SB-15, Flavobacterium (Flavobacterium sp.) Cytophaga (bacteriolyze genus), the pro-alkaline strain of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) and bacillus.

More high plant is considered to only contain the debranching factor of Starch debranching enzyme type, Ishizaki etc., " agricultural biochemistry " Agric.Biol.Chem.) 47:771-779,1983, Lee and whelan " glycogen and starch-debranching enzyme ", P.191-234, P.D.Boyer (ed), " enzyme " (TheEnzymes), Vol5,1971) described from the isoamylase of inferring in the potato tuber.Also described from two kinds of the same block stem extract different Starch debranching enzymes.The potato isoamylase has the substrate specificity similar to the pseudomonas isoamylase, but higher pH is arranged just when (5.5-6.0), and is made up of the dipolymer that tentative molecular weight is 178.000Kd.The physiological action of potato isoamylase is also not fully aware of, but infers that its enzyme of participating in starch during sprouting decomposes.Having reported a kind of potato debranching factor activity is Starch debranching enzyme sample (the vegetable polysaccharides engineering is international symposium for the first time for Kossman, J. etc., Trondheim, Norway, in June, 1994).

An object of the present invention is to provide the method for a kind of production than high amylose content starch.Another object of the present invention provides has low α-1, and the 6-D-glucuronide divides branching or changes branch branching pattern, thereby has the structural modification starch for the improved functional property of food and non-food product purposes.Further aim of the present invention provides employed DNA construction and the vegetable cell that comprises these constructions in this method.A further object of the present invention provides the food crops that has the working ability of improvement owing to the structural modification of starch content.Another object of the present invention provide can produce have improved pH just when the transform bacteria of isoamylase.A further object of the present invention provides the method that makes starch debranching with isoamylase.Summary of the invention

The invention provides a kind of from Flavobacterium isoamylase gene, shown in SEQ ID NO:1.The present invention further provides the DNA construction that comprises following working order:

A) in vegetable cell, work, cause the promotor that the RNA sequence produces;

B) coding isoamylase structured coding sequence; And

C) in described vegetable cell, work 3 '-non-translational region, it causes that polyadenylic acid ester (polyadenylate) Nucleotide joins 3 ' terminal of RNA sequence; Wherein said promotor is allogenic for the structured coding sequence, and wherein said promotor is connected with described structured coding series of operations, and it then is operatively connected with described non-translational region.The structured coding sequence preference further comprises the sequence of coding plastid target sequence.The present invention further provides and be converted to the vegetable cell that comprises described DNA construction.Preferred isoamylase has about 5 to about 8 optimal pH, and most preferred isoamylase has sequence shown in the SEQ ID NO:11.

Can randomly comprise with DNA construction plant transformed of the present invention provides other improved other allogeneic dna sequence DNA.These improvement may be irrelevant with Starch Production, resistance to insecticides for example, disease resistance, or insect-resistant.Perhaps, can use with the plant underground organization in the relevant gene of Starch Production.Example comprises granule in conjunction with amylosynthease, starch branching enzyme, soluble starch synthetic enzyme and ADP-glucose pyrophosphorylase.The expression of native starch branching enzyme also can be by use reverse sequence (antisense) or for carrying out the negative adjusting that other method of other modification is carried out in the starch molecule.Preferred plant of the present invention also contains the gene of expressing heterologous or external ADP glucose pyrophosphorylase, more preferably the intestinal bacteria glgC16 gene of ADP glucose pyrophosphorylase.It is disclosed in WO91/19806 (Kishore) plant with by the application in the conversion plant, is equivalent to U.S.'s registration number 08/120703, and the applying date is on July 13rd, 1993, is incorporated herein by reference here.

The present invention further provides production method than high amylose content or structural modification starch content starch, comprise vegetable cell is changed into the cell that comprises described DNA construction, make whole plants regeneration, make described plant propagation, gather in the crops raw material from it, and from wherein extracting starch.

The present invention further provides the new farm crop of starch content, comprise vegetable cell is changed into the cell that comprises described DNA construction, make whole plants regeneration, and gather in the crops amyloid crop with modification.This farm crop can comprise potato tuber, the root of cassava or sweet potato, and cereal, wheat, rice, or the seed of barley.

The present invention further provides have coding have basically aminoacid sequence isoamylase gene shown in the SEQ ID NO:11 by the inverting biological body.The present invention further provides the isolating isoamylase that can be used to take off this transform bacteria production of propping up starch.

Here employed term " isoamylase " refers to energy hydrolyzed starch, the α-1 of glycogen and deutero-oligosaccharides, the enzyme of 6-D-glucoside bond.

Here employed term " the starch content of modification " refers to contain the branch branching pattern that less minute branching or change are arranged, the intermediate material of increase, and/or the starch of higher amylose starch and the amylopectin of the ratio of amylopectin.Here employed term " starch structure of modification " refers to have the branch branching pattern of less minute branching or change, the intermediate material of increase, and/or than the amylopectin of high amylose starch with the ratio of amylopectin.Here employed term " structural modification starch " refers to have the branch branching pattern of less minute branching or change, the intermediate material of increase, and/or than the starch of high amylose starch with the amylopectin of the ratio of amylopectin.Under all situations, the starch of modification is with except that the isoamylase gene of introducing, and the starch of homogenic type plant production is compared.Detailed description of the invention

The invention provides a kind of production has the novel method of the plant amylum of structural modification starch structure, and preferably including must be than the ratio of high amylose starch with amylopectin by the plant that transforms production starch with the polypeptide gene that isoamylase is arranged.Gene can include active plant of isoamylase and microorganism from multiple source.Preferred isoamylase has about 5 to about 8 optimal pH, and this pH is near the amyloplast internal pH.This isoamylase is provided.

Brief and concise for exposing, below the present invention describe the isoamylase be limited to Flavobacterium in detail.The method that those skilled in the art understand this paper explanation easily can be applicable to the isoamylase gene of use from other source.The Flavobacterium isoamylase

The isoamylase that is used for testing below is by a kind of organism natural production, and this organism is a feature with the kind of Flavobacterium, is disclosed in Sato, H.H. and Park, Y.K.Starch 32:132-136,1980.Flavobacterium or in LB meat soup, under 28 ℃, sways aerobic growth with 200rpm on LuriaBertani (LB) agar.

Be the purifying isoamylase, at 500ml 0.1% tryptone, 0.2% yeast extract in 0.1% casein hydrolysate and 0.8% maltose, under 30 ℃, sways with 225rpm flavobacterium in 2 liters of flasks, grows 20 hours.With the centrifugal removal cell of 15000 * g, supernatant liquor filters by 0.2 μ m filter.Acellular supernatant liquor stirs in the cell concentration device at the Amicon that has the YM-10 film and is concentrated into 20ml, is concentrated into 2ml then in the centrifugal thickener of Amicon Centriprep-30.Retention is added to uses 100mM, and on the amylose starch of the sodium phosphate of pH6.5 (buffer A) pre-equilibration/agarose affinity matrix post (2.5cm * 5cm)., perhaps do not come out with 1.5ml/min speed flushing pillar with the 250ml buffer A up to having to detect protein wash-out in washing fluid.Isoamylase is eluted from post with the speed of 25% maltose buffer A with 1.5ml/min.Be associated with active 1ml fraction,, it be concentrated into 250 μ l with Amicon Centriprep-30 and the centrifugal thickener of AmiconCentriprep-30, and with the buffer A pre-equilibration with removal maltose.Add glycerine, reach 20% ultimate density, isoamylase is preserved down at 4 ℃, up to assessing purity with SDS-PAGE.

Measure by SDS-PAGE, the isoamylase molecular weight together is purified into the molecular weight ranges 70-75kD second little swimming band in the 80-85kD scope.Measure by standard iodine, it is about 50000 units/mg protein than work.[use the 1ml1% amylopectin, 0.2ml 0.2M sodium phosphate (pH6.5), the 0-0.2ml zymin, and add water and make final volume reach 1.4ml, prepare a mixture.After adding enzyme, reaction mixture is at 40 ℃ of incubations.With different time at interval, the 0.2ml reaction mixture is added to 0.2ml 0.2%I ₂, 2.0%KI, 0.2%H ₂SO ₄In, and be diluted with water to 10ml.After following 15 minutes of the room temperature, read absorption value at the 610nm place.One unit isoamylase activity is defined as the amount of the enzyme of 31 610nm absorption value increases by 0.01 in 1 hour].

These results are different from the result of Sato and Park report, and (molecular weight measured of size exclusion chromatography is 121000, and final is 11110 units/mg albumen than work.The difference of molecular weight may be measured owing to more accurate SDS-PAGE.And may be owing to the difference of lipidated protein, because in former report, report with the homoplasmon that the isoamylase purifying is become of SDS-PAGE mensuration than the difference of living.The N-end sequence is measured

Directly, carry out the sequencing of the flavobacterium enzyme (75 μ g) of purifying in the pH6.5 sodium phosphate at 75 μ l (3 * 25 μ l carrying capacity), 200 μ M.N-terminal is used Applied Biosystems, 470A type gas phase sequenator, automatic edman degradation chemistry, the circulation of application standard sequenator, 0.3 RPTH.Use the 120A PTH type analysis instrument that is equipped with Brownlee 2.1mm I.D.PTH-C18 post of Applied Biosystems to carry out each PTH-aa derivative of RP-HPLC Analysis and Identification, detect following N-end sequence: AIDAQQLGARYDAAQANLAFRVYSSRATXVEXFLYKNP (SEQ ID NO:3) with on-line mode.This sequence is with to use the N-end sequence of ripe pseudomonas isoamylase (Tognoni etc., J.Gen.Microbiol.135:37-45,1989) through processing to have 55% identical, show between the secretory phase may be from the cracking of flavobacterium isoamylase signal peptide.

Also will from the flavobacterium culture, become the isoamylase of homogeneity to go up trace by purifying at pvdf membrane (Immobilon, Nillipore Corp.).Downcut main (on) and little (descending) band.Trace directly circulates with sequenator in the terminal mode of N-to the sample on the PVDF, and 01RPVD carries out sequencing.Two band PVDF trace N-end sequences are identical and corresponding to SEQID NO:3, this shows in the body or natural enzyme may be in the terminal brachymemma of C-during the purifying.Gene sequencing

With Sambiook etc., " molecular cloning: experimental implementation " second edition, Cold Spring HarborLaboratory Press, Cold Spring Harbor N.Y, 1989, the standard scheme of explanation carries out all basic DNA operations, as PCR, agarose electrophoresis, restrictive diges-tion, ligation, intestinal bacteria transform, indigo plant-Bai bacterium colony screening, bacterium colony pipettes and the Southern trace.

With derive from 24 hours 100ml flavobacterium cultures the cell precipitation thing be suspended in 3.5ml10mM EDTA, 25mM Tris (pH8.0), 5% glycerine, and add 400 μ l10%SDS.Suspension was hatched on ice bath 10 minutes, on dry ice freezing 10 minutes then.Melt suspended substance, and in 70 ℃ of water-baths, follow once in a while and jiggle, heated 5 minutes or until cytolysis.Twice usefulness 4ml phenol-chloroform (1: 1) once uses chloroform-primary isoamyl alcohol (24: 1) carefully to extract the cytolysis thing then, and adds 10ml dehydrated alcohol deposit D NA.Need not be centrifugal, the supernatant liquor that inclines, and DNA precipitation separated the Tris in 2ml10mM, pH8.0,1.0mM EDTA (TE8 damping fluid).Need not be centrifugal, with 225 μ l 3M sodium acetates, PH5.2 and 6.0ml ethanol sedimentation DNA.Throw out is dissolved among the 0.5ml TE8 again, handles 20 minutes at 37 ℃ with the RNA enzyme (U.S. Biochemics Inc.) of the no DNA enzyme of 25 μ l (300 unit), uses equal-volume phenol-chloroform extraction then.Deposit D NA is dissolved in the TE8 damping fluid again, to (4 * 1.0L) dialysis 18 hours of TE8 damping fluid.

Produce the isoamylase dna probe by pcr amplification from the flavobacterium chromosomal DNA.Design in the consensus amino acid sequences of degenerate pcr primer two high conservatives from the bacterial dextran enzyme.These two sequences are SEQ ID NO:8 and SEQ ID NO:9.Particularly, the enzyme sequence of use is the pseudomonas isoamylase, pneumobacillus (Klebsiella pneumoniae) Starch debranching enzyme, and the enzyme sequence of the new Starch debranching enzyme of bacstearothermophilus (Bacillus stearothermophilus).Also use high GC content design oligonucleotides primer, reflect flavobacterium genome high GC content.

The PCR cycling condition: 94 ℃, 3 '; 60 ℃, 2 '; 72 ℃, 3 '; (5 circulations); 94 ℃, 30s; 60 ℃, 2 '; 72 ℃, 3 ' (30 circulations).260 bp PCR products are gel-purified, are connected to the EcoRV site of pBSSK+, and according to the description of Sambrook etc., screen separating clone by indigo plant-Bai.

The 260 bp PCR product nucleotide sequences that produce from the flavobacterium chromosomal DNA are SEQ IDNO:4.Sequential analysis shows that it is identical with same section 56% in the disclosed pseudomonas isoamylases such as Tognoni on amino acid levels.This 260 bp fragment is used according to Genius ^TMThe digoxigenin random primer labelling of on-radiation dna marker system.

Flavobacterium genomic dna BamHI, BglII, ClaI, EcoRI, NotI, PstI, SacI and XhoI complete digestion separately.Digest Southern trace to Zeta-probe film (Bio-Rad), was toasted 1 hour down for 80 ℃ in vacuum, make probe with 260 bp fragments of digoxigenin mark, and according to Genius ^TMThe requirement of on-radiation detection architecture detects.Spend the night 68 ℃ of hybridization, 68 ℃ with 0.2 * SSC, 0.1%SDS does last flushing.Each digest obtains a wall scroll probe These positive bands, BglII, and NotI and PstI provide about 10kb respectively, 9kb and 5kb band.Genome BglII fragment (9-12kb), NotI fragment (7-10kb) is separated by the preparation agarose gel electrophoresis with PstI fragment (4-6kb), and is connected to their pBSSK+ dephosphorylation sites separately.Connector transformed into escherichia coli DH5 α, and the transformant bacterium colony pipetted Hybond ^TMOn-N+ the nylon membrane.One face up what bacterium colony was arranged and film is placed on the fresh LB-penbritin flat board and 37 ℃ of incubations 4 hours.Film is placed on order uses 10%SDS, then use 0.5M NaOH, then use 1M Tris-HCl, pH8.0, the Whatman 3MM paper that 1.5M NaCl is saturated dissolved bacterium colony last 5 minute.Remove cell residue fully with 5 * SSC flushing, film was 80 ℃ of oven dry of vacuum 1 hour.

The hybridization of identical 260 bp probes (SEQ ID NO:4) and detection are basically according to the explanation with the Southern trace.The positive bacterium colony of the probe of inferring is that plasmid DNA prepares, and inserts fragment for probe is positive by the calibrating of Southern blot hybridization.Be screening isoamylase activity, with two NotI probe positive colonies, three PstI probe positive colonies transform the intestinal bacteria SR193 that comprises pGP1-4 respectively, and with pBSSK+ in contrast.Intestinal bacteria SR193 contains temperature sensitive, excision-damaged λ prophage.When 28 ℃ down the bacterium colonies of growth be transferred and during at 37 ℃ of incubations, the λ lysis genes is induced, and bacterium colony is owing to cell wall degradation becomes " porous " shape.PGP1-4 is the plasmid based on ColE1, its be included in can be thermoinducible phage t7 RNA polymerase and thermo-responsive λ repressor CI857 gene (Tabor etc., Proc.Natl.Acad.Sci.USA under the control of λ PL promotor, 82:1074-1078,1985).The transformant kind on the LB agar plate of penbritin and kantlex, is measured the expression of isoamylase containing amylopectin (1%) with dull and stereotyped detection assay.[the dull and stereotyped detection assay of isoamylase: at 28 ℃ of initial incubations after 20 hours, perhaps when colony diameter is 1mM, flat board is transferred to other 20 hours of 37 ℃ of incubations transcribe with inducing cell wall seepage (λ lysis genes) and t7 rna polymerase.Be inverted flat board, add several 2%I ₂, 1%KI, 25% ethanolic soln surrounds bacterium colony by blue halogen and detects isoamylase activity (because amylose starch produces from amylopectin)].

The NotI clone does not show the isoamylase activity; And the PstI clone shows the blue halogen bacterium colony of intensive owing to discharging active isoamylase.Selection has 4.9kb PstI to insert segmental a kind of active isolate to carry out all following analyses, and note is made pMON 17481.

From the restricted fragment of the PstI inset of pMON 17481 in pBSSK+ and pBSKS+ at the both direction subclone.With preparing single stranded DNA from the intestinal bacteria JM101 that is loaded with pMON 17481 derivatives after MBK 07 helper phage (Bio-Rad) superingection.Use is available from the strand Phage of Bio101 ^TMDNA Seperating box purification of single stranded DNA uses the TA Quence available from U.S.'s biochemical corp ^TMVersion 2.0 dna sequencing boxes carry out sequencing by the dideoxy-chain terminating method.Have or do not have the 7-denitrification assorted-situation of dGTP under, with conventional synthetic primer both direction order-checking flavobacterium isoamylase open reading frame and 5 ' with 3 ' non-translational region.Use the Wisconsin GCG of university sequence analysis software and carry out sequential analysis.

So the nucleotide sequence of measuring is shown in SEQ ID NO:1.2334 bp open reading frame of 777 amino acid preferments of coding are found in sequential analysis.This translation (SEQ ID NO:2) estimated molecular weight 84340.Expression in the intestinal bacteria

With pMON 17481 is template, carries out PCR mutagenesis, removes the microorganism signal sequence from clone gene.Primer below the design adds the starting point of methionine residue in the ripe isoamylase (L-Ala-33) through processing, and makes translation cause other terminator codon (TAA) 3 ' adjacent with endogenous TGA codon.This primer also comprises the terminal NcoI of N-and terminal SacI of C-and EcoRI site.The N-end: 5 '-GGGGCCATGGCCATCGATGCGCAGCAGCTCGGCGCGCGCTACGAC-3 ' (SEQ ID NO:5).The C-end: 5 '-CCCCGAATTCGAGCTCTTATCACTTCGCGATCAGCAACAGCAGCGA-3 ' (SEQ ID NO:6).

Since the encoding sequence high GC content, PCR reaction needed 5% methane amide or 10%DMSO final concentration.The PCR cycling condition is as follows: 96 ℃, 3 '; 65 ℃, 2 '; 72 ℃, 3 ' (5 circulations); Each reaction adds the 5 other Taq of unit polysaccharases, and then 94 ℃, 30s; 65 ℃, 2 '; 72 ℃, 3 '+20 sec/ circulation (30 circulations).2.3kb PCR product (SEQ ID NO:10) carries out gel-purified, and is cloned into the NcoI-EcoRI site of PUC for the escherichia coli vector on basis, wherein the polylinker of Xiu Shiing is arranged in semi-lactosi Z α-peptide gene, and expresses with the lactose promoters driven.Identify the clone who has 2.3kb to insert fragment (SEQ NO:10) at intestinal bacteria JM101 with indigo plant-Bai screening.By the marking protein sequence shown in SEQ ID NO:11.

Isoamylase also can prepare [37 ℃, with 0.5mM IPTG abduction delivering, optical density(OD) (610nm) is 0.5 for 25ml penbritin meat soup, 200rpm] from the liquid culture of intestinal bacteria JM101 transformant.Induce 3 hours postprecipitation cells, resuspending is in 500 μ l100m/K, in the sodium phosphate of pH6.5, and on ice with 30% relative peak power sonication 2 * 10 seconds (Heat Systems-Ultrasonics, Inc., W-375 type).Granular cell solute centrifugal 5 minutes with 12000 * g.And by debranching activity in the above-mentioned standard iodine measuring method mensuration supernatant liquor.

Select to produce the active isolate of high-level isoamylase, pMON 17408, and with the NcoI-EcoRI site of 2.3kb inset (SEQ ID NO:10) subclone to coli expression carrier, obtain pMON17409.This carrier comprises pACYC replicon and synthetic G10 target sequence ribosome bind site, wherein expresses from the lactose promoters driven.By realize the expression of the high-level isoamylase of pMON17409 in intestinal bacteria JM101 with the IPTG inducing action of 500ml LB-kantlex substratum (as mentioned above), induce back 0,1,2, with 3 hours, take out the 1ml equal portions from substratum, precipitation, resuspending are equivalent in the Laemmli sample buffer of Klett unit's optical density(OD) on the quantity of 1 volume (μ ls), and seethed with excitement 8 minutes.SDS-PAGE measures the proteinic appearance of 80-85Kd that new height is expressed.Remaining cell precipitates when inducing back 3 hours, and resuspending is in 8ml 100mM, in the sodium phosphate of pH6.5, and sonication on ice 2 * 20 seconds, and with 15000 * g centrifugal 5 minutes.

As mentioned above the isoamylase purifying that obtains in the thick supernatant liquor in the cell in the 500ml substratum is become homogeneous.By the cross reactivity of protein (Western) engram analysis with the reorganization isoamylase of anti-flavobacterium isoamylase polyclonal antibody purification Identification.Interesting is not detect the little 70-75kd band of isoamylase visible outside the born of the same parents of flavobacterium purifying, and the terminal brachymemma of this proof donor enzyme C-is because the cracking of flavobacterium proteolytic enzyme.The recombinase of purifying (SEQ IDNO:11) has about 50600 units/mg than living, and similar in appearance to the value of being measured for the donor enzyme of purifying, and measures according to SDS-PAGE the same molecular amount is arranged.Other host who is used to ferment

Isoamylase of the present invention (SEQ ID NO:11) can or from various host organisms, produce and preparation.The gene of producing this enzyme in a kind of host organisms can be the gene (SEQ ID NO:1) or the mature sequence gene (SEQ IDNO:10) of the non-mature sequence of secretion signal sequence.Perhaps also can use the natural secretory signal sequence of host organisms.

The intestinal bacteria that transformed can be used for the fermentative preparation isoamylase as mentioned above.Perhaps, can use bacillus, as " molecular biology method of bacillus ", Harwood etc. (eds.), New York: Wiley-Inter-Science describes in 1990.Also can be referring to F.G.Priest, " microbiology outline " (Aspects of Microbiology), 9, " perienzyme " (Extracellulasr Enzymes), Washington: AAM, 1984.

Barms also can be used in the production of heterologous polypeptide.Those skilled in the art are familiar with the mechanism of yeast conversion and fermentation.General explanation can be referring to (1) " biotechnology ", and 13 (1): 18-19,1992; (2) " the up-to-date trend of biotechnology " (Current Opinion inBiotechnology), 3:486-496,1992.

Perhaps, insect cell can be used for producing needed peptide, for example, and by getting the flavobacterium isoamylase with the baculovirus particles transfectional cell culture that transforms.Referring to Summers etc., Texas Exp.Station Bull.1555:1-57.Application in taking off a starch

The isoamylase of producing with recombinant chou intestinal bacteria or other organism can be used for the preparation from the various products of plant amylum.Take off is to prepare a step the high-fructose corn syrup from W-Gum.It is those favourable application near neutral pH wherein that the character of this specific debranching factor is specially adapted to it.Usually, only have that to have optimal pH be that the pseudomonas isoamylase of 3-4 is the commercially available isoamylase that is used for starch structure analysis and the processing of food uses starch.It is the amylase of 4.0-5.5 that the WO94/13792 of PCT application recently report has found to derive from Bacillus licheniformis (BacillusLicheniformis) optimal pH.It is reported that it is used in need not regulate pH to produce in the glucose by " liquefaction W-Gum " be favourable.Therefore, use the flavobacterium isoamylase that the further improvement of this method is provided because it both made in addition also work near neutral pH.

Under the standard iodine condition determination, at the 50mM acetate, 50mM MES measures in the 100mM Tris damping fluid, and the optimal pH of the isoamylase of being produced by pMON17409 of purifying is in the 4-9.5pH scope.Calculate relative reactivity (maximum value per-cent) with initial linear speed.For making the pH beta stability line, with Amicon Centricon-30 thickener with the pMON17409 reequilibrate of purifying in the 8mM sodium phosphate, pH6.5,20% glycerine.In 3.5 μ l enzymes, add 2.0 μ l175mM acetates, 175mM MES, 305mM Tris store buffer liquid, getting ultimate density is the 64mM acetate, 64mM MES, 127mM Tris.Then with in the pH4.5-9.5 scope, with enzyme 40 ℃ of incubations 30 minutes.Measure with standard iodine then, at the 50mM acetate, 50mM MES, 100mM Tris, the final concentration of pH6.5 measure the residual isoamylase activity of 5.5 μ l mixtures down.

The result shows, optimal pH 6.0-7.0, and it is similar to 6.3 value (Sato and Park) of the donor enzyme of previous report.At pH6.5-7.0 the suitableeest stability is arranged.But when when measuring for 22 ℃, the recombinant chou isoamylase shows wider activity and stable optimal pH 5.0-8.0.

To the oyster glycogen, the rabbit liver glycogen, corn amylopectin, rice starch, yam starch and amylopectin are measured the recombinant chou isoamylase substrate specificity of the purifying that is obtained by pMON 17409.From measuring than living at the initial velocity of pH6.5 hydrolysis.Purification of Recombinant body isoamylase takes off the speed of relative movement that props up with various minutes branching polysaccharide and sees Table 1.This enzyme has the highest substrate specificity for glycogen, but hydrolyzed starch hardly, enzyme of this conclusive evidence purifying is an isoamylase.

Table 1

Substrate is than living ^*

Oyster 182

Rabbit liver glycogen 174

Corn amylopectin 172

Rice starch 154

Yam starch 120

Amylopectin 3

^*The micromole of the reduction group that S.A..=discharges counts the conversion of plant

Expression comprises by RNA polymerase and transcribes messenger RNA(mRNA) (mRNA) and ensuing processing at the initial transcript of the mRNA of nucleus inside from the chain of DNA with the plant gene that the double-stranded DNA form exists.This process relates to the 3 ' non-translational region that polyadenylic acid ester Nucleotide is added to 3 of RNA ' end.

It is that DNA district by so-called promotor regulates that DNA transcribes mRNA.Promoter region comprises and sends signal RNA polymerase is combined with DNA, and the Transcription that to cause with a DNA chain be template mRNA prepares the base sequence of corresponding complementary strand.

Be used for promotor of the present invention and be causing those promotors of the Transcription of the tissue that starch produces therein.This promotor can perhaps can be that allos is derived in this kind of plant plant from what will be transformed.The example that is used for promotor of the present invention is those promotors that work at potato tuber.Comprise granule in conjunction with amylosynthease, Zulkovsky starch synthetic enzyme, ADP glucose pyrophosphorylase, patatin (I class) sucrose synthase, branching enzyme, promotor (the Gen Bank of debranching factor and stem tuber polyphenoloxidase ^Registration number M 95196 and M 95197).

Cause that the promotor that isoamylase is produced is used for the present invention in seed.Can obtain the gene of the enzyme that relate to the Starch Production and these promotors are used for DNA construction as described herein from any plant seed.Therefore can obtain corn, wheat, the natural promoter of rice and barley also is used for the present invention.

The example of the promotor that works in cereal seed comprises the zein promotor.The genomic clone of zein spirit-soluble gene is separated and open, and the promotor from these clones comprises 15kD, 16kD, and 19kD, 22kD, 27kD and γ gene also can be used to express the isoamylase gene in corn and other plant seed.The promotor of gene below known other promotor that works in corn comprises: wax (waxy), fragility 2 (brittle), shrinkage 2 (shrunken), branching enzyme I and II, amylosynthease, debranching factor, oleosin, gluten, and sucrose synthase.

The example that is suitable for the promotor of expression isoamylase gene in wheat comprises the promotor of those ADPGPP subunit genes, the promotor of granule combination and Zulkovsky starch synthetic enzyme, the promotor of dividing branching and debranching factor, height enriches the proteic promotor of fetal development, the promotor of gliadine and the promotor of gluten.The example of this promotor in rice comprises those promotors of ADPGPP subunit gene, the promotor of granule combination and Zulkovsky starch synthetic enzyme, the promotor of branching enzyme, the promotor of debranching factor, the promotor of sucrose synthase, promotor with gluten, the example that is used for this promotor of barley comprises those promotors of ADPGFPP subunit gene, the promotor of granule combination and Zulkovsky starch synthetic enzyme, the promotor of branching enzyme, the promotor of debranching factor, the promotor of sucrose synthase, hordein promotor, the promotor of embryo's gluten and aleuron specific proteins.

It is a lot of transforming and be used for plant of the present invention.Example includes but not limited to corn, potato, rice, barley, yam, cassava, and wheat.Each of these plants can be used currently known methods to transform by those skilled in the art.Intron

Generally speaking, the suitableeest expression of acquisition in monocotyledons when intron sequences is between promotor and encoding sequence.The example of this intron sequences is Adh1 and Hsp70 intron.The Hsp70 intron of describing among the WO93/19189 is preferred.Plastid target sequence

DNA construction of the present invention can randomly include a plastid target sequence.If they do not comprise a kind of like this sequence, generally can cell cytoplasm, find from the enzyme of structured coding sequence translation so.This kytoplasm enzyme can be used for foodstuff production, because in the process of former plant materials converted products, what it can cause starch takes off branch branching.For example downcut potato tuber, destroy the starch granules body that is wherein contained, starch can be obtained by the branch branching of taking off of kytoplasm isoamylase.The potato product of processing can have the character of improvement above-mentioned, as the oil absorbency of reduction and the quality of improvement.

Randomly, DNA construction of the present invention can prepare with plastid target sequence.A kind of like this target sequence is imported in the plastid protein; During importing, removed the target sequence.Each all will work protein delivery to the plastid of arbitrary type to be sure of chloroplast(id) and amyloplast target sequence.The purposes of two kinds of plastids comprises in the present invention.

Preferred target sequence be modify from Timko etc. in " chemistry is to the influence-rich exemplary discussion of biotechnology " (Impact of Chemistry onBiotechnology-A Multidisciplinary Discussion) that Phillips etc. publishes " nuclear of light synthesizer coding composition genetic engineering in the Arabidopsis plant " (" Genetic Engineering of NuclearEncode Components of the Photosynthetic Apparatus in Arabidopsis "), pp279-295,1988, the chloroplast targeted sequence of deutero-(CTP) in the sequence of middle report.The target sequence (CTP1) of this target by Stark etc. at " science " (Science) 258:287-292, report among " ADP glucose Pyrophosphate phosphohydrolase in plant tissue to the regulation and control of amount of starch " (" Regulation of the amount of starch in plant tissues by ADP glucosepyrophosphorylase ") in 1992, and as shown in SEQ ID NO:7.

Selected plastid target sequence and isoamylase gene Fusion thing can and be used for the present invention with the standard method preparation.Polyadenylation signal

Chimeric plant group 3 ' non-translational region comprises one and works in plant and polyadenylic acid ester Nucleotide is joined the polyadenylation signal of RNA3 ' end.The example in suitable 3 ' district be (1) comprise Agrobacterium tumor inducing (Ti) plasmid gene polyadenylation signal 3 ' transcribe; non-translational region; as nopaline synthase gene (NOS gene); (2) plant gene; resemble soybean storage protein gene and ribulose-1,5-bisphosphate, the little subunit of 5-bisphosphate carboxylase (ssRUBISCO) gene.The isoamylase GENE SOURCES

The isoamylase gene that is used for Plant Transformation DNA construction of the present invention can be any isoamylase gene.Be not only limited to product Flavobacterium gene mentioned above, but it is preferred.If enzyme is not to resemble the plastid that leads above-mentioned, the pH that then needs is not just when perhaps just so strict.For example also can use isoamylase gene from pseudomonas or bacillus.The gene that has been used for the isoamylase commercial production can be transplanted to and contain the plasmid that is suitable for the plant regulating and controlling sequence, and adopts in the present invention.

Another possibility is to use the plant isoamylase, the gene of for example natural potato isoamylase, and it is caused the production of modifying starch by the promotor back that the isoamylase of through engineering approaches enough amounts during causing starch metabolism is produced.Like this, from germinateing to Starch Production, potato isoamylase activity all will exist.Mensuration described herein can be used for the complementation cloning from the isoamylase gene of plant-sourced expression library, and the gene that obtains like this can replace bacterium isoamylase gene.Perhaps, can be by using the protein purification of known technology from the isoamylase gene of plant-sourced, determined amino acid sequence and gene isolation and obtain.

In order to separate this gene, dna primer shown in SEQ ID NO:8 and the SEQ ID NO:9, or have the bigger or less relevant primer that departs from of lower or higher G+C percentage composition gene together to make with round pcr to be used for cloning the isoamylase gene.Perhaps also the end region SEQ ID NO:4 of above-described flavobacterium gene can be separated other isoamylase gene as probe.

The following examples are used the isoamylase gene (hereinafter representing with iam) from flavobacterium, but should not be construed as the where face restriction scope of the invention in office.Those skilled in the art should be appreciated that various other genes and modification, and brachymemma etc. can be fit to method described herein and gene and do not exceed the spirit and scope of the invention.For example can prepare pH just when approaching preferred 5-8 scope, the above known isoamylase mutant of other that discussed derivative with sudden change and screening.In potato, express

Specific expressed in order to obtain stem tuber, construction carrier (pMON 16953), make its comprise stem tuber specificity I level patatin promotor～1.0kb part is (hereinafter with Ppatatin 1.0 expressions, descriptions such as Bevan, " nucleic acids research " (Nucleic Acids Res.) 14:4625:4638,1986), nopaline synthase gene 3 '-untranslated polyadenylation district (NOS3 '), and have the spectinomycin resistance that in intestinal bacteria and Agrobacterium tumefaciens (Agrobacteriumtumefaciens), is used to select.The iam gene separates from pMON 17409 with the NcoI-EcoRI fragment.Chloroplast transit peptides (CTP1) gene (SEQ ID NO:7) as a segmental modification of BglII-NcoI connects the BglII-EcoRI site that enters pMON 16953 by three, is fused to the initial site of translation of iam gene, obtains pMON17411.Be connected to the NotI site of the pMON 17227 and the pMON 17320 of single dephosphorylation from Ppatatin 1.0/CTP1-iam/NOS 3 ' NotI expression cassette of pMON 17411, obtain pMON 17418 and pMON 17419 respectively.PMON 17227 is a kind of Ti-plasmids carriers; open and explanation in people's such as Barry WO92/04449 (1991); here be incorporated herein by reference, pMON 17227 comprises the FMV/CP4 construction that is used for Plant Transformation and regeneration N-((phosphonomethyl)) glycine (glyphosate) selection.PMON 17320 is pMON 17227 derivatives that also comprise the Ppatatin1.0/CTP1-glgC16 box.The ADP glucose Pyrophosphate phosphohydrolase of the modification that CTP1glgC16 fusions encoded K ishore describes in WO91/19806.

Screening is orientated pMON 17418 and pMON 17419 constructions of FMV/CP4 clockwise in intestinal bacteria MM294.Put together pMON 17418 and pMON 17419 moved to by three parental plants with helper plasmid pRK 2013 (Ditta etc., 1980) and remove in the Agrobacterium tumefaciens bacterial strain.

In order to transform Russet Burbank potato as selected marker with N-((phosphonomethyl)) glycine (glyphosate); 75 μ g/ml (spectinomycins have been added at 2ml; in the LB meat soup of 75 μ g kantlex and 50 μ g/ml paraxin with suitable edaphic bacillus overnight incubation.The culture that spends the night is diluted to 1: 10 with MSO or is 0.2-0.33 up to making 600nm place optical density(OD).Get on except that leaf from branch under aseptic condition at the potato plants in three weeks of PM substratum growth of adding the 25mg/ml xitix.Branch is cut into the section of 3-5mm.And in square substratum ware, use and dilute microbionation 15 minutes.Explant places on the common culture plate, contains 1/10MSO on the flat board, and with (tobacco the is raised cell) cell of wet filter paper upper berth 1.5mlT * D).Each dull and stereotyped going up is amplified about 50 sections explants.After cultivating altogether in two days, explant placed on the corpus callosum inducing culture cultivated 2 days, described substratum contains 5.0mg/l Zeatin Riboside, 10mg/lAgNO ₃With the 0.1mg/l naphthylacetic acid.Explant is transferred successively in the corpus callosum inducing culture that contains N-((phosphonomethyl)) glycine that 0.025mM is used to select.The four stars after date places explant to contain 5.0mg/l Zeatin Riboside, 10mg/l AgNO ₃And on the stem inducing culture of 0.3mg/l gibberic acid and 0.025mM N-((phosphonomethyl)) glycine.During 8 weeks, occur sprouting, every four stars phase is transferred to explant in the fresh stem inducing culture, cultivates for 12 weeks altogether.Downcut spray and place on the PM substratum and cultivate about 2 weeks, perhaps big to a certain degree being implanted into soil up to spray.The condition in two months greenhouses comprises 14 hours photoperiod, light intensity 600 μ E, 60% relative humidity, fertilising, 19 ℃ of insulations in 25 ℃/night of daytime.Trimestral condition changes 12 hours photoperiod into, does not apply fertilizer 12 ℃ of insulations in 25 ℃/night of daytime.After this gather in the crops rhizome.Analyze and transformed the potato rhizome

In 24 strain plants with pMON 17419 conversions, there are some rhizome proportions to increase to some extent, are similar to the potato that contains glg C16 gene of previous report.

The sophisticated greenhouse growth rhizome of handling control group and being transformed need not extract damping fluid, by Barun high speed juicer, then at once with centrifugal 5 minutes sedimentation starch particles of 2000 * g.Freezing supernatant liquor and on dry ice-80 ℃ of preservations.There is new band in the protein analysis proof of supernatant liquor of rhizome extracting solution of squeezing the juice, and it has the molecular weight lower than flavobacterium isoamylase, may be because proteolysis.Even also be like this in the presence of proteinase inhibitor.

Sedimentary starch granules body and function is counted volume cold (4 ℃) water washing also centrifugal six times, then with two volumes cold (20 ℃) washing with acetone.The particulate matter air is air-dry and 4 ℃ of preservations.

For carrying out western blot analysis, at 10ml1.0%SDS, 50mMTris-HCl, pH7.5 mesoscale eddies 3 minutes be with the lift-off particles surface protein with the 1.0g particulate matter, and with 2000 * g centrifugal 5 minutes.Repeat this operation, particulate matter is washed 5 times in 10ml water, uses twice of 5ml washing with acetone then.The protein that inside is embedded in the particle extracted from the particle that SDS washed by the 100mg particle is boiled in 1.0ml Laemmli sample buffer in 6 minutes.The Laemmli starch gel is immersed in the micro tube with 200 μ l valinche tips, and with 12000 * g centrifugal 10 minutes.Supernatant liquor (every swimming lane carrying capacity is about 0.4 μ g protein) carries out SDS-PAGE, and then western blotting is measured isoamylase protein level in the particle.The particulate protein analysis that the SDS that extracts with the Laemmli sample buffer washs shows that molecular weight is identical with the isoamylase of escherichia coli expression with containing the Flavobacterium isoamylase in the 18 strain particles in 23 strains of pMON 17419 conversions.It is that total particle extracts proteic 0.5-3.0% isoamylase and shows during rhizome extracts by proteasome degradation that western blotting records the isoamylase content range, and the proteinic protein analysis that from the particle of SDS washing, extracts show that isoamylase is protected can be by proteolysis.This result proves that isoamylase not only imports in amyloplast, also is embedded in the particle matrix.Exist isoamylase that enzyme is trapped in the starch skeleton when starch molecule generates crystallization in the starch biosynthesizing.

Starch granules 4 ℃ of preservations is analyzed with light microscopy with Nikon Diaphot-TMD inverted image microscope.Particle (50mg) is suspended in the 2ml water, and at 100 times, 200 times and 400 times of magnifications are estimated 100 μ l suspension under cover glass.PMON 17419 particles that contain isoamylase show that gross morphology changes.Several pMON 17419 strain productions contain the isoamylase particle, and it is microscler, cylindric, is similar to spindle body, and the angle is arranged, and be not spherical, asymmetric, and shape height are irregular.But measure according to western blotting, the isoamylase expression level does not always just in time become dependency with the particle degree of irregularity.Comparatively speaking, wild system, or only with glg C16 transform be produce avette, sphere, and symmetric particle.

Measure the size-grade distribution of starch granules with the Coulter LS130 series particle-size analyzer that has the microbody product module.Magneton stirring rod (regulating 3.5) short mix 1 minute is then used in particle suspension liquid (40mg/10ml water) sonication 1 minute.1 minute sonication time is measured in initial analysis does not have influence to granularity.Obtain duplicate size measurement from the suspension of 800 μ l equal portions sonications.

Table 2 has been summed up the expression level of western blotting appraisal and the subjective judgement of all pMON 17419 strain particle shape degree of irregularities, and selected be the granular size analysis.0 to 10 specification is used for representing the particle degree of irregularity, and 0 expression is normal, and 10 expressions are extremely irregular.The granularity analysis is not a different shapes of judging the transgenosis granule.Data show that 3,19 and 25 strain particles are less.

Table 2

Degree of irregularity protein analysis volume diameter (μ M)

17419-16 0 negative 17419-17 4-17419-18 0 feminine gender among the 17419-14 8 high 17419-15 7 among the 17419-13 5 among 17419-6 10 high 34.74 33.64 17419-12 8 among 30.88 30.84 17419-4,6 high 35.34 34.60 17419-5 2 among the 17419-3 2 among negative 34.76 35.10 17419-1,8 high 35.30 35.45 17419-2 5 of negative 34.50 34.32 wild types-3 0 of negative 35.06 35.37 wild types-2 0 of system's (0-10 specification) isoamylase mean value median wild type-1 0

17419-19 7 is high by 32.92 32.22

17419-20 3 height

17419-21 10 is high by 34.30 33.82

17419-22 0 feminine gender

17419-23 3 is low

17419-25 0 is high by 32.98 32.37

Among the 17419-26 8

17419-27 0 feminine gender

17419-29 5 is low

17419-30 9 height

With the Perkin-Elmer type DSC-7 instrument effect of differential scanning calorimetry method research iam to the modification of starch Thermogelling character.Starch sample (3.0+/-0.1mg) weigh and put into Perkin-Elmer aluminium volatile samples pincers pot, and add 10 μ l distillatory deionized waters.The sealing of sample pincers pot is also weighed again.Scanning samples immediately, sweep velocity is 10 ℃ of per minutes, the scanning from 20 ℃ to 90 ℃.After this weigh sample again to guarantee again the imponderability loss.Measure temperature and enthalpy values with Perkin-Elmer system software 7, except the outlet temperature of the extrapolation of labor measurement (Tm).The results are shown in Table 3.Numerical value is mean value ± standard deviation.For wild-type-1, n=4; Wild-type-2 and wild-type-3, n=2,6 strains, 21 strains and 30 strains, n=3.

Table 3

Endothermic conversion (℃) the gelation enthalpy

Source starting temperature peak temperature final temperature (joule/gm)

Wild-type-1 63.9 ± 0.27 67.1 ± 0.21 70.5 ± 0.25 16.72 ± 0.23

Wild-type-2 66.3 ± 0.07 69.5 ± 0.07 73.4 ± 0.07 16.77 ± 0.28

Wild-type-3 63.5 ± 0.14 66.6 ± 0.14 71.4 ± 0.0 16.85 ± 0.30

pMON17419

Strain 6 63.0 ± 0.35 66.1 ± 0.29 69.5 ± 0.35 16.93 ± 0.68

Strain 21 60.9 ± 0.25 65.0 ± 0.20 69.2 ± 0.10 16.17 ± 0.41

Strain 30 61.6 ± 0.21 65.9 ± 0.06 70.0 ± 0.06 16.26 ± 0.38

Measure according to DSC, the gelatination property of transgenosis granule confirms the granule morphological change.Show owing to changing microscler and the higher amount of minute branching for the lower gelling temperature of iam-glg C16 granule than the intermediate material that causes.And, there is the starch granules body of higher gelling temperature generally to have higher crystallinity, it provides structure and thermostability to granule.DSC result shows that also the transgenosis granule has 1) total lower height rule crystallization structure, and/or 2) less calorifics and structure resistant crystalline region more, and/or 3) low stable amorphous district.Therefore, the perturbation by the active starch biosynthesis mechanism of isoamylase may produce the intermediate material that can not form high-crystallinity.

Use the gradient pump by GP40, with the elutriator of helium pressurization, ED40 pulsed current detector (PAD-II), the Dionex system that pneumatic controller and AS 3500 autopipettes are formed behind the post carries out high performance anion exchange chromatography (HPAEC) (thermal separation product).PAD-II has used a metal working to make electrode and silver-silver chloride reference electrode.Dynamax with Rainin instrument company ^MacIntegrator ^TM, ChromPic ^TM, and Dynamax ^CompareModules software carries out data integrate and analysis.

Be dissolved in the 5ml 0.1N sodium hydroxide by the starch granules body with the 75mg purifying, add 7.5ml water, and boiled 15 minutes, preparation is used for the starch sample of 6,21 and 30 strains (maximum particle shape degree of irregularity be) of HPAEC.(1.0M, the sodium acetate of pH3.5 transfers to about pH4.0 with solution with 2.5ml.Take out 1ml; Add the 200 10-30 μ l of unit) pseudomonas isoamylase (with Amicon centrcon-30 desalination); Be reflected at 37 ℃ of insulations 4 hours, perhaps up to using Somogyi-Nelson method (Hodge and Hofreiter, " organic hydrate chemical process " (Methods in curbohydrate chemistry) New York: year publishes, 1962) measure go back original hase and no longer increase till.The Quick Spin that 500 μ l equal portions starch solutions are crossed by the water in advance balance ^TMThe desalination of G-25 sephadex column.Elutriant transfers to pH12 with 3 μ l, 50% sodium hydroxide, by 0.45 μ m membrane filtration.It is 25 μ l that sample injects volume.CarbPac PA-1 post (Dionex, 4 * 250mm) mensuration chain lengths distributions with online strainer (5 μ m, 35 μ m).Eluent A is a 150mM sodium hydroxide, and eluent B is the 150mM sodium hydroxide that contains the 500mM sodium acetate.The gradient of sodium acetate is as follows: 30% eluent B in the time of 0 minute; 2.0 minute the time 40%, 20 minute the time 60%; 50.0 minute the time 80%; 55.0 minute the time 80%.PAD-II pulse strength (volt) and time length are as follows: E ₁0.05 (t ₁0), E20.05 (t ₂0.2), E ₃0.05 (t ₃0.5), E ₄0.6 (t ₄0.51), E ₅0.6 (t ₅0.59), E ₆-0.6 (t ₆0.6), E ₇-0.6 (t ₇0.65).High purity Fructus Hordei Germinatus oligose (G2-G7) (Hayashibara company) is used for the preparation standard correlation curve.

HPAEC measures the chain length distribution and shows evident difference between the starch that extracts in wild-type system and the transgenic lines.Compare with wild-type system, 6,21 and 30 of pMON17419 is that the chromatogram of the starch of extraction shows that the polymerization degree that has of obvious higher per-cent is 30 and the long-chain branch of Geng Gao.The result shows that transgenosis starch contains the increase of longer distance between the branch branch point and/or intermediate material.This with show that change owing to length/minute branching ratio increases the low gelation value that the DSC of intermediate material records and matches.

By following (1970) such as Williams " cereal chemistry " that changes a little (CerealChemistry), 47 (7): the method among the 411-420, mensuration is the amylose content of isolating starch in the rhizome from the pMON17419 conversion.Accurately 100mg starch is dipped among the 50ml 0.5N KOH.For preventing to lump in the gelation process, stir adding starch fast with the magneton stirring rod.Accurately 10ml starch-KOH solution is transferred in the 100ml volumetric flask several times, and be diluted with water to 100ml.Accurately the starch solution of 20ml dilution is transferred in the new 100ml volumetric flask, and added 10ml 0.1N HCl, then add 1.0ml iodine reagent B.Volume dilution to 100ml, after 5 minutes, is measured absorption value at the 625nm place.In conjunction with the mother liquor of different volumes (cumulative volume 10ml) potato amylose starch (100mg/50ml KOH) and amylopectin potato (100mg/50ml KOH), and be diluted with water to 100ml, come the preparation standard curve.

Duplicate analysis of control (unconverted) tip starch, it contains about 23.6% amylose starch, and the starch that 6,12,14,21,30 strains that pMON17419 transforms produce contains 31.0,25.5,31.3,28.1 and 27.6% amylose starch respectively.Because amylose starch has high-affinity to iodine, intermediate material and the improper amylopectin that contains long-chain branch all have the height IBC for every kind.Therefore, the growth of amylose starch per-cent can be so that amylopectin divides the distance between the branch point longer and/or increase intermediate material.

The amylose content result conforms to DSC result with HPAEC, its show the starch that derives from pMON17419 and 6,21 and 30 strains have longer branch branching dot spacing from.In addition, the increase of amylose content and the granule morphologic correlation that changes from pMON17419 strain starch.Irregular, there is the starch based from the pMON17419 strain cylindraceous at angle to be similar to the granule form of replenishing (extender) starch from the amylose starch of corn, the latter also has been enhanced the level of amylose starch and intermediate material.(Jane, J. etc., " starch " (Starch/st is rke 4.), 46:121-129; Katz, F etc., 1993, " containing carbon polymer " be 21:133-136 (Carb.Polymers)).In monocotyledons, express

Use this area disclosed method, the gene of isoamylase can be transformed in the monocotyledons with being stabilized, and from aftergrowth wherein.Referring to, for example, U.S.'s registration number 08/275929 (Armstrong etc.) is equivalent to EP586355A, discloses the method for conversion and regeneration corn.In order to test the ability that the iam gene is expressed in corn and other monocotyledons, carry out following experiment.

With BglII-EcoRI fragment separation of C TP1-iam fusions, and subclone obtains pMON17431 to the BamHI-EcoRI site based on the carrier of pVC from pMON 17411.CTP-iam fragment among the pMON 17431 is 3 ' to composing type CaMV 35S promoter and HSP70 intron and 5 ' to NOS 3 ' transcription terminator (being E35S/HSP70/CTP1-iam/NOS 3 ').Prepare second carrier similarly, pMON17482, but in order to obtain, the expression after the stable conversion of regeneration corn tissue in the corn seed endosperm places gluten 1 promotor back with the CTP-iam fragment.

Purifying pMON 17431 and blank carrier in intestinal bacteria, duplicate electroporation (each 100 μ gDNA) is in the protoplastis that is made by corn leaf.After about 24 hours, at 100mM, the broken electroporation of cells fraction of sound in the sodium phosphate of pH6.5, and carry out western blot analysis.Instantaneous isoamylase is expressed and is estimated as total extraction proteic 0.1% in the leaf of Semen Maydis protoplastis.

Also can pMON 17431 and plasmid EC9 (Fromm etc., " biotechnology " be 8:833-839 (Biotechnology), 1990) be transformed in Black Mexican Sweet (BMS) the corn corpus callosum tissue together by particle gun bombardment.PEC2 comprises maize mutant ALS cDNA, makes it have the chlorsulfuron resistance, and is started by the E35S promotor.By at 2%SDS, 15% glycerine, 75mM Tris pulverizes tissue among the pH7.4, isolated protein from chlorsulfuron resistance corpus callosum tissue, and carry out western blot analysis.The expression of isoamylase in BMS corpus callosum tissue estimates to account for total extraction proteic 0.025～0.05%.

With BglII-NotI fragment separation of C TP1-iam/NOS 3 ' box from pMON 17411, and subclone obtains pMON17482 to another BamHI-NotI site based on the carrier of pUC.CTP-iam/NOS3 ' fragment among the pMON17482 is 3 ' to endosperm specific paddy protein promoter (P-osgt1) and HSP 70 introns (being P-osgt1/CTP1-iam/NOS 3 ') with cesium chloride density gradient centrifugation about 1mgpMON 17482 of purifying from two liters of intestinal bacteria.By particle gun bombardment with super spirial plasmid DNA maize transformation cell (referring to, for example, EP 586355A, Armstrong etc.).Derive from each corn seed pulverization on liquid nitrogen of Ro plant.By at 100mM Tris, 10mM EDTA, 35mM KCl, 20% glycerine, the pH7.5 mesoscale eddies extracts protein from powder, and carries out western blot analysis.In 18 5 systems that transform in the system, be determined at the expression of isoamylase in the mature seed endosperm.The highest expression of enzymes is that level with a little higher than total extraction proteinic 0.2% contains isoamylase.The starch structure of expectation expression of enzymes is modified in this scope.

Similarly, can use currently known methods, as Vasil etc., disclosed method in U.S. patent 5405765 (VS 5405765 here is incorporated herein by reference) can be with the isoamylase gene transformation in wheat.Promotor is useful in the expression of isoamylase gene iam as discussed above.The HSP70 intron also is used in the wheat conversion carrier.

From the above mentioned, as can be seen, the present invention can fine adaptation finish result proposed above and purpose, and advantage is apparent and intrinsic by the present invention.It is useful should be appreciated that some character and further making up, and can use with further combination with reference to other character.These are included in this claim.Can not implement a lot of possible examples since do not exceed the scope of the invention, should be appreciated that therefore situation that this paper proposes is only in order to describe rather than limit the present invention in detail.

All publications mentioned in the specification sheets and patent are introduced and as a reference here, each publication or patent particularly each be incorporated herein by reference explanation.

The general information of sequence table (1):

(i) applicant:

(A) title: Monsanto company

(B) street: 800 North Lindbergh Boulevard

(C) city: St.Louis

(D) state: Missouri

(E) country: the U.S.

(F) postcode: (ZIP): 63167

(G) phone: (314) 694-3131

(H) fax: (314) 694-5435

(ii)TITLE OF INVENTION：Novel Isoamylase Gene，Compositions

    Containing It and Methods of Using Isoamylases

(iii) sequence number: 11

(iv) computer-reader form:

(A) matrix type: Floppy dish

(B) computer: IBM PC compatibility

(C) operating system: PC-DOS/MS-DOS

(D) software: Patentln Release#1.0, Version#1.30 (EPO)

(vi) priority application day:

(A) application number: US 08/281902

(B) applying date: the 1994-7 month 28 (2) SEQ ID NO:1 information: (i) sequence signature

(A) length: 2334 base-pairs

(B) type: nucleic acid

(C) chain thigh: two strands

( D ) ： ( ii ) ：DNA ( ) ( xi ) ：SEQ ID NO：1： ATGGACCCACACGCCCCGCAGCGGCAACGAAGCGGGCAGCGCTTGCGCGCCCTCGCCCTG 60 GCCGCGCTGGCCTGCGCGCTGAGCCCGGCCCACGCCGCCATCGATGCGCAGCAGCTCGGC 120 GCGCGCTACGACGCCGCCCAGGCCAACCTCGCGTTCCGGGTCTATTCCTCGCGCGCGACC 180 CGCGTCGAGGTGTTCCTGTACAAGAACCCGACCGGCTCGCAGGAAGTCGCGCGGCTGGCG 240 CTGAGCAAGGACCCGGCGACCCAGGTGTGGTCGCTGTCGCTGCCGACCAGCACGATCAAG 300 AACACCTACGGCATCACCGGCGCCGTCTACTACGGTTACCGCGCCTGGGGCCCGAACTGG 360 CCCTACGATGCGGCCTGGACCAAGGGCAGCGCCACCGGCTTCGTCAGCGACGTCGACAAC 420 GCCGGCAACCGTTTCAATCCGAACAAGCTGCTGCTCGACCCCTACGCGCGCGAGATCAGC 480 CAGGACCCGAACACCGCGACCTGCGCCGACGGCACCATCTACGCCACCGGCGCCGCGCAC 540 CGCAACAAGGACAGCGGCCTGTGCGCGAGCAAGGGCATCGCGCTGGCCGCGGACGCGACC 600 TCGGTCGGCAGCAAGCCGACCCGCGCGCTCAAGGACGAGGTGATCTACGAAGTGCACGTG 660 CGCGGCCTGACCCGCAACGACGACAGCGTGCCCGCGGCCGAACGCGGCACCTACAAGGGC 720 GCCGCGCGCAAGGCCGCCGCGTTGGCCGCGCTCGGCGTCACCGCGGTCGAGTTCCTGCCG 780 GTGCAGGAAACCCAGAACGACCAGAACGATGTCGATCCCAATTCCACCGCGGGCGACAAC 840 TACTGGGGCTACATGACCCTCAACTACTTCGCCCCGGACCGCCGCTACGCCTACGACAAG 900 TCGGCCGGCGGGCCGACCCGCGAATGGAAGGCGATGGTCAAGGCCTTCCACGACGCCGGC 960 ATCAAGGTCTACATCGACGTGGTCTACAACCACACCGGCGAAGGCGGCCCGTGGAGCGGC 1020 ACCGACGGGCTCAGCGTCTACAACCTGCTCTCGTTCCGCGGCCTCGACAACCCGGCCTAC 1080 TACTCGCTGAGCAGCGATTACAAGTATCCGTGGGACAACACCGGCGTCGGCGGCAACTAC 1140 AACACCCGCCATCCCATCGCCCAGAACCTGATCGTCGACTCGCTGGCGTACTGGCGCGAC 1200 GCGCTCGGCGTAGACGGTTTCCGCTTCGATCTGGCCTCGGTGCTCGGCAACAGCTGCCAG 1260 CACGGCTGCTTCAACTTCGACAAGAACGACTCGGGCAACGCGCTCAACCGCATCGTCGCC 1320 GAGCTGCCGCCGCGCCCGGCCGCGGGCGGCGCCGGCGCGGACCTGATCGCCGAACCCTGG 1380 GCGATCGGCGGCAACTCCTACCAGGTCGGCGGCTTCCCGGCCGGCTGGGCCGAGTGGAAC 1440 GGCCTCTACCGCGACGCGCTGCGCAAGAAGCAGAACAAGCTCGGCGTGGAAACGGTCACC 1500 CCCGGCACCCTGGCCACGCGCTTCGCCGGCTCCAACGACCTGTACGGCGACGACGGCCGC 1560 AAGCCGTGGCATTCGATCAACTTCGTGGTCGCCCACGACGGCTTCACCCTCAACGACCTG 1620 TACGCCTACAACGACAAGCAGAACAACCAGCCGTGGCCGTACGGGCCGTCCGACGGCGGC 1680 GAGGACCACAACCTGAGCTGGAACCAGGGCGGCATCGTCGCCGAGCAGCGCAAGGCCGCG 1740 CGCACCGGACTGGCGTTGCTGATGCTCAGCGCCGGCGTGCCGATGATCACCGGCGGCGAC 1800 GAGGCGCTGCGCACCCAGTTCGGCAACAACAACACCTACAACCTGGATTCGGCGGCCAAC 1860 TGGCTGTACTGGAGCCGCAGCGCGCTCGGGCCGACCACGAGACCTACACCAAGCGCCTG 1920 ATCGCGTTCCGCAAGGCGCACCCGGCGCTGCGCCCGGCGAACTTCTATTCGGCCAGCGAC 1980 ACCAACGGCAACGTGATGGAGCAGTTGCGCTGGTTCAAGCCCGACGGCGCGCAGGCCGAC 2040 AGCGCCTACTTCAACGGCGCCGACAACCACGCCCTGGCCTGGCGCATCGACGGCAGCGAG 2100 TTCGGCGACAGCGCCAGCGCGATCTACGTCGCCTACAACGGCTGGTCCGGCGCGGTCGAC 2160 TTCAAGCTGCCGTGGCCGGGCACCGGCAAGCAGTGGTACCGGGTCACCGATACCGCGACC 2220 TGGAACGAAGGCCCCAACGCGGTGGCGCTGCCCGGCAGCGAGACCCTGATCGGCGGCGAG 2280 AACACCGTCTACGGCATGCAGGCGCGCTCGCTGCTGTTGCTGATCGCGAAGTGA 2334 ( 2 ) SEQ ID NO：2： ( i )

(A) length: 777 amino acid

(B) type: amino acid

(D) topological structure: linearity, (ii) molecule type: protein, (xi) sequence description: SEQ ID NO:2:Met Asp Pro His Ala Pro Gln Arg Gln Arg Ser Gly Gln Arg Leu Arg 15 10 15 Ala Leu Ala Leu Ala Ala Leu Ala Cys Ala Leu Ser Pro Ala His Ala

     20          25             30 Ala Ile Asp Ala Gln Gln Leu Gly Ala Arg Tyr Asp Ala Ala Gln Ala

  35       40                 45 Asn Leu Ala Phe Arg Val Tyr Ser Ser Arg Ala Thr Arg Val Glu Val   50           55             60 Phe Leu Tyr Lys Asn Pro Thr Gly Ser Gln Glu Val Ala Arg Leu Ala 65            70           75            80 Leu Ser Lys Asp Pro Ala Thr Gln Val Trp Ser Leu Ser Leu Pro Thr

     85           90             95 Ser Thr Ile Lys Asn Thr Tyr Gly Ile Thr Gly Ala Val Tyr Tyr Gly

   100            105         110 Tyr Arg Ala Trp Gly Pro Asn Trp Pro Tyr Asp Ala Ala Trp Thr Lys

 115           120            125 Gly Ser Ala Thr Gly Phe Val Ser Asp Val Asp Asn Ala Gly Asn Arg    130            135           140 Phe Asn Pro Asn Lys Leu Leu Leu Asp Pro Tyr Ala Arg Glu Ile Ser 145           150           155           160 Gln Asp Pro Asn Thr Ala Thr Cys Ala Asp Gly Thr Ile Tyr Ala Thr

      165           170           175 Gly Ala Ala His Arg Asn Lys Asp Ser Gly Leu Cys Ala Ser Lys Gly

    180             185           190 Ile Ala Leu Ala Ala Asp Ala Thr Ser Val Gly Ser Lys Pro Thr Arg

  195           200           205 Ala Leu Lys Asp Glu Val Ile Tyr Glu Val His Val Arg Gly Leu Thr    210          215             220 Arg Asn Asp Asp Ser Val Pro Ala Ala Glu Arg Gly Thr Tyr Lys Gly 225           230       235                 240 Ala Ala Arg Lys Ala Ala Ala Leu Ala Ala Leu Gly Val Thr Ala Val

      245             250             255 Glu Phe Leu Pro Val Gln Glu Thr Gln Asn Asp Gln Asn Asp Val Asp

    260           265          270 Pro Asn Ser Thr Ala Gly Asp Asn Tyr Trp Gly Tyr Met Thr Leu Asn

275           280           285 Tyr Phe Ala Pro Asp Arg Arg Tyr Ala Tyr Asp Lys Ser Ala Gly Gly    290          295             300 Pro Thr Arg Glu Trp Lys Ala Met Val Lys Ala Phe His Asp Ala Gly 305           310             315           320 Ile Lys Val Tyr Ile Asp Val Val Tyr Asn His Thr Gly Glu Gly Gly

        325           330              335 Pro Trp Ser Gly Thr Asp Gly Leu Ser Val Tyr Asn Leu Leu Ser Phe

        340       345           350 Arg Gly Leu Asp Asn Pro Ala Tyr Tyr Ser Leu Ser Ser Asp Tyr Lys

 355          360         365 Tyr Pro Trp Asp Asn Thr Gly Val Gly Gly Asn Tyr Asn Thr Arg His    370          375            380 Pro Ile Ala Gln Asn Leu Ile Val Asp Ser Leu Ala Tyr Trp Arg Asp 385             390             395           400 Ala Leu Gly Val Asp Gly Phe Arg Phe Asp Leu Ala Ser Val Leu Gly

       405            410          415 Asn Ser Cys Gln His Gly Cys Phe Asn Phe Asp Lys Asn Asp Ser Gly

    420       425       430 Asn Ala Leu Asn Arg Ile Val Ala Glu Leu Pro Pro Arg Pro Ala Ala

 435            440        445 Gly Gly Ala Gly Ala Asp Leu Ile Ala Glu Pro Trp Ala Ile Gly Gly   450             455            460 Asn Ser Tyr Gln Val Gly Gly Phe Pro Ala Gly Trp Ala Glu Trp Asn 465           470             475           480 Gly Leu Tyr Arg Asp Ala Leu Arg Lys Lys Gln Asn Lys Leu Gly Val

      485             490           495 Glu Thr Val Thr Pro Gly Thr Leu Ala Thr Arg Phe Ala Gly Ser Asn

    500           505            510 Asp Leu Tyr Gly Asp Asp Gly Arg Lys Pro Trp His Ser Ile Asn Phe

 515           520           525 Val Val Ala His Asp Gly Phe Thr Leu Asn Asp Leu Tyr Ala Tyr Asn    530            535           540 Asp Lys Gln Asn Asn Gln Pro Trp Pro Tyr Gly Pro Ser Asp Gly Gly 545           550           555             560 Glu Asp His Asn Leu Ser Trp Asn Gln Gly Gly Ile Val Ala Glu Gln

      565           570        575 Arg Lys Ala Ala Arg Thr Gly Leu Ala Leu Leu Met Leu Ser Ala Gly

    580            585            590 Val Pro Met Ile Thr Gly Gly Asp Glu Ala Leu Arg Thr Gln Phe Gly

 595            600            605 Asn Asn Asn Thr Tyr Asn Leu Asp Ser Ala Ala Asn Trp Leu Tyr Trp    610          615           620 Ser Arg Ser Ala Leu Glu Ala Asp His Glu Thr Tyr Thr Lys Arg Leu 625           630            635            640 Ile Ala Phe Arg Lys Ala His Pro Ala Leu Arg Pro Ala Asn Phe Tyr

       645            650           655 Ser Ala Ser Asp Thr Asn Gly Asn Val Met Glu Gln Leu Arg Trp Phe

    660           665            670  Lys Pro Asp Gly Ala Gln Ala Asp Ser Ala Tyr Phe Asn Gly Ala Asp

 675            680            685 Asn His Ala Leu Ala Trp Arg Ile Asp Gly Ser Glu Phe Gly Asp Ser   690             695            700 Ala Ser Ala Ile Tyr Val Ala Tyr Asn Gly Trp Ser Gly Ala Val Asp 705             710             715           720 Phe Lys Leu Pro Trp Pro Gly Thr Gly Lys Gln Trp Tyr Arg Val Thr

     725           730            735 Asp Thr Ala Thr Trp Asn Glu Gly Pro Asn Ala Val Ala Leu Pro Gly

   740            745        750 Ser Glu Thr Leu Ile Gly Gly Glu Asn Thr Val Tyr Gly Met Gln Ala

755 760 765 Arg Ser Leu Leu Leu Leu Ile Ala Lys, 770 775 (2) SEQ ID NO:3 information: (i) sequence signature

(A) length: 38 amino acid

(B) type: amino acid

(D) topological structure: linearity, (ii) molecule type: peptide, (xi) sequence description: SEQ ID NO:3:Ala Ile Asp Ala Gln Gln Leu Gly Ala Arg Tyr Asp Ala Ala Gln Ala 15 10 15 Asn Leu Ala Phe Arg Val Tyr Ser Ser Arg Ala Thr Xaa Val Glu Xaa

    20           25             30 Phe Leu Tyr Lys Asn Pro

35 (2) SEQ ID NO:4 information: (i) sequence signature

(A) length: 260 base-pairs

(B) type: nucleic acid

(C) chain thigh: strand

(D) topological structure: linear (ii) molecule type: DNA (synthesizing) is sequence description (xi): SEQ ID NO:4:ATCGACGTGGTCTACAACCACACCGGCGAAGGCGGCCCGTGGAGCGGCACC GACGGGCTC 60 AGCGTCTACAACCTGCTCTCGTTCCGCGGCCTCGACAACCCGGCCTACTACTCGCT GAGC 120 AGCGATTACAAGTATCCGTGGGACAACACCGGCGTCGGCGGCAACTACAACACCCG CCAT 180 CCCATCGCCCAGAACCTGATCGTCGACTCGCTGGCGTACTGGCGCGACGCGCTCGG CGTA 240 GACGGTTTCCGCTTCGATCT 260 (2) SEQ ID NO:5 information: (i) sequence signature

(A) length: 45 base-pairs

(B) type: nucleic acid

(C) chain thigh: strand

(D) topological framework: linearity

(ii) molecule type: DNA (synthesizing)

(xi) sequence description: SEQ ID NO:5:GGGGCGATGGCCATCGATGCGCAGCAGCTCGGCGCGCGCTACGAC 45 (2) SEQ ID NO:6 information: (i) sequence signature

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain thigh: strand

(D) topological framework: linearity is molecule type (ii): DNA (synthesizing) is sequence description (xi): SEQ ID NO:6:CCCCGAATTCGAGCTCTTATCACTTCGCGATCAGCAACAGCAGCGA 46 (2) SEQ ID NO:7 information: (i) sequence signature

(A) length: 355 base pairs

(B) type: nucleic acid

(C) chain thigh: two strands

(D) topological framework: linearity is molecule type (ii): DNA (genome) is information in the public domain (x):

(H) document number: WO 91/19806

(I) applying date: 07-JUN-1991

(J) open day: the 1991-12 month 26

(K) relevant residue among the SEQ ID NO:7: from 1 to 355 (xi) sequence description: SEQ ID NO:7:AAGCTTGTTCTCATTGTTGTTATCATTATATATAGATGACCAAAGCACTAG ACCAAACCT 60CAGTCACACAAAGAGTAAAGAAGAACAATGGCTTCCTCTATGCTCTCTTCCGCT ACTATG 120GTTGCCTCTCCGGCTCAGGCCACTATGGTCGCTCCTTTCAACGGACTTAAGTC CTCCGCT 180GCCTTCCCAGCCACCCGCAAGGCTAACAACGACATTACTTCCATCACAAGCAA CGGCGGA 240AGAGTTAACTGCATGCAGGTGTGGCCTCCGATTGGAAAGAAGAAGTTTGAGAC TCTCTCT 300TACCTTCCTGACCTTACCGATTCCGGTGGTCGCGTCAACTGCATGCAGGCCAT GG 355 (2) SEQ ID NO:8 information: (i) sequence signature

(A) length: 6 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): peptide (xi) sequence description: SEQ ID NO:8:

Asp?Val?Val?Tyr?Asn?His

15 (2) SEQ ID NO:9 information: (i) sequence signature

(A) length: 9 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): peptide (xi) sequence description: SEQ ID NO:9:

Gly?Phe?Arg?Phe?Asp?Leu?Ala?Ser?Val

15 (2) SEQ ID NO:10 information: (i) sequence signature

(A) length: 2244 base pairs

(B) type: nucleic acid

(C) chain thigh: two strands

(D) topological framework: linearity is molecule type (ii): DNA (genome) is character (ix):

(A) title/keyword: CDS

(B) location: 1...2241, (xi) sequence description: SEQ ID NO:10:ATG GCC ATC GAT GCG CAG CAG CTC GGC GCG CGC TAC GAC GCC GCC CAG 48Met Ala Ile Asp Ala Gln Gln Leu Gly Ala Arg Tyr Asp Ala Ala Gln 15 10 15GCC AAC CTC GCG TTC CGG GTC TATTCC TCG CGC GCG ACC CGC GTC GAG 96Ala Asn Leu Ala Phe Arg Val Tyr Ser Ser Arg Ala Thr Arg Val Glu

20 25 30GTG?TTC?CTG?TAC?AAG?AAC?CCG?ACC?GGC?TCG?CAG?GAA?GTC?GCG?CGG?CTG 144Val?Phe?Leu?Tyr?Lys?Asn?Pro?Thr?Gly?Ser?Gln?Glu?Val?Ala?Arg?Leu

35 40 45GCG?CTG?AGC?AAG?GAC?CCG?GCG?ACC?CAG?GTG?TGG?TCG?CTG?TCG?CTG?CCG 192Ala?Leu?Ser?Lys?Asp?Pro?Ala?Thr?Gln?Val?Trp?Ser?Leu?Ser?Leu?Pro

50 55 60ACC?AGC?ACG?ATC?AAG?AAC?ACC?TAC?GGC?ATC?ACC?GGC?GCC?GTC?TAC?TAC 240Thr?Ser?Thr?Ile?Lys?Asn?Thr?Tyr?Gly?Ile?Thr?Gly?Ala?Val?Tyr?Tyr65 70 75 80GGT?TAC?CGC?GCC?TGG?GGC?CCG?AAC?TGG?CCC?TAC?GAT?GCG?GCC?TGG?ACC 288Gly?Tyr?Arg?Ala?Trp?Gly?Pro?Asn?Trp?Pro?Tyr?Asp?Ala?Ala?Trp?Thr

85 90 95AAG?GGC?AGC?GCC?ACC?GGC?TTC?GTC?AGC?GAC?GTC?GAC?AAC?GCC?GGC?AAC 336Lys?Gly?Ser?Ala?Thr?Gly?Phe?Val?Ser?Asp?Val?Asp?Asn?Ala?Gly?Asn

100 105 110CGT?TTC?AAT?CCG?AAC?AAG?CTG?CTG?CTC?GAC?CCC?TAC?GCG?CGC?GAG?ATC 384Arg?Phe?Asn?Pro?Asn?Lys?Leu?Leu?Leu?Asp?Pro?Tyr?Ala?Arg?Glu?Ile

115 120 125AGC?CAG?GAC?CCG?AAC?ACC?GCG?ACC?TGC?GCC?GAC?GGC?ACC?ATC?TAC?GCC 432Ser?Gln?Asp?Pro?Asn?Thr?Ala?Thr?Cys?Ala?Asp?Gly?Thr?Ile?Tyr?Ala 130 135 140ACC?GGC?GCC?GCG?CAC?CGC?AAC?AAG?GAC?AGC?GGC?CTG?TGC?GCG?AGC?AAG 480Thr?Gly?Ala?Ala?His?Arg?Asn?Lys?Asp?Ser?Gly?Leu?Cys?Ala?Ser?Lys145 150 155 160GGC?ATC?GCG?CTG?GCC?GCG?GAC?GCG?ACC?TCG?GTC?GGC?AGC?AAG?CCG?ACC 528?Gly?Ile?Ala?Leu?Ala?Ala?Asp?Ala?Thr?Ser?Val?Gly?Ser?Lys?Pro?Thr

165 170 175CGC?GCG?CTC?AAG?GAC?GAG?GTG?ATC?TAC?GAA?GTG?CAC?GTG?CGC?GGC?CTG 576Arg?Ala?Leu?Lys?Asp?Glu?Val?Ile?Tyr?Glu?Val?His?Val?Arg?Gly?Leu

180 185 190ACC?CGC?AAC?GAC?GAC?AGC?GTG?CCC?GCG?GCC?GAA?CGC?GGC?ACC?TAC?AAG 624Thr?Arg?Asn?Asp?Asp?Ser?Val?Pro?Ala?Ala?Glu?Arg?Gly?Thr?Tyr?Lys

195 200 205GGC?GCC?GCG?CGC?AAG?GCC?GCC?GCG?TTG?GCC?GCG?CTC?GGC?GTC?ACC?GCG 672Gly?Ala?Ala?Arg?Lys?Ala?Ala?Ala?Leu?Ala?Ala?Leu?Gly?Val?Thr?Ala 210 215 220GTC?GAG?TTC?CTG?CCG?GTG?CAG?GAA?ACC?CAG?AAC?GAC?CAG?AAC?GAT?GTC 720Val?Glu?Phe?Leu?Pro?Val?Gln?Glu?Thr?Gln?Asn?Asp?Gln?Asn?Asp?Val225 230 235 240GAT?CCC?AAT?TCC?ACC?GCG?GGC?GAC?AAC?TAC?TGG?GGC?TAC?ATG?ACC?CTC 768Asp?Pro?Asn?Ser?Thr?Ala?Gly?Asp?Asn?Tyr?Trp?Gly?Tyr?Met?Thr?Leu

245 250 255AAC?TAC?TTC?GCC?CCG?GAC?CGC?CGC?TAC?GCC?TAC?GAC?AAG?TCG?GCC?GGC 816Asn?Tyr?Phe?Ala?Pro?Asp?Arg?Arg?Tyr?Ala?Tyr?Asp?Lys?Ser?Ala?Gly

260 265 270GGG?CCG?ACC?CGC?GAA?TGG?AAG?GCG?ATG?GTC?AAG?GCC?TTC?CAC?GAC?GCC 864Gly?Pro?Thr?Arg?Glu?Trp?Lys?Ala?Met?Val?Lys?Ala?Phe?His?Asp?Ala

275 280 285GGC?ATC?AAG?GTC?TAC?ATC?GAC?GTG?GTC?TAC?AAC?CAC?ACC?GGC?GAA?GGC 912Gly?Ile?Lys?Val?Tyr?Ile?Asp?Val?Val?Tyr?Asn?His?Thr?Gly?Glu?Gly 290 295 300GGC?CCG?TGG?AGC?GGC?ACC?GAC?GGG?CTC?AGC?GTC?TAC?AAC?CTG?CTC?TCG 960Gly?Pro?Trp?Ser?Gly?Thr?Asp?Gly?Leu?Ser?Val?Tyr?Asn?Leu?Leu?Ser305 310 315 320TTC?CGC?GGC?CTC?GAC?AAC?CCG?GCC?TAC?TAC?TCG?CTG?AGC?AGC?GAT?TAC 1008Phe?Arg?Gly?Leu?Asp?Asn?Pro?Ala?Tyr?Tyr?Ser?Leu?Ser?Ser?Asp?Tyr

325 330 335AAG?TAT?CCG?TGG?GAC?AAC?ACC?GGC?GTC?GGC?GGC?AAC?TAC?AAC?ACC?CGC 1056Lys?Tyr?Pro?Trp?Asp?Asn?Thr?Gly?Val?Gly?Gly?Asn?Tyr?Asn?Thr?Arg

340 345 350CAT?CCC?ATC?GCC?CAG?AAC?CTG?ATC?GTC?GAC?TCG?CTG?GCG?TAC?TGG?CGC 1104His?Pro?Ile?Ala?Gln?Asn?Leu?Ile?Val?Asp?Ser?Leu?Ala?Tyr?Trp?Arg

355 360 365GAC?GCG?CTC?GGC?GTA?GAC?GGT?TTC?CGC?TTC?GAT?CTG?GCC?TCG?GTG?CTC 1152Asp?Ala?Leu?Gly?Val?Asp?Gly?Phe?Arg?Phe?Asp?Leu?Ala?Ser?Val?Leu 370 375 380GGC?AAC?AGC?TGC?CAG?CAC?GGC?TGC?TTC?AAC?TTC?GAC?AAG?AAC?GAC?TCG 1200Gly?Asn?Ser?Cys?Gln?His?Gly?Cys?Phe?Asn?Phe?Asp?Lys?Asn?Asp?Ser385 390 395 400GGC?AAC?GCG?CTC?AAC?CGC?ATC?GTC?GCC?GAG?CTG?CCG?CCG?CGC?CCG?GCC 1248Gly?Asn?Ala?Leu?Asn?Arg?Ile?Val?Ala?Glu?Leu?Pro?Pro?Arg?Pro?Ala

405 410 415GCG?GGC?GGC?GCC?GGC?GCG?GAC?CTG?ATC?GCC?GAA?CCC?TGG?GCG?ATC?GGC 1296Ala?Gly?Gly?Ala?Gly?Ala?Asp?Leu?Ile?Ala?Glu?Pro?Trp?Ala?Ile?Gly

420 425 430GGC?AAC?TCC?TAC?CAG?GTC?GGC?GGC?TTC?CCG?GCC?GGC?TGG?GCC?GAG?TGG 1344Gly?Asn?Ser?Tyr?Gln?Val?Gly?Gly?Phe?Pro?Ala?Gly?Trp?Ala?Glu?Trp

435 440 445AAC?GGC?CTC?TAC?CGC?GAC?GCG?CTG?CGC?AAG?AAG?CAG?AAC?AAG?CTC?GGC 1392Asn?Gly?Leu?Tyr?Arg?Asp?Ala?Leu?Arg?Lys?Lys?Gln?Asn?Lys?Leu?Gly 450 455 460GTG?GAA?ACG?GTC?ACC?CCC?GGC?ACC?CTG?GCC?ACG?CGC?TTC?GCC?GGC?TCC 1440Val?Glu?Thr?Val?Thr?Pro?Gly?Thr?Leu?Ala?Thr?Arg?Phe?Ala?Gly?Ser465 470 475 480AAC?GAC?CTG?TAC?GGC?GAC?GAC?GGC?CGC?AAG?CCG?TGG?CAT?TCG?ATC?AAC 1488Asn?Asp?Leu?Tyr?Gly?Asp?Asp?Gly?Arg?Lys?Pro?Trp?His?Ser?Ile?Asn

485 490 495TTC?GTG?GTC?GCC?CAC?GAC?GGC?TTC?ACC?CTC?AAC?GAC?CTG?TAC?GCC?TAC 1536Phe?Val?Val?Ala?His?Asp?Gly?Phe?Thr?Leu?Asn?Asp?Leu?Tyr?Ala?Tyr

500 505 510AAC?GAC?AAG?CAG?AAC?AAC?CAG?CCG?TGG?CCG?TAC?GGG?CCG?TCC?GAC?GGC 1584Asn?Asp?Lys?Gln?Asn?Asn?Gln?Pro?Trp?Pro?Tyr?Gly?Pro?Ser?Asp?Gly

515 520 525GGC?GAG?GAC?CAC?AAC?CTG?AGC?TGG?AAC?CAG?GGC?GGC?ATC?GTC?GCC?GAG 1632Gly?Glu?Asp?His?Asn?Leu?Ser?Trp?Asn?Gln?Gly?Gly?Ile?Val?Ala?Glu 530 535 540CAG?CGC?AAG?GCC?GCG?CGC?ACC?GGA?CTG?GCG?TTG?CTG?ATG?CTC?AGC?GCC 1680Gln?Arg?Lys?Ala?Ala?Arg?Thr?Gly?Leu?Ala?Leu?Leu?Met?Leu?Ser?Ala545 550 555 560GGC?GTG?CCG?ATG?ATC?ACC?GGC?GGC?GAC?GAG?GCG?CTG?CGC?ACC?CAG?TTC 1728Gly?Val?Pro?Met?Ile?Thr?Gly?Gly?Asp?Glu?Ala?Leu?Arg?Thr?Gln?Phe

565 570 575GGC?AAC?AAC?AAC?ACC?TAC?AAC?CTG?GAT?TCG?GCG?GCC?AAC?TGG?CTG?TAC 1776Gly?Asn?Asn?Asn?Thr?Tyr?Asn?Leu?Asp?Ser?Ala?Ala?Asn?Trp?Leu?Tyr

580 585 590TGG?AGC?CGC?AGC?GCG?CTC?GAG?GCC?GAC?CAC?GAG?ACC?TAC?ACC?AAG?CGC 1824Trp?Ser?Arg?Ser?Ala?Leu?Glu?Ala?Asp?His?Glu?Thr?Tyr?Thr?Lys?Arg

595 600 605CTG?ATC?GCG?TTC?CGC?AAG?GCG?CAC?CCG?GCG?CTG?CGC?CCG?GCG?AAC?TTC 1872Leu?Ile?Ala?Phe?Arg?Lys?Ala?His?Pro?Ala?Leu?Arg?Pro?Ala?Asn?Phe 610 615 620TATTCG?GCC?AGC?GAC?ACC?AAC?GGC?AAC?GTG?ATG?GAG?CAG?TTG?CGC?TGG 1920Tyr?Ser?Ala?Ser?Asp?Thr?Asn?Gly?Asn?Val?Met?Glu?Gln?Leu?Arg?Trp625 630 635 640TTC?AAG?CCC?GAC?GGC?GCG?CAG?GCC?GAC?AGC?GCC?TAC?TTC?AAC?GGC?GCC 1968Phe?Lys?Pro?Asp?Gly?Ala?Gln?Ala?Asp?Ser?Ala?Tyr?Phe?Asn?Gly?Ala

645 650 655GAC?AAC?CAC?GCC?CTG?GCC?TGG?CGC?ATC?GAC?GGC?AGC?GAG?TTC?GGC?GAC 2016Asp?Asn?His?Ala?Leu?Ala?Trp?Arg?Ile?Asp?Gly?Ser?Glu?Phe?Gly?Asp

660 665 670AGC?GCC?AGC?GCG?ATC?TAC?GTC?GCC?TAC?AAC?GGC?TGG?TCC?GGC?GCG?GTC 2064Ser?Ala?Ser?Ala?Ile?Tyr?Val?Ala?Tyr?Asn?Gly?Trp?Ser?Gly?Ala?Val

675 680 685GAC?TTC?AAG?CTG?CCG?TGG?CCG?GGC?ACC?GGC?AAG?CAG?TGG?TAC?CGG?GTC 2112Asp?Phe?Lys?Leu?Pro?Trp?Pro?Gly?Thr?Gly?Lys?Gln?Trp?Tyr?Arg?Val 690 695 700ACC?GAT?ACC?GCG?ACC?TGG?AAC?GAA?GGC?CCC?AAC?GCG?GTG?GCG?CTG?CCC 2160Thr?Asp?Thr?Ala?Thr?Trp?Asn?Glu?Gly?Pro?Asn?Ala?Val?Ala?Leu?Pro705 710 715 720GGC?AGC?GAG?ACC?CTG?ATC?GGC?GGC?GAG?AAC?ACC?GTC?TAC?GGC?ATG?CAG 2208Gly?Ser?Glu?Thr?Leu?Ile?Gly?Gly?Glu?Asn?Thr?Val?Tyr?Gly?Met?Gln

725 730 735GCG?CGC?TCG?CTG?CTG?TTG?CTG?ATC?GCG?AAG?TGATAA 2244Ala?Arg?Ser?Leu?Leu?Leu?Leu?Ile?Ala?Lys

740 745 (2) SEQ ID NO:11 information: (i) sequence signature

(A) length: 746 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): protein

(xi) sequence description: SEQ ID NO:11:Met Ala Ile Asp Ala Gln Gln Leu Gly Ala Arg Tyr Asp Ala Ala Gln 15 10 15Ala Asn Leu Ala Phe Arg Val Tyr Ser Ser Arg Ala Thr Arg Val Glu

20 25 30Val?Phe?Leu?Tyr?Lys?Asn?Pro?Thr?Gly?Ser?Gln?Glu?Val?Ala?Arg?Leu

35 40 45Ala?Leu?Ser?Lys?Asp?Pro?Ala?Thr?Gln?Val?Trp?Ser?Leu?Ser?Leu?Pro

50 55 60Thr?Ser?Thr?Ile?Lys?Asn?Thr?Tyr?Gly?Ile?Thr?Gly?Ala?Val?Tyr?Tyr65 70 75 80Gly?Tyr?Arg?Ala?Trp?Gly?Pro?Asn?Trp?Pro?Tyr?Asp?Ala?Ala?Trp?Thr

85 90 95Lys?Gly?Ser?Ala?Thr?Gly?Phe?Val?Ser?Asp?Val?Asp?Asn?Ala?Gly?Asn

100 105 110Arg?Phe?Asn?Pro?Asn?Lys?Leu?Leu?Leu?Asp?Pro?Tyr?Ala?Arg?Glu?Ile

115 120 125Ser?Gln?Asp?Pro?Asn?Thr?Ala?Thr?Cys?Ala?Asp?Gly?Thr?Ile?Tyr?Ala 130 135 140Thr?Gly?Ala?Ala?His?Arg?Asn?Lys?Asp?Ser?Gly?Leu?Cys?Ala?Ser?Lys145 150 155 160Gly?Ile?Ala?Leu?Ala?Ala?Asp?Ala?Thr?Ser?Val?Gly?Ser?Lys?Pro?Thr

165 170 175Arg?Ala?Leu?Lys?Asp?Glu?Val?Ile?Tyr?Glu?Val?His?Val?Arg?Gly?Leu

180 185 190Thr?Arg?Asn?Asp?Asp?Ser?Val?Pro?Ala?Ala?Glu?Arg?Gly?Thr?Tyr?Lys

195 200 205Gly?Ala?Ala?Arg?Lys?Ala?Ala?Ala?Leu?Ala?Ala?Leu?Gly?Val?Thr?Ala 210 215 220Val?Glu?Phe?Leu?Pro?Val?Gln?Glu?Thr?Gln?Asn?Asp?Gln?Asn?Asp?Val225 230 235 240Asp?Pro?Asn?Ser?Thr?Ala?Gly?Asp?Asn?Tyr?Trp?Gly?Tyr?Met?Thr?Leu

245 250 255Asn?Tyr?Phe?Ala?Pro?Asp?Arg?Arg?Tyr?Ala?Tyr?Asp?Lys?Ser?Ala?Gly

260 265 270Gly?Pro?Thr?Arg?Glu?Trp?Lys?Ala?Met?Val?Lys?Ala?Phe?His?Asp?Ala

275 280 285Gly?Ile?Lys?Val?Tyr?Ile?Asp?Val?Val?Tyr?Asn?His?Thr?Gly?Glu?Gly 290 295 300Gly?Pro?Trp?Ser?Gly?Thr?Asp?Gly?Leu?Ser?Val?Tyr?Asn?Leu?Leu?Ser305 310 315 320Phe?Arg?Gly?Leu?Asp?Asn?Pro?Ala?Tyr?Tyr?Ser?Leu?Ser?Ser?Asp?Tyr

325 330 335Lys?Tyr?Pro?Trp?Asp?Asn?Thr?Gly?Val?Gly?Gly?Asn?Tyr?Asn?Thr?Arg

340 345 350His?Pro?Ile?Ala?Gln?Asn?Leu?Ile?Val?Asp?Ser?Leu?Ala?Tyr?Trp?Arg

355 360 365Asp?Ala?Leu?Gly?Val?Asp?Gly?Phe?Arg?Phe?Asp?Leu?Ala?Ser?Val?Leu 370 375 380Gly?Asn?Ser?Cys?Gln?His?Gly?Cys?Phe?Asn?Phe?Asp?Lys?Asn?Asp?Ser385 390 395 400Gly?Asn?Ala?Leu?Asn?Arg?Ile?Val?Ala?Glu?Leu?Pro?Pro?Arg?Pro?Ala

405 410 415Ala?Gly?Gly?Ala?Gly?Ala?Asp?Leu?Ile?Ala?Glu?Pro?Trp?Ala?Ile?Gly

420 425 430Gly?Asn?Ser?Tyr?Gln?Val?Gly?Gly?Phe?Pro?Ala?Gly?Trp?Ala?Glu?Trp

435 440 445Asn?Gly?Leu?Tyr?Arg?Asp?Ala?Leu?Arg?Lys?Lys?Gln?Asn?Lys?Leu?Gly 450 455 460Val?Glu?Thr?Val?Thr?Pro?Gly?Thr?Leu?Ala?Thr?Arg?Phe?Ala?Gly?Ser465 470 475 480Asn?Asp?Leu?Tyr?Gly?Asp?Asp?Gly?Arg?Lys?Pro?Trp?His?Ser?Ile?Asn

485 490 495Phe?Val?Val?Ala?His?Asp?Gly?Phe?Thr?Leu?Asn?Asp?Leu?Tyr?Ala?Tyr

500 505 510Asn?Asp?Lys?Gln?Asn?Asn?Gln?Pro?Trp?Pro?Tyr?Gly?Pro?Ser?Asp?Gly

515 520 525Gly?Glu?Asp?His?Asn?Leu?Ser?Trp?Asn?Gln?Gly?Gly?Ile?Val?Ala?Glu 530 535 540Gln?Arg?Lys?Ala?Ala?Arg?Thr?Gly?Leu?Ala?Leu?Leu?Met?Leu?Ser?Ala545 550 555 560Gly?Val?Pro?Met?Ile?Thr?Gly?Gly?Asp?Glu?Ala?Leu?Arg?Thr?Gln?Phe

565 570 575Gly?Asn?Asn?Asn?Thr?Tyr?Asn?Leu?Asp?Ser?Ala?Ala?Asn?Trp?Leu?Tyr

580 585 590Trp?Ser?Arg?Ser?Ala?Leu?Glu?Ala?Asp?His?Glu?Thr?Tyr?Thr?Lys?Arg

595 600 605Leu?Ile?Ala?Phe?Arg?Lys?Ala?His?Pro?Ala?Leu?Arg?Pro?Ala?Asn?Phe 610 615 620Tyr?Ser?Ala?Ser?Asp?Thr?Asn?Gly?Asn?Val?Met?Glu?Gln?Leu?Arg?Trp625 630 635 640Phe?Lys?Pro?Asp?Gly?Ala?Gln?Ala?Asp?Ser?Ala?Tyr?Phe?Asn?Gly?Ala

645 650 655Asp?Asn?His?Ala?Leu?Ala?Trp?Arg?Ile?Asp?Gly?Ser?Glu?Phe?Gly?Asp

660 665 670Ser?Ala?Ser?Ala?Ile?Tyr?Val?Ala?Tyr?Asn?Gly?Trp?Ser?Gly?Ala?Val

675 680 685Asp?Phe?Lys?Leu?Pro?Trp?Pro?Gly?Thr?Gly?Lys?Gln?Trp?Tyr?Arg?Val 690 695 700Thr?Asp?Thr?Ala?Thr?Trp?Asn?Glu?Gly?Pro?Asn?Ala?Val?Ala?Leu?Pro705 710 715 720Gly?Ser?Glu?Thr?Leu?Ile?Gly?Gly?Glu?Asn?Thr?Val?Tyr?Gly?Met?Gln

725 730 735Ala?Arg?Ser?Leu?Leu?Leu?Leu?Ile?Ala?Lys

740 745

Claims (27)

1. separated coding SED ID NO:2 protein DNA molecule.

2. the molecule of an isolating SED ID NO:10 DNA

3. one kind contains the transformant that coding has the allogeneic dna sequence of SED ID NO:11 sequences polypeptide basically, and wherein said cell is selected from intestinal bacteria, bacillus, and yeast.

4. DNA construction comprises 5 ' be operatively connected to 3 ' direction:

A) work and cause the promotor that produces the RNA sequence; With

B) the structured coding sequence of SED ID NO:10; Wherein said promotor and described structured coding sequence allos.

5. method of producing isoamylase comprising that fermentation comprises the organism culture of claim 4 DNA construction and from wherein extracting isoamylase.

6. DNA construction comprises 5 ' be operatively connected to 3 ' direction:

A) in select producing the vegetable cell of starch, work and cause the promotor that the RNA sequence produces;

B) the structured coding sequence of coding isoamylase; With

C) in described vegetable cell, work and cause the 3 ' non-translational region that polyadenylic acid ester Nucleotide is joined RNA sequence 3 ' end;

Wherein said promotor and structured coding sequence allos.

7. the DNA construction of claim 6, wherein said structured coding sequence further comprises plastid target sequence.

8. the DNA construction of claim 7, wherein said plastid target sequence is CTP-1 plastid target sequence SED ID NO:7.

9. the DNA construction of claim 6, wherein said isoamylase is SED ID NO:11.

One kind comprise the DNA construction by transformed plant cells, the DNA construction contains 5 ' be operatively connected to 3 ' direction:

A) in the vegetable cell of selecting production starch, work, cause the promotor that the RNA sequence produces;

B) the structured coding sequence of coding isoamylase; With

C) in described vegetable cell, work and cause the 3 ' non-translational region that polyadenylic acid ester Nucleotide is joined RNA sequence 3 ' end;

Wherein said promotor and structured coding sequence allos.

11. the transformed plant cells of claim 10, wherein said structured coding sequence further comprises plastid target sequence, and wherein said isoamylase optimal pH 5-8.

12. the transformed plant cells of claim 11, wherein plastid target sequence is CTP-1 plastid target sequence SED ID NO:7.

13. the transformed plant cells of claim 12, wherein isoamylase is SED ID NO:11.

14. the transformed plant cells of claim 13, wherein isoamylase is encoded by SED ID NO:10.

15. the transformed plant cells of claim 10, wherein vegetable cell is from potato, corn, wheat, barley, yam, cassava, or rice.

16. the transformed plant cells of claim 10 transforms with external source ADP glucose pyrophosphorylase stable gene.

17. a production has the method for modification structure starch, comprises

A) transformed plant cells makes it comprise the DNA construction of a kind of contain with 5 ' be operatively connected to 3 ' direction;

I) in select producing the vegetable cell of starch, work and cause the promotor that produces the RNA sequence;

Ii) the encode structured coding sequence of isoamylase; With

Iii) in described vegetable cell, work and cause the 3 ' non-translational region that polyadenylic acid ester Nucleotide is joined RNA sequence 3 ' end; Wherein said promotor and structured coding sequence allos;

B) regeneration whole plants;

C) numerously plant described plant;

D) results plant material; With

E) therefrom extract starch.

18. the method for claim 17, wherein said structured coding sequence further comprises plastid target sequence, and wherein said isoamylase optimal pH is 5-8.

19. the method for claim 18, wherein said structured coding sequence comprise CTP-1 plastid target sequence SED ID NO:7.

20. the method for claim 19, wherein said isoamylase are SED ID NO:11.

21. the method for claim 20, wherein said isoamylase is encoded by SED ID NO:10.

22. the method for claim 21, wherein said vegetable cell be from potato, corn, wheat, barley, yam, cassava, or rice.

23. the method for claim 17, wherein said vegetable cell further comprise the external source ADP glucose pyrophosphorylase gene of stable conversion.

24. the starch of producing with the method for claim 17.

25. plant that comprises the transformed plant cells of claim 10 and contain structural modification starch.

26. the plant of claim 25, wherein said plant is a potato, corn, wheat, barley, yam, cassava, or rice.

27. the plant of claim 25, wherein said structural modification starch have than the ratio of high amylose starch with amylopectin.