CN1402789A - Nucleic acid molecules from wheat, transgenic plant cells and plants, and use thereof for production of modified starch - Google Patents

Nucleic acid molecules from wheat, transgenic plant cells and plants, and use thereof for production of modified starch Download PDF

Info

Publication number
CN1402789A
CN1402789A CN00808513A CN00808513A CN1402789A CN 1402789 A CN1402789 A CN 1402789A CN 00808513 A CN00808513 A CN 00808513A CN 00808513 A CN00808513 A CN 00808513A CN 1402789 A CN1402789 A CN 1402789A
Authority
CN
China
Prior art keywords
leu
val
glu
ser
asp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN00808513A
Other languages
Chinese (zh)
Inventor
G·阿贝尔
H·罗尔兹
S·鲁缇克
R-C·施密特
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer CropScience AG
Original Assignee
Hoechst Schering Agrevo GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hoechst Schering Agrevo GmbH filed Critical Hoechst Schering Agrevo GmbH
Publication of CN1402789A publication Critical patent/CN1402789A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes

Abstract

Nucleic acid molecules are described encoding an R1-protein from wheat and methods and recombinant DNA molecules for the production of transgenic plant cells and plants synthesizing a modified starch. Additionally, the plant cells and plants resulting from those methods as well as the starch obtainable therefrom are described.

Description

Nucleic acid molecule, transgenic plant cells and plant and the application in producing treated starch thereof from wheat
The present invention relates to encode from the proteinic nucleic acid molecule of the R1-of wheat and derivative thereof and part, described R1-protein, be used to produce described R1-method of protein, the transgenic plant cells that comprises described nucleic acid molecule and plant, the transgenic plant cells that comprises described nucleic acid molecule and plant and can be available from the treated starch of described transgenic plant cells and plant.
Polysaccharide starch has constituted one of most important storage material in the plant.Starch is widely used in production food and plays an important role as regenerative raw materials in the manufacture product.For applying starch in many different technologies field, the starch that needs various randomly modifications is so that satisfy the different demands of processing industry.
Although starch is by the basal component of homogeneous chemically, promptly glucose is formed, and it does not constitute even raw material.It is complicated molecule mixture, described molecule there are differences aspect the polymerization degree of its grape sugar chain and the degree of branching: amylose starch type starch is by α-1, the polymkeric substance of non-branching basically that 4-glucosides side chain glucose molecule is formed, and amylopectin type starch is the mixture of branched glucose chain, it comprises α-1 in addition, 6-glucosides interconnection key.
The molecular structure of starch mainly depends on its degree of branching, amylose starch/amylopectin ratios, mean chain length, chain length distribution and phosphorylation degree, thereby further determines the functional performance of the starch and the aqueous solution thereof.The critical function characteristic of the starch and the aqueous solution thereof is respectively: solvability, the trend that decreases, film forming ability, viscosity, gelatinization (bonding and glue connects) characteristic and cold resistance for example.In addition, the size of starch granules also may determine the suitability of starch to special applications.
, satisfies starch the requirement of industry because being changed by chemistry and/or physical modification usually, so to providing treated starch to have huge demand, this treated starch will make the vegetable cell or the plant parts that contain treated starch be more suitable for for example producing food or handicraft product in industrialization processing.Therefore, need avoid carrying out chemistry consuming time and expensive and/or physical modification and provide and to synthesize the plant of closer satisfying the starch that starch processing industry requires.
For example, by traditional breeding and/or produce the ordinary method that the mutant strain preparation produces the improvement plant of modified product and be confined to use homologous gene and always not gratifying.Especially in wheat, because of the polyploidy of wheat (four or hexaploidy) is difficult to prepare stable mutant strain by traditional breeding method.Yet (Nakamura etc., Mol.Gen.Geent.248 (1995) 253-259) have obtained the wheat mutant strain of generation wax-matrix type starch (starch that does not contain amylose starch) by breeding method recently.
Further alternative method is that preparation comprises and is suitable for changing the transgenic plant of the nucleic acid molecule of plant amylum mechanism with synthesis modification starch.This class plant disturbs the homology and/or the heterologous nucleic acids molecule (for example coding region, regulatory element, intron) of starch metabolism to produce by recombinant molecule biology techniques and introducing.Yet using the recombinant molecule biology techniques needs directly or indirectly (for example generation of inhibition altogether, antisense technology, protein or ribozyme) to participate in the validity of the suitable nucleic acid of starch metabolism or starch biosynthesizing (being synthetic, the modification and/or the degraded of starch).
A large amount of genes participate in starch metabolism.Therefore, will encode a large amount of genes of q enzyme, debranching factor, isoamylase, amylosynthease, ADP-glucose-pyrophosphorylase for example are used for changing the starch metabolism of plant.
Especially R1 protein participates in starch metabolism and therefore is suitable for changing the synthetic of starch with regard to the starch phosphorylation degree.Especially, the R1-protein and the proteinic gene of R1-that derives from following many plant species of encoding are known: promptly (Nature Biotechnology 16 (1998), potato 473-477) from WO 97/11188-A1 and Lorberth etc.; Corn from WO 98/27212-A1; Rice from Sakaki etc., EMBL database registration deposit numbers C71741 (1997-09-19); With mouse ear mustard genus, ginger, mosses, cattail (common cattail) and soybean from WO 99/53072-A1.
Yet, exist R1-protein not to be confirmed in the wheat plant, the corresponding nucleic acids molecule does not obtain identifying yet.In addition, coding R1-proteinic known nucleic acid molecule is always gratifying or be not always adapted to the genetic engineering of wheat plant or mutagenesis in vivo so that change the biosynthesizing and/or the metabolism of wheat starch.
Therefore, remain to be provided in the proteinic nucleic acid molecule of R1-and change plant that derives from wheat of encoding by the problem that the present invention solves, especially in the wheat plant starch metabolism so that a kind of method of treated starch is provided, this treated starch is different from natural synthetic starch with regard to physics and/or chemical property, especially wheat starch, it shows the feature of improvement, particularly is applied to food and/or non-food product industry.
These problems are solved by the embodiment of the present invention described in claim.
Therefore, the present invention relates to encode and comprise according to the proteinic nucleic acid molecule of R1 of the aminoacid sequence of Seq.ID No.2 and Seq.ID No.9 or according to the cDNA of plasmid pTa R1-11 (DSM number 12810) and plasmid RS26-88 (DSM number 13511) and insert segmental its derivative or its part.Described R1-protein of the present invention participates in the metabolism of starch and the biosynthesizing of direct or indirect participation wheat starch with regard to phosphorylation degree.
In implication of the present invention, relevant R1-protein (polypeptide of the present invention, aminoacid sequence) term " derivative " comprises the polypeptide that derives from Seq.ID No.2, it comprises that 60-79 is individual amino acid based approximately at least, preferably at least 80 amino acid based, more preferably at least 90 amino acid based, particularly at least 100 and most preferably from about 101-111 is amino acid based, these amino acid based amino acid based group that is selected from following composition: 1E, 2V, 3V, 5G, 6L, 7G, 8E, 9T, 10L, 11V, 12G, 13A, 14Y, 15P, 16G, 17R, 18A, 20S, 21F, 23C, 24K, 25K, 27D, 28L, 30S, 31P, 34L, 35G, 36Y, 37P, 38S, 39K, 40P, 41I, 42G, 43L, 44F, 45I, 48S, 49I, 50I, 51F, 52R, 53S, 54D, 55S, 56N, 57G, 58E, 59D, 60L, 6 1E, 62G, 63Y, 64A, 65G, 66A, 67G, 68L, 69Y, 70D, 71S, 72V, 73P, 74M, 75D, 77E, 80V, 81V, 83D, 84Y, 87D, 88P, 89L, 90I, 92D, 95F, 96R, 99I, 100L, 101S, 103I, 104A, 105R, 106A, 107G, 108H, 109A, 110I, 111E, 112E, 113L, 114Y, 115G, 116S, 117P, 118Q, 119D, 121E, 122G, 123V, 124V, 126D, 127G, 128K, 129I, 130Y, 131V, 132V, 133Q and 134T; And described polypeptide comprise at least 1, preferred 2 and more preferably 3 be selected from as Seq.ID No.2 described amino acid based in amino acid based (hereinafter by the single letter representation) of the group formed of 76V, 93S and 97N.
In implication of the present invention, the term " part " of relevant R1-protein of the present invention (polypeptide, aminoacid sequence) comprises by 10-19 at least, preferred 20, more preferably at least 40 of the pacts of R1-protein or derivatives thereof of the present invention, particularly at least 80 and most preferably from about 100-140 amino acid based polypeptide of forming or oligopeptides at least.
The invention further relates to nucleic acid molecule, this nucleic acid molecule comprises: the nucleic acid molecule or derivatives thereof or its part that derive from Seq.IDNo.1 and Seq.ID No.9; The 672 bp EcoR I/Kpn I of plasmid pTa R1-11 (DSM number 12810) insert fragment or derivatives thereof or its part; The particularly coding region of Seq.ID No.1 (Nucleotide 1-449) or derivatives thereof or its part; Especially plasmid pTa R1-11 (DSM number 12810) inserts segmental coding region; Coding region or derivatives thereof or its part with plasmid RS26-88 (DSM number 13511).
In implication of the present invention, the term " derivative " of relevant nucleic acid molecule of the present invention (nucleotide sequence or polynucleotide) comprises polynucleotide, it comprises approximately at least 150-209 Nucleotide, preferably at least 210 Nucleotide, more preferably at least 240 Nucleotide, particularly at least 270 Nucleotide and 280-294 Nucleotide most preferably from about, and these Nucleotide are selected from the group of the Nucleotide of following composition:
(a) as the described 1C of Seq.ID No.1,3G, 4A, 6G, 7T, 8G, 9G, 10T, 12A, 15G, 16G, 18C, 19T, 20T, 21G, 22G, 24G, 25A, 27A, 28C, 30C, 31T, 33G, 34T, 36G, 37G, 38A, 39G, 40C, 42T, 43A, 44T, 45C, 46C, 48G, 49G, 51C, 52G, 53T, 54G, 55C, 58T, 59G, 60A, 61G, 63T, 64T, 67T, 69T; 70G, 72A, 73A, 75A, 76A, 77A, 79A, 81G, 82A, 84C, 85T, 88A, 89C, 90T, 91C, 92T, 93C, 94C, 97A, 100T, 103T, 105G, 106G, 107T, 108T, 109A, 110C, 111C, 112C, 114A, 115G, 116C, 117A, 118A, 120C, 121C, 123A, 124T, 126G, 127G, 129C, 130T, 132T, 133T, 134C, 135A, 136T, 137A, 138A, 144T, 145C, 147A, 148T, 149C, 150A, 151T, 152C, 153T, 154T, 155C, 156C, 157G, 159T, 160C, 162G, 163A, 165T, 166C, 168A, 169A, 171G, 172G, 174G, 175A, 177G, 178A, 181T, 182G, 183G, 184A, 185A, 186G, 187G, 188T, 189T, 190A, 192G, 193C, 195G, 196G, 198G, 199C, 201G, 202G, 205T, 207T, 208A, 210G, 211A, 213A, 214G, 215T, 216G, 217T, 219C, 220C, 222A, 223T, 224G, 225G, 226A, 227T, 228G, 230G, 231G, 232A, 234G, 235A, 238A, 240G, 241T, 242T, 243G, 244T, 245A, 247T, 249G, 250A, 252T, 253A, 256C, 259C, 261G, 262A, 263C, 264C, 265C, 268T, 270A, 271T, 276G, 277A, 281T, 285T, 286T, 287C, 288C, 289G, 295C, 296A, 297A, 298T, 299C, 300C, 301T, 303T, 304C, 306A, 308C, 309A, 310T, 312G, 313C, 315C, 316G, 318G, 319C, 320T, 321G, 322G, 324G, 325A, 327G, 328C, 330A, 331T, 332C, 333G, 334A, 335G, 336G, 337A, 338G, 339C, 340T, 342T, 343A, 344T, 345G, 346G, 348T, 349C, 351C, 352C, 354C, 355A, 357G, 358A, 361T, 363G, 364A, 365G, 366G, 367G, 369G, 370T, 371A, 372G, 373T, 374G, 375A, 377G, 378G, 379A, 380T, 381G, 382G, 384A, 385A, 387A, 388T, 390T, 391A, 393G, 394T, 396G, 397T, 399C, 400A, 401G, 402A, 403C, 404A, 406A, 407C, 408C, 409A, 410A, 411A, 412G, 413A, 414T, 415G, 416T and 419T; And
(b) described polynucleotide comprise approximately at least 15-19 Nucleotide, preferably at least 20 Nucleotide, more preferably at least 25 Nucleotide, particularly at least 27 Nucleotide and 30-32 Nucleotide most preferably from about, and these Nucleotide are selected from the group of following Nucleotide composition:
As the described 17A of Seq.ID No.1,23A, 50C, 56C, 65C, 68G, 71T, 104G, 113T, 143G, 159C, 161A, 167T, 191C, 203G, 206G, 218C, 221T, 229T, 233A, 248C, 251C, 257G, 269C, 272C, 279T, 280C, 290G, 326C, 341C, 347G, 350A, 353A, 359T, 383G, 392C and 405T.
Clearly illustrate that not and the numbering of sequence composition (be on the one hand nucleotide sequence and be aminoacid sequence on the other hand) should be interpreted as definition fixing or that limit.This numbering only provides the information of sequence composition each other the position relevant with term and has been a kind of reference therefore.
In addition, the term " derivative " of the proteinic nucleic acid molecule of relevant code book invention R1-comprises by adding, lack, insert or one or more Nucleotide of recombinating being different from Seq.IDNo.1 and/or Seq.ID No.9 and satisfying nucleic acid molecule as the definition that provides in above-mentioned (b).
In addition, the term " derivative " of the proteinic nucleic acid molecule of relevant code book invention R1-comprises complementation or reverse complemental polynucleotide or its part of nucleic acid molecule of the present invention.In addition, about the term " derivative " of the proteinic nucleic acid molecule of code book invention R1-comprises and polynucleotide or its part of making nucleic acid molecular hybridization of the present invention, its satisfy as above-mentioned (b) in definition of providing.
For the purposes of the present invention, term " hybridization " refers under the conventional hybridization condition, preferably as (Molecular Cloning:A Laboratory Manual such as Sambrook for example, the 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) hybridization under the described stringent condition.
" specific hybrid " especially preferably refers to following condition:
Hybridization buffer: 2 * SSC; 10 * Denhardt solution (Ficoll 400+PEG+BSA; Ratio is 1: 1: 1); 0.1% SDS; 5mM EDTA; 50mM Na 2HPO 4250 μ g/ml black carp sperm DNAs; 50 μ g/ml tRNA; Or 0.25M sodium phosphate buffer (pH7.2); 1 mM EDTA; 7% SDS;
Hybridization temperature T=55-68 ℃;
Lavation buffer solution: 0.2 * SSC; 0.1% SDS; With
Wash temperature: T=40-68 ℃.
Also comprise nucleic acid molecule of the present invention with nucleic acid molecule of the present invention or with the molecule that is suitable for the making nucleic acid molecular hybridization that the present invention uses or be suitable for part, derivative and the allele variant of the nucleic acid molecule that the present invention uses.
In the context of the present invention, term " derivative " sequence that refers to these molecules is different from the present invention or is suitable for the sequence of the nucleic acid molecule that the present invention uses and reveals the homology of height with these sequence tables on one or more positions.Homology refer to sequence identity be at least 60%, preferably more than 70% and especially preferably more than 85%, particularly more than 90% and particularly preferably in more than 95%.Caused with respect to nucleic acid molecule of the present invention or with respect to the deviation that is suitable for the nucleic acid molecule that the present invention uses by one or more disappearances, replacement, insertion (interpolation) or reorganization.
In addition, homology refers at described nucleic acid molecule and between by their encoded protein matter and has function and/or structural equivalence.With nucleic acid molecule of the present invention or be suitable for nucleic acid molecule homology that the present invention uses and the nucleic acid molecule that constitutes the derivative of these molecules and normally constitute identical, the version of these molecules of the modification of same or similar biological function in fact of performance.They can be for example from the version or the sudden change of the so natural appearance of the sequence of other plant species, and these sudden changes may natural generations or have been introduced into by directed mutagenesis.These versions can further be the synthetic sequences.Allele variant can be the variant of natural appearance or synthetic variant or the variant that produces by recombinant DNA technology.
The term " part " of the proteinic nucleic acid molecule of relevant code book invention R1-comprises encode 30-99 at least, preferred at least 100, more preferably at least 200 of the pacts of the proteinic nucleic acid molecule or derivatives thereof of R1-, particularly at least 300 and at least 400 polynucleotide or oligonucleotide that Nucleotide is formed most preferably by the present invention.Term " part " is not limited to grow to is enough to encode the part of the nucleic acid molecule of R1-protein function active part as mentioned above.
In an embodiment preferred of the present invention, term of the present invention " derivative " and/or " part " comprise polynucleotide, polypeptide or oligopeptides as defined above respectively, and they show R1-gene (the proteinic nucleic acid molecule of R1-of promptly encoding), the proteinic function of R1-and/or the structural equivalence that comes from wheat respectively.Term " function and/or structural equivalence " refers to identical separately, of equal value or similar function, the especially biological function of molecule of the present invention.Yet term " part " is not limited to be enough to the part of the functionally active described nucleic acid molecule partly in the code for said proteins.
R1-protein by nucleic acid molecule encoding of the present invention can demonstrate some conventional feature: for example best pH of the mobility in enzymic activity, molecular weight, immunoreactivity, conformation, the gel electrophoresis, chromatography feature, settling ratio, solvability, spectral response curve, stability, enzymic activity and/or optimum temps etc.
Nucleic acid molecule of the present invention can separate from natural origin for example, can maybe can be by chemical synthesis process production by genetic engineering or molecular biology method (for example PCR) preparation.Nucleic acid molecule of the present invention is DNA or RNA molecule preferably, for example cDNA or genomic dna molecule.Randomly, nucleic acid molecule of the present invention comprises one or more intervening sequences (intron).
In another preferred embodiment, nucleic acid molecule of the present invention comprises that one or more guarantee in prokaryotic cell prokaryocyte and/or eukaryotic cell, preferred the transcribing and the synthetic regulatory element of RNA molecule in vegetable cell.
Nucleic acid molecule of the present invention is suitable for changing the biosynthesizing/metabolism of starch in cell, the preferred plant cell, and this change realizes by following manner: have justice to express nucleic acid molecule of the present invention, antisense expression nucleic acid molecule of the present invention, express suitable ribozyme, suppress altogether or mutagenesis in vivo.
Therefore, the present invention also relates to allow the application of nucleic acid molecule of the present invention, the particularly dna molecular of in cell that changes the R1-protein expression level or vegetable cell translation or untranslated mRNA molecule synthesis (have justice or antisense effect, restraining effect or ribozyme) altogether.
In general, the application of nucleic acid molecule of the present invention is suitable for any plant species.Yet, preferred monocotyledons and dicotyledons, particularly crop plants and the most preferably plant of storage strach, for example rye, barley, oat, wheat, millet, sago, rice, corn, pea, wrinkled-seeded pea, cassava, potato, tomato, rape, soybean, hemp, flax, Sunflower Receptacle, cowpea, arrowroot, trifolium, wheat straw or clover particularly are potato, corn, rice or wheat plant.
Suppress method (Jorgensen, Trends Biotechnol.8 (1990), 340-344 well known to those skilled in the art altogether; Niebel etc., Curr.Top.Microbiol.Immunol.197 (1995), 91-103; Flavell etc., Curr.Top.Microbiol.Immunol.197 (1995), 43-56; Palaqui ﹠amp; Vaucheret, Plant.Mol.Biol.29 (1995), 149-159; Vaucheret etc., Mol.Gen.Genet.248 (1995), 311-317; With de Borne etc., Mol.Gen.Genet.243 (1994), 613-621).
In another embodiment, the present invention relates to the encode dna molecular of RNA molecule of the ribozyme activity that demonstrates specificity cracking dna molecular transcript of the present invention.Ribozyme is can the cleaving rna molecule and the RNA molecule with catalytic activity of specific target sequence.Can measure specificity by recombinant DNA technology with respect to the ribozyme of nucleic acid molecule of the present invention.Dna molecular for the ribozyme for preparing coding specificity cracking dna molecular transcript of the present invention for example makes the both sides of the dna sequence dna (dna molecular) of encoding ribozyme catalyst structure domain be connected with dna sequence dna of the present invention.The nucleotide sequence of described catalyst structure domain of encoding is: the catalyst structure domain (Davies etc. of the satellite DNA of SCMo virus for example, Virology 177 (1990), 216-224) or the catalyst structure domain of the satellite DNA of TobR virus (Steinecke etc., EMBO are (1992) J.11,1525-1530; Haseloff and Gerlach, Nature 334 (1988), 585-591).The dna sequence dna that is positioned at described catalyst structure domain flank preferably is used as dna molecular of the present invention or its part of target thing.General Principle and method that ribozyme is expressed are described among the EP-B1 0 321 201.The expression of ribozyme in vegetable cell further describes the Mol.Gen.Genet.250 (1996) at Feyter etc., among the 329-338.
Method by " mutagenesis in vivo " also can reduce the activity of R1-protein of the present invention in vegetable cell.Therefore, hybrid RNA/DNA oligonucleotide (mosaic) is introduced cell (Kipp etc., Poster Session at the 5th International Congress of PlantMolecular Biology, 21-27 day in September, 1997, Singapore; Dixon and Arntzen, about the meeting report of " Metabolic Engineering in Transgenic Plants ", Keystone Symposia, Copper Mountain, CO, USA, TIBTECH 15 (1997), 441-447; WO 95/15972-A1; Kren etc., Hepatology25 (1997), 1462-1468; Cole-Strauss etc., Science 273 (1996), 1386-1389).
Therefore, another object of the present invention provides and a kind ofly demonstrates the active plant of the proteinic change of R1-of the present invention, preferably wheat plant by what mutagenesis in vivo obtained.
In addition, the present invention relates to a kind of carrier, especially plasmid that is suitable for comprising of genetic engineering of nucleic acid molecule of the present invention (for example DNA and/or RNA), clay, virus, phage etc.; The carrier that particularly is suitable for the genetic engineering of bacterium and/or plant.Term " carrier " refers to permission known in those skilled in the art and changes strand or double chain acid molecule target the carrier of host cell over to, for example: DNA or RNA viruses or viral fragment; The plasmid that under the situation that is with or without the regulatory element existence, is suitable for nucleic acid molecule is changed over to cell; The metallic particles that in the particle gun method, uses for example; Can directly introduce the nucleic acid molecule of cell in addition by chemistry and/or physical method.
The present invention relates to a kind of genetically modified host cell that transforms and/or recombinate and operate by nucleic acid molecule of the present invention or carrier in another embodiment, particularly a kind of genetically modified prokaryotic cell prokaryocyte or eukaryotic cell and more preferably a kind of genetically modified bacterium or vegetable cell.Genetically modified host cell of the present invention, especially genetically modified bacterium or vegetable cell contain one or more nucleic acid molecule of the present invention, they stably are integrated into the genome of described cell, respectively preferred not on the locus of homologous gene group, not in genome on the position of the gene of natural appearance.Can identify transgenic cell of the present invention by southern blotting technique, RNA trace and/or western blot analysis.
In addition, the present invention relates to derive from genetically modified host cell of the present invention and/or it contains the offspring's of nucleic acid molecule of the present invention or carrier transgenic cell.
Because nucleic acid molecule of the present invention and/or carrier are provided; can prepare transgenic plant cells or the plant that comprises nucleic acid molecule of the present invention and/or carrier by recombinant DNA technology; particularly monocotyledons or dicotyledons cell or plant; preferred crop plants cell or plant particularly are selected from the vegetable cell or the plant of the group of following composition: potato; corn; oat; rye; barley; wheat; pea; rice; millet; wrinkled-seeded pea; cassava; sago; tomato; rape; soybean; hemp; flax; Sunflower Receptacle; cowpea; arrowroot; trifolium; wheat straw; clover or cassava.
Transgenic plant cells of the present invention or phytosynthesis with regard to structure and/or physics and/or chemical property, be different from the treated starch of synthetic starch in wild-type (unconverted) plant.By genetic engineering and/or molecular biology method with carrier of the present invention and/or nucleic acid molecule introduced plant cell, preferably be connected with guaranteeing one or more regulatory elements of transcribing and/or translating in described vegetable cell.Randomly, subsequently with the complete plant of transgenic plant cells regeneration of gained.
Therefore; the present invention relates to a kind of transgenic plant cells that comprises nucleic acid molecule of the present invention and/or carrier; particularly monocotyledons or dicotyledons cell; the cell of cell, particularly potato, wheat, corn or the rice of preferred potato, corn, oat, rye, barley, wheat, pea, rice, millet, wrinkled-seeded pea, cassava, sago, tomato, rape, soybean, hemp, flax, Sunflower Receptacle, cowpea, arrowroot, trifolium, wheat straw, clover or cassava.
The invention still further relates to the preparation method of a kind of genetically modified host cell, preferred plant cell, this method comprises introduces the genome that belongs to prokaryotic cell prokaryocyte or eukaryotic host cell, the genomic step of preferred introduced plant cell with nucleic acid molecule of the present invention and/or carrier.Preferred described cell contains the nucleic acid molecule that is connected with one or more regulatory elements of transcribing and/or translating of guaranteeing in described cell.Suitable regulatory element preferably is homology or allogenic for nucleic acid molecule of the present invention.
In another embodiment, the present invention relates to a kind of transgenic plant cells, (homologous or randomly, the allogenic) nucleic acid molecule of the present invention that wherein exists directly or indirectly causes R1-protein expression of the present invention or directly or indirectly causes suppressing encoding the expression of proteinic one or more endogenous genes of R1-on the other hand.Preferred described transgenic plant cells comprises the nucleic acid molecule of the group that is selected from following nucleic acid molecule composition:
(a) be transcribed into the nucleic acid molecule of the present invention that adopted RNA is arranged that causes R1-protein expression of the present invention, preferred dna molecular;
(b) be transcribed into proteinic one or more endogenous gene expressions of R1-that cause encoding and reduce the nucleic acid molecule of the present invention of the sense-rna of (inhibition), preferred dna molecular;
(c) be transcribed into proteinic one or more endogenous gene expressions of R1-that cause encoding and reduce the nucleic acid molecule of the present invention of the common inhibition RNA (adopted RNA is arranged) of (inhibition), preferred dna molecular;
(d) be transcribed into the nucleic acid molecule of the present invention of the ribozyme of proteinic one or more endogenous gene transcripts of specificity cracking coding R1-, preferred dna molecular;
(e) nucleic acid molecule of the present invention of proteinic one or more endogenous genes of introducing by mutagenesis in vivo of modification coding R1-;
Changed the starch metabolism/biosynthesizing in the described cell thus.
If changed the metabolism of starch in plant by the antisense effect, dna molecular so of the present invention guarantees that with one or more regulatory element of transcribing in vegetable cell and/or translating is connected on antisense orientation, randomly, it comprises the intron of the corresponding gene group sequence of the polynucleotide that one or more are expressed.Sense-rna should have minimum about 15-25 Nucleotide, preferably at least about 50-100 Nucleotide and most preferably at least about 200-1000 Nucleotide.
In another embodiment, obtain reducing by the proteinic amount of R1-in a kind of ribozyme render transgenic vegetable cell that comprises nucleic acid molecule of the present invention.In order in transgenic plant cells of the present invention, to express described ribozyme molecule, the dna molecular of the described ribozyme of coding is connected with one or more regulatory elements of guaranteeing to transcribe and/or translate.
Can be by the well-known method of those skilled in the art with the complete plant of described transgenic plant cells regeneration.Can also be theme of the present invention by the regenerate transgenic plant that comprise transgenic plant cells of the present invention of transgenic plant cells acquisition of the present invention and the preparation method of described transgenic plant.
Transgenic plant of the present invention are a kind of monocotyledons or dicotyledons; preferred crop plants; particularly rye, barley, oat, rice, wheat, millet, sago, corn, pea, wrinkled-seeded pea, cassava, potato, tomato, cassava, rape, soybean, hemp, flax, Sunflower Receptacle, cowpea, butch clover, wheat straw, clover or arrowroot plant, particularly corn, wheat, rice or potato plants.
In addition, the present invention relates to reproductive material, seed, organ and the position of plant of the present invention.
The invention still further relates to a kind of method that is used to produce starch, this method comprises the step in the production/extraction process of transgenic plant cells of the present invention, plant and/or plant parts introducing starch.
The invention further relates to a kind of method that is used to produce treated starch, this method comprises the step in the technology of the chemistry of starch introducing starch of the present invention and/or physical modification/processing.
The technology of extracting starch from plant, vegetable cell or its position is well-known in the art.For example, this class technology is described in the Cereal Chem.73 (1996) of Eckhoff etc., among the 54-57.For example extract W-Gum by " wet milling process ".Be used for being described in the following document from other method of each kind of plant extraction starch: for example Starch:Chemistry andTechnology (edits: Whistler, BeMiller and Paschall (1994) the 2nd edition, Academic Press Inc.London LTD; ISBN 0-12-746270-8; The XII chapter, the 417-468 page or leaf; Watson, S.A.:Corn and Sorghum Starches:Production, XIII chapter, 469-479 page or leaf; Corbishley and Miller:Tapioca, Arrowroot and Sago Starches:Production; The XIV chapter, the 479-490 page or leaf; Mitch:Potato Starch:Production and Uses; The XV chapter, the 491-506 page or leaf; Knight and Olson:Wheat Starch:Production, Modification and Uses; The XVI chapter, the 507-528 page or leaf; Rohwer and Klem:RiceStarch:Production and Uses).Being used for extracting the equipment of using always the method for starch from vegetable material is separator, decantor, hydrocyclone and for example spray-dryer or the different types of like this machine that is used for dry starch of ejector drier.
The invention still further relates to can be available from transgenic plant cells of the present invention, plant and/or plant parts, preferably available from the treated starch of wheat.Transgenic cell of the present invention or phytosynthesis be different from regard to phosphorylation degree can be available from the treated starch of the starch of unconverted plant.In specific embodiment of the present invention, starch of the present invention demonstrates than the phosphate ester content that can increase available from the starch of corresponding no transformed cells or plant.The sulfuric ester content that the phosphate ester content (phosphoric acid one ester content) that increases refers to starch is than increasing about 10-30% available from the phosphate ester content of the starch of corresponding unconverted plant at least, more preferably increasing by 30% even more preferably increase by 50% and especially preferably increase and arrive about 1000-5000% more than 100% at least at least.In general, percent value for example refers to according to Lim etc. at Cereal Chem. (1994) 71, and Robison ester (glu-6-P) content of the wheat starch that the method described in 448 is measured is about 0.3nmol glu-6-P/mg starch.Therefore, wheat starch of the present invention comprise the Robison ester content of 0.4nmol/mg starch at least, more preferably at least the Robison ester content of 0.8nmol/mg starch, particularly at least the Robison ester content of 1.0nmol/mg starch, especially at least about the Robison ester content of 1.5nmol/mg starch and the Robison ester content of 3.0nmol/mg starch at least most preferably.
In another embodiment of the invention, the phosphate ester content of the reduction that starch of the present invention demonstrates (phosphoric acid one ester content) for can available from the phosphate ester content of the starch of corresponding unconverted plant at least about 5-20%, preferably at least about 21-50%, be even more preferably about 51-95%.Therefore, the Robison ester content that demonstrates of wheat starch of the present invention be lower than 0.2nmol/mg starch, preferably be lower than 0.1nmol/mg starch, more preferably less than 0.05nmol/mg starch, particularly be lower than 0.02nmol/mg starch, especially be lower than 0.01nmol/mg starch and most preferably be lower than 0.001nmol/mg starch.
Another object of the present invention provides a kind of method that is used to prepare R1-protein or derivatives thereof of the present invention or its part, and this method is included in the step of cultivating genetically modified host cell of the present invention under the condition that allows the described R1-protein or derivatives thereof of expression or its part and separating described R1-protein or derivatives thereof or its part from the substratum of described cell and/or described cell.
In addition, the present invention relates to R1-protein (R1-polypeptide) or derivatives thereof or its part by the obtainable nucleic acid molecule encoding of the present invention of method by being used to produce R1-protein or derivatives thereof of the present invention or its part, preferably derive from R1-protein or derivatives thereof or its part of wheat, especially according to R1-protein or derivatives thereof or its part of Seq.ID No.2 and Seq.ID No.10.
In the present invention, term " guarantee transcribe and/or translate regulatory element " preferably has such as promotor, enhanser, terminator etc. and makes the transcripting starting in the cell and/or the implication of terminated nucleic acid molecule (for example DNA and/or RNA) like this.Term " guarantee transcribe and/or translate regulatory element " can also comprise and causes being subjected in plant and/or the vegetable cell time and/or zone (endosperm, root, stem tuber, leaf, stem, seed, fruit, apoplast, vacuole, cytosol, plastid, plastosome, lysosome) but the transcribing or the nucleic acid molecule of chemical induction of restriction.
In order in vegetable cell, to express nucleic acid molecule of the present invention, can use any active promotor.Described promotor can be a homology or allogenic for institute's plant transformed cell, for example be used for the cauliflower mosaic virus (CaMV) of constitutive expression 35S promoter (Odell etc., Nature 313 (1985), 810-812; Mitsuhara etc., Plant andCell Physiology 37 (1996), 49-59) or the promoter construct of describing among the WO 94/01571-A1.Suitable cause in addition by for example with regard to plant particular organization or position such endogenous and/or the extrinsic factor (for example WO 93/07279-A1) of limited expression determine/inductive is subjected to the expression promoter (Stockhaus etc. of zone and/or time limitation, EMBO is (1989) J.8,2245-2251).Preferably in the conversion plant, has active promotor in the position of storage strach.For example so preferred plant parts such as corn, wheat and rice grain or seed and potato tuber etc. is used to express nucleic acid molecule of the present invention.In order to transform potato, (Rocha-Sosa etc., EMBO are (1989) J.8,23-29) can to use stem tuber specific b 33-promotor.Except that promotor, start the DNA district that transcribes and to contain the dna sequence dna of guaranteeing to transcribe further increase such as so-called enhanser-element like this.For at vegetable cell and particularly in wheat cell, express, can use following promotor: 35S promoter (Odell etc., above; Mitsuhara etc., above); (US 5,614,399, Christensen etc., Plant Mol.Biol.18 (1992), 675-689 for the ubiqutin promotor; Takimoto etc., Plant Mol.Biol.26 (1994), 1007-1012; Corne jo etc., PlantMol.Biol.23 (1993), 567-581; Toki etc., Plant Phys.100 (1992), 1503-1507); Gluten promotor (Leisy etc., Plant Mol.Biol.14 (1990), 41-50; Zheng etc., Plant are (1993) J.4,357-366; Kononowicz etc., JointAnnual Meeting of The American Society of Plant Physiologistsand The Canadian Society of Plant Physiologists, Minneapolis, Minnesota, USA, 1 day-August 4 July in 1993; Plant Physiol.102 (supplementary issue) (1993) 166; Zhao etc., Annual Meeting of The AmericanSociety of Plant Physiologists, Pittsburgh, Pennsylvania, USA, 1-5 day in August, 1992; Plant Physiol.99 (supplementary issue 1) (1992), 85; Yoshihara etc., FEBS Lett.383 (1996), 213-218); Actin promoter (McElroy etc., Plant Cell 2 (1990), 163-171); The cab-6 promotor (Plant and Cell Physiology 35 (1994), 773-778); (Yin etc., Plant are (1997) J.12,1179-1188) for the RTBV promotor; The CVMV promotor (Verdaguer etc., Plant Mol.Biol.31 (1996), 1129-1139); Rab 16B promotor (Plant Physiol.112 (1996), 483-491); The promotor of psbD-C operon (To etc., Plant and Cell Physiology 37 (1996), 660-666); The Tpi promotor (Snowden etc., Plant Mol.Biol.31 (1996), 689-692); The Osgrpl promotor (Xu etc., Plant Mol.Biol.28 (1995), 455-471); (Kalla etc., Plant are (1994) J.6, and 849-860), (40-48) (EMBO is (1991) J.10,1803-1808) with the LHCP promotor for Kyozuka etc., Mol.Gen.Genet.228 (1991) for the ADH1 promotor for the Ltp2 promotor.
In addition, term " regulatory element " also comprises and is suitable for stopping transcribing and/or poly A tail is added to termination signal on the nucleic acid molecule of transcribing.The example of termination signal is nopaline synthase gene (NOS gene) or the octopine synthase gene (Gielen etc. that comprise from Agrobacterium, EMBO is (1989) J.8,3 '-non-translational region of polyadenylation signal 23-29), from the 3 '-non-translational region or the ribulose-1,5-bisphosphate of the storage protein gene of soybean, the little subunit (ssRUBISCO) of 5-bisphosphate carboxylase.Randomly, term " regulatory element " comprises the nucleic acid molecule of for example guaranteeing the specific localization of transcribing and/or translating of nucleic acid molecule of the present invention in specific tissue (for example endosperm, leaf, stem, stem tuber, meristematic tissue, fruit, root, seed) or cellular compartment (for example cytosol, apoplast, plastid, plastosome, vacuole, lysosome).Randomly, term " regulatory element " also comprises the nucleic acid molecule of for example guaranteeing that nucleic acid molecule of the present invention is subjected to time limitation to transcribe and/or translate.In addition, " regulatory element " can randomly be triggered with chemical mode.
The general use guarantees that described nucleic acid molecule stable integration goes into the cloning vector of Plant Genome with nucleic acid molecule of the present invention, preferred DNA or RNA molecule introduced plant cell.For nucleic acid molecule is introduced higher plant, can use and contain the cloning vector that intestinal bacteria reproducing signals and for example pBR322, pUC series, M13mp series, pACYC184 are used to screen the marker gene of transform bacteria cell so in a large number.By using one or more restriction endonucleases nucleic acid molecule of the present invention can be integrated on the suitable restriction site of carrier.The plasmid that obtains is used to transform for example Bacillus coli cells.In suitable medium, cultivate cell transformed and collect subsequently and cracking, reclaim plasmid DNA and generally come it is analyzed by restriction enzyme digestion and/or sequential analysis by standard method.After each operation, can be connected with other dna sequence dna with described plasmid DNA cutting and with the dna fragmentation that obtains.For with DNA introduced plant host cell, can use a large amount of method for transformation and technology: for example, transform by the T-DNA that uses Agrobacterium tumefaciens or Agrobacterium rhizogenes; Protoplastis merges; The DNA injection; The DNA electroporation; With introduce DNA by membrane permeation (PEG) or by biological (biolistic) method and other method.Should contain selectable marker gene if desire so by the transgenic plant cells complete plant that regenerates.If use Ti-or Ri-plasmid, for example for transformed plant cells, so should be, preferably its right side and left side edge and desire are introduced described vegetable cell and be connected as the polynucleotide of flanking region with the right side edge at least of Ti-or Ri-plasmid T-DNA.If Agrobacterium is used for transforming, the dna clone that desire should be introduced is in intermediate carrier or binary vector so.Because the sequence homology of sequence and T-DNA is so can be integrated into intermediate carrier the Ti-or the Ri-plasmid of Agrobacterium by homologous recombination.Described intermediate carrier also contains the requisite vir-of transfer T-DNA district.Because intermediate carrier can not duplicate in Agrobacterium, so helper plasmid can be transferred to intermediate carrier (conjugation) in the Agrobacterium.Binary vector can duplicate intestinal bacteria with in Agrobacterium.They contain selectable marker gene and are positioned at the joint or the polylinker of right side and T-DNA marginarium, left side flank.They directly can be transformed into Agrobacterium (Hoslters etc., Mol.Gen.Genet.163 (1978), 181-187).The plasmid that is used to transform Agrobacterium further comprises a kind of selectable marker gene, for example allows to select the NPTII gene of the bacterium that transforms.This plasmid can comprise for example to spectinomycin (Svab etc., Proc.Natl.Acad.Sci.U.S.A.87 (1990), 8526-8530; Sval etc., Plant Mol.Biol.14 (1990), 197-206), Streptomycin sulphate (Jones etc., Mol.Gen.Genet.91 (1987), 86-91; Svab etc., Proc.Natl.Acad.Sci.U.S.A.87 (1990), 8526-8530; Svab etc., Plant Mol.Biol.14 (1990), 197-206), phosphinothricin (De Block etc., EMBO is (1987) J.6,2513-2518), (Thompson etc., EMBO are (1987) J.6,2519-2523 for glyphosate; Thompson etc., Weed Sci.35 (1987), 19-23 (supplementary issue)) or Totomycin (Waldron etc., Plant Mol.Biol.5 (1985), 103-108) other selectable marker gene of generation resistance.The Agrobacterium host cell should contain the plasmid that carries the vir-district.The vir-district is absolutely necessary to T-DNA is transferred in the vegetable cell.Can contain additional T-DNA.The Agrobacterium that is transformed is further used for transformed plant cells.
The application of T-DNA in transformed plant cells is described in the following document: EP-A-120516; Hoekema:The Binary Plant Vector System OffsetdrukkerijKanters B.V., Alblasserdam (1985), V chapter; Fraley etc., Crit.Rev.Plant.Sci., 4,1-46 and An etc., EMBO is (1985) J.4,277-287.Binary vector is purchased, for example pBIN19 (Clontech Laboratories, Inc., USA).
For DNA is transferred in the vegetable cell, the explant of plant can be cultivated altogether with Agrobacterium tumefaciens or Agrobacterium rhizogenes.Can be in allow selecting the suitable medium (for example containing microbiotic or biocide etc.) of transformant complete plant regenerates from the vegetable material that infects (for example blade, stipes, root, the vegetable cell that also has protoplastis or suspension to cultivate).The DNA of the introducing that the foliage filter screening that obtains is existed.For by use biological example (biolistic) method or by transform protoplastis introduce other possibility of foreign DNA be for a person skilled in the art known (for example, Willmitzer, L., 1993Transgenic plants:Biotechnology, A Multi-VolumeComprehensive Treatise (H.J.Rehm, G.Reed, A.P ü hler, P.Stadler edits), Vol.2,627-659, VCH Weinheim-New York-Basel-Cambridge).
Transforming dicotyledons by Agrobacterium tumefaciens by Ti-plasmid-carrier system is a kind of method of establishing fully.Agrobacterium can also be used for transforming monocots (Chan etc., Plant Mol.Biol.22 (1993), 491-506; Hiei etc., Plant are (1994) J.6,271-282).
The alternative method that is used for transforming monocots has: for example, transform by biological (biolistic) means; Protoplast transformation; The electroporation of the penetrating cell of part; Introduce DNA by glass fibre.Various reference relate to conversion (the WO 95/06128-A1 of corn; EP-A-0 513 849; EP-A-0 465 875).How to have described among the EP-A-292 435 by no mucous crisp grain maize calli and obtained the method that to educate plant as raw material.Shillito etc. (Bio/Technology 7 (1989), 581) with the callus suspension culture that produces differentiation protoplastis that can the complete plant of regeneration as raw material.
With regard to transformed wheat, can variety of methods: for example (Hiei etc., Plant are (1994) J.6,271-282 in the transgenosis of Agrobacterium mediation; Hiei etc., PlantMol.Biol.35 (1997), 205-218; Park etc., J.Plant.Biol.38 (1995), 365-371); Protoplast transformation (see: Gene transfer to plants, I.Potrykus, G.Spangenberg (editor), Springer-Verlag BerlinHeidelberg, 1995,66-75 page or leaf by data; Datta etc., Plant Mol.Biol.20 (1992), 619-629; Sadasivam etc., Plant Cell Rep. (1994), 394-396); Biological (biolistic) means (Li etc., Plant Cell Rep.12 (1993), 250-255; Cao etc.,, Plant Cell Rep.11 (1992), 586-591; Christou, Plant Mol.Biol.81997,197-203); And electroporation (Xu etc.: Gene transferto plants, I.Potrykus, G.Spangenberg (editor), Springer-VerlagBerlin Heidelberg (1995), 201-208).
In case the DNA that introduces is integrated into the genome of vegetable cell, then its integration and being retained in offspring's genome of original cell transformed usually with being stabilized.Cell transformed contains a kind of selectable marker gene usually, and its allows to select transformant having under some carbohydrate, amino acid, biocide or the situation that for example the such microbiotic of kantlex, G 428, bleomycin, Totomycin or phosphinothricin exists.Therefore, each selectable marker gene allows contrast to lack the cell selection cell transformed of the DNA that introduces.
After selection, cultivate institute's cell transformed under normal operation and make it grow into complete plant (McCormick etc., Plant Cell Reports 5 (1986), 81-84).Can be with the plant and heredity with same conversion or different genetic plant hybridization breeding of gained.The individuality of gained or crossbred have corresponding phenotypic characteristic.Should make two generations or many generation growths so that no matter guarantee that any phenotypic characteristic is all stable and can transform.In addition, seed should be gathered so that guarantee corresponding phenotype or other characteristic remains.
Can be available from vegetable cell, can maybe can be suitable for a large amount of industrial applications available from plant of the present invention by the treated starch that the inventive method obtains.Basically, starch can be divided into again two main fields.A field comprises the hydrolysate of starch, and another is so-called native starch.Hydrolysis mainly comprises glucose or the dextran component that obtains by enzyme or chemical process.They can be used for further technology, such as fermentation and chemically modified.At present use amyloglucosidase to carry out the hydrolysis of starch in the enzymatic mode basically.By using more a spot of hydrolysis can reduce cost with enzyme, this is because change has taken place starch structure, and for example the surface-area of grain increases, causes because of branching is less digestibility to improve or space structure changes, and it has limited used enzyme and has entered.The application of so-called native starch can be divided into following field again:
(a) application of preparation food
Starch is the additive of traditional various food, and wherein it is mainly used in the purpose of bonding aqueous additive or viscosity is increased or gelling increases.Important features characteristic is mobile and sorbency, swelling temperature and gelatinization point, viscosity and thickening property, solvability, transparency and paste structure, thermotolerance, slip resistance and the acid resistance of starch, the trend that decreases, film forming ability, freezing/melt resistance, digestibility and with the ability of for example inorganic or organic ion formation mixture.
(b) application of preparation non-food product
Another main application fields is the additive that starch can be used as the auxiliary in the various production processes or be used as handicraft product.Starch at first is paper-making industry and paperboard industry as the main application fields of auxiliary.In this field, starch is mainly used in fixing (keeping solid-state), be used for gluing filler and fine particle, as curing material and be used for dehydration.In addition, use the advantageous feature of the starch of relevant stiffness, hardness, stationarity, feel, gloss, smoothness, tear strength and surface-area.
In the production process of paper, can promptly distinguish between surface, coating, agglomerate and the spraying 4 Application Areass.
Relevant starch surface-treated is required mainly to be the brightness of height, corresponding viscosity, high viscosity stability, good film-forming properties and to form less dust.When being used for the applying solid inclusion, corresponding viscosity, high adhesive capacity and high pigment affinity play an important role.Quick, even, the lossless dispersion of additive as agglomerate, high mechanical stability and in paper pulp completely retention have importance.When starch was used to spray, corresponding solids content, high viscosity and high adhesive capacity also were important.A main Application Areas for example is in adhesives industry, and wherein the Application Areas with starch is divided into 4 fields again: as pure amylan, be used for the preparation of special chemical substance amylan, with starch as the additive of synthetic resins and polymeric dispersions and the supplement that starch are used as composite adhesives.With the matrix material, envelope that all are used to produce gauffered board, paper capsule and paper bag, paper and aluminium based on 90% of the tackiness agent of starch with box and glue, stamp etc.
Starch is the production process that is used for fabric care product as another possible application of auxiliary and additive.In textile industry, can in following 4 Application Areass, distinguish: with starch as tackiness agent, promptly as ironing with strengthen and be used for the auxiliary that prevents braiding process active tension and be used for increasing the deburring characteristic of braiding process wear resistance; As mainly on the turn after the pre-treatment fabric improve, such as the reagent of bleaching, dyeing etc.; Thickening material as the dye paste production process that is used for preventing dye diffusion; Be used for the additive of suture with conduct with the winding agent.
In addition, can be with the additive of starch as material of construction.Example is to produce plasterboard, and blended starch becomes paste, spreads and make cardboard and described plasterboard bonding thus in gypsum board surface in the wherein thin terra alba with water.Other Application Areas is that starch is mixed with terra alba and mineral fibre.In ready mixed concrete, starch can be used to make the starching process to slow down.
In addition, starch is advantageously used in production and prevents that temporarily soil particle is subjected to the people moves the influence of middle water for the stratum soil stabilization instrument.According to the knowledge of prior art, the combined prod of being made up of starch and polymer emulsion can be regarded as and have identical subtracting with used product up to now and corrode and subtract encrustment; Yet they are quite cheap.
The Another application field is a starch in the application of the plant protection product of the special characteristics that is used for changing these goods.For example, starch is used to improve the wettability of plant protectant and fertilizer; Be used for the quantitative release of active ingredient; Be used for liquid, volatility and/or activeconstituents odorous are changed into crystallite, stable, deformable material; Be used to mix inconsistent composition; With slowly be used for the prolongation effect time limit because of decomposing.
Starch can also be used for medicine, medical treatment and cosmetic industry field.In pharmaceutical industry, can be with starch as the tackiness agent of tablet or be used for diluting the tackiness agent of capsule.In addition, starch is suitable as the disintegrating agent of tablet, and this is because its absorbs liquid and it swells to activeconstituents is discharged in back in short-term when swallowing.It also is a kind of suitable auxiliary agent (retardation) that reaches time lag type release of active ingredients.Owing to qualitative reason, medicinal flowable formulation (flowance) and dusting are other Application Areass.In cosmetic field, for example, with starch as carrier such as the such powder additive of spices and Whitfield's ointment.The relative wide application field of starch is a toothpaste.
The additive that starch is used as coal and briquet also is suitable.By adding starch, coal can become piece quantitatively and/or roll into a ball into high-quality briquet, has prevented the too early disintegration of briquet thus.Burn coal and contain the interpolation starch of 4-6%, the heat coal of 0.1-0.5%.In addition, starch is suitable as tackiness agent, can obviously reduce distributing of toxicant because add it in coal and briquet.
In addition, can be with starch as the flocculation agent in processing ore and the coal slime.
The Another application field is with the additive of starch as processing materials in the casting.With regard to various casting process, need be by the core of the sand production that is mixed with tackiness agent.At present, the most frequently used tackiness agent is to be mixed with treated starch, and major part is the wilkinite of swollen starches.
The purpose of adding starch is to increase flow resistance and improves bond strength.In addition, swollen starches can satisfy other prerequisite of production technique, such as the dispersiveness in cold water, rehydration degree, in sand good compatibility and the ability of height combination water.
In rubber industry, starch can be used to improve technology and optical quality.Owing to this reason just requires to improve surface luster, feel and outward appearance.For this purpose, before cold vulcanization, starch is dispersed on the viscosity glue-coated surface of rubber material.Starch can also be used to improve the printability of rubber.
The Another application field of treated starch is the production leather substitutes.
On plastics market, emerging following Application Areas: the product that will derive from starch is integrated into the course of processing (starch only is filler, does not exist directly bonding) or will derives from starch on the other hand between synthetic polymer and starch product is integrated in the production process of polymkeric substance (starch and polymer formation stable bonding).
Starch as pure filler can not with such as such other material competition of talcum.When special starch property becomes effectively and the characteristic of finished product distributes when obviously changing thus, above-mentioned situation can change.An example is that starch product is used to process such as the such thermoplastic material of polyethylene.Therefore, starch and synthetic polymer are formed master batch by 1: 1 mixed, can produce variant production by using granulated poly routine techniques thus by coexpression.The integration of starch can make the saturating property increase of material in hollow body, water vapor permeation property improvement, antistatic property improve in the polyethylene film, agglomeration preventing performance improves and use the printability of moisture dyestuff to improve.
Another kind of possibility is the application of starch in urethane foam.Because the employing of starch derivative and because the optimization of processing technology, so can carry out specific control to the reaction between synthetic polymer and the starch hydroxyl.The result has made polyurethane film have the following properties distribution in response to having used starch: thermal expansivity reduces; Shrinkage reduces; Pressure/tension force improved performance; Water vapor permeability increases and not change of water-absorbent; Flammable and cracking density reduces; There is not ignitable part to overflow; Not halide and aging minimizing.Still the defective that exists is that pressure and shock strength reduce at present.
The research and development of film product no longer are unique selections.Can also produce the solid plastic product that has 50% above starch content such as jar, plate and bowl like this.In addition, starch/polymeric blends provides them very easily in biodegradable advantage.
In addition, because the ability of their combination water more extremely strong than starch, so graftomer has obtained great importance.These products are to contain starch and according to the product of the side chain lattice of the synthon in the grafting of free radical chain mechanism.Obtainable starch-grafted polymkeric substance is characterised in that the high viscosity of the bonding and save power of improvement up to 1000g water/g starch at present.Mainly these superabsorbers are used for sanitation and health-care field, for example are applied in such as in the such product of diaper and sheet and be applied in the such agriculture field of seed grain for example.Depositing of biomaterial
According to the requirement of budapest treaty as described in the present invention following plasmid be deposited with the Deutsche Sammlung f ü r Mikroorganismen undZellkulturen (DSMZ) of the Braunschweig of Germany:
Plasmid pTaR1-11 refers to the deposit numbers DSM No.12810 that deposited on May 20th, 1999.
Plasmid RS26-88 refers to the deposit numbers DSM No.13511 that deposited on May 24th, 2000.
The following example only is used for explaining the present invention and limits the present invention never in any form.Embodiment 1: from common wheat L., the proteinic cDN's of coding R1-of cv Florida
Preparation
In order to identify and to separate the proteinic cDNA of R1-that coding derives from wheat, by using λ zap II carrier (λ ZAP II-cDNA synthetic agent box, Stratagene GmbH, Heidelberg, Germany), prepare wheat cDNA library by 21 age in days wheat plant Yings fruit (" starch-containing "-endosperm) poly+RNA according to the scheme of manufacturers.The original titre in this cDNA library is about 1.26 * 10 6Pfu/ml.
Use oligonucleotide R1A and R1B as inserting fragment and carry out the primer of PCR (polymerase chain reaction) amplification and screen the cDNA library to containing plasmid pBinAR Hyg (DSM 9505) DNA that coding derives from the proteinic cDNA of R1-of corn.Described plasmid for example can be according to the embodiment 14 described acquisitions of WO98/27212.Therefore, special disclosure with WO 98/27212-A1 is incorporated herein by reference.
After carrier pBluescript being carried out the digestion of Xba I/Asp 718 restriction endonucleases, by agarose gel electrophoresis and standard scheme purifying cDNA fragment.
As the template that is used for described corn cDNA fragment is carried out pcr amplification, use the above-mentioned isolating corn cDNA fragment of about 10pg.
The PCR damping fluid contains 1.5mM MgCl 2, 20mM Tris-HCL (pH 8.4), 50mM KCl, 0.8mM dNTP mixture, 1 μ M primer R1A, 1 μ M primer R1B and 2.5 units the Taq polysaccharase.
R1A：5’TATTGGAAGCTCGAGTTGAAC?3’(Seq.ID?No.3)
R1B：5’TTGAGCTGTCTAATAGATGCA?3’(Seq.ID?No.4)
According to following scheme at Trioblock The PCR-thermal cycler (Biometra, carry out the PCR circulation in Germany) so that amplification coding derives from the proteinic cDNA fragment of the R1-of corn: 95 ℃ are following 4 minutes; 96 ℃ following 1 minute; 62 ℃ following 45 seconds; 72 ℃ following 1 minute 15 seconds; Totally 30 circulations; With 72 ℃ following 5 minutes.
Subsequently, digitoxin (digoxygenin) mark that the fragment that obtains is guided at random according to the scheme (Boehringer Mannheim, DIG system user guide) of manufacturers.
With the cDNA fragment of the amplification of 1924bp and mark further as the allos probe in the cDNA library that derives from wheat of the above-mentioned preparation of screening.
Screen about 3.5 * 10 according to standard scheme 5Phage.
5 * SSC under 55 ℃, 3% blocking-up liquid (Blocking) are (BoehringerMannheim), in 0.2% SDS, 0.1% sodium lauryl sarcosinate and the 50 μ g/ml black carp sperm DNAs behind the prehybridization, hybridize (Yin Dao dna marker test kit at random) r1-protein probe (the corn Xbal/Asp718 cDNA fragments of 1924 bp) of this filter membrane and 1ng/ml digitoxin (digoxygenin) mark and spend the night.At room temperature this filter membrane was washed 2 times, 5 minutes with 2 * SSC, 1% SDS totally; Washed 2 times, totally 10 minutes with 1 * SSC, 0.5% SDS down at 55 ℃; And under 55 ℃, washed 2 times, totally 10 minutes with 0.5 * SSC, 0.2% SDS.
Again screen and the purifying positive colony.(Stratagene is Heidelberg) by excision separation quality grain (pBluescript SK Phagemide) in the body according to the scheme of manufacturers.After described clone being carried out characterization, further analyze the longest cDNA and insert fragment by restriction analysis.The cDNA of embodiment 2:pTaR1-11 inserts the fragments sequence analysis
(5463-5467) cDNA that analyzes the isolating pTaR1-11 of clone of institute inserts segmental nucleotide sequence for Sanger etc., Proc.Natl.Acad.Sci.USA74 (1977) according to the dideoxy nucleotide method.
Clone pTaR1-11 contains the insertion fragment of 672bp, and this fragment representative coding is according to the proteinic Partial cDNA according to Seq.ID No.1 of the R1-that derives from wheat of Seq.ID No.2.
The corresponding aminoacid sequence of the polynucleotide of Seq.ID No.1 provides in Seq.ID No.2.Embodiment 3: from the proteinic cDNA's of coding R1-of common wheat L.cv Florida
Separate and Sequence Identification
In order to identify and to separate coding from the proteinic cDNA of the R1-of wheat, always in the 3-6 of the wheat Lao Ye in age in week, separate poly+RNA and use RT-PCR-test kit (Titan One tube RT-PCR System, Roche Diagnostics, Mannheim, Germany), it is carried out reverse transcription according to the scheme of manufacturers.Use oligonucleotide Zm-R1-2 (Seq.ID No.5) and Wh-R1-5 (Seq.ID No.6) and as the encode amplification of the proteinic cDNA of R1-of the aliquot of the RT-reactant of template.
Following primer is elected to be the hybridization probe that is used for separating the proteinic required DNA of coding R1: primer binding site is positioned the 1-24 position and the 3402-3418 position of Seq.ID NOs.7 and 9:
Zm-R1-2(Seq.ID?No.5)：
5’-CTG?TGG?TCT?TGT?CTG?GAC-3’
Wh-R1-5’(Seq.ID?No.6)：
5’-GAG?GAA?GCA?AGG?AAG?GAA?CTG?CAG-3’
According to Eppendorf Mastercycler TM(Eppendorf, Hamburg Germany) carry out containing 10mM Tris-HCl pH 8.85,25mM KCl, 5mM (NH in PCR-reaction and this reaction gradient 4) SO 4, 1.5mM MgSO 4, 0.8mM dNTPs, 1 μ M primer Zm-R1-2,1 μ M primer Wh-R1-5 and 1 unit the Pwo-DNA-polysaccharase.Carry out following temperature program(me):
Beginning is following 2 minutes at 94 ℃; Then 94 ℃ following 1 minute, 55 ℃ following 1 minute and 72 ℃ following 3 minutes, amount to 35 circulations; With last 72 ℃ of following steps of 5 minutes.The 3.4 kb DNA-fragment clonings that obtain are gone into the EcoRV-site of pBluescript SK (-) carrier, thereby produce plasmid RE 23-88, (Konstanz Germany) cooperates and further to analyze its nucleotide sequence and as described in the SEQ ID No.7 with GATC GmbH.Its representative wherein 5 '-end～1kb and 3 '-end～major portion of the R1-gene that 300bp lacks.3 ' of disappearance-district and the clone's of the part R1-cDNA described in embodiment 1 and 2 respective area complementation, thus produce plasmid RS 26-88 and comprise SEQ ID No.9.In order to obtain it, with restriction endonuclease Ec/136 digestion clone RS 23-88.The big fragment of gained is used for further clone, and discards less 140bp fragment.Handle the clone TaR1-11 that contains R1 cDNA 3 '-district with restriction endonuclease Xhol, use the T4-DNA-polysaccharase restriction site is filled up into flush end and from carrier, to discharge by digesting with restriction endonuclease Ec/136 to make from 3 ' of the R1 cDNA of wheat-distinguish from wheat from embodiment 1 and 2.The fragment of this generation is connected on the flush end of RS 23-88 of Ec/136 digestion.Direction by restriction analysis control institute junction fragment.By (Konstanz, Germany) global cDNA clone (～3.7kb) primary structure and as described in the SEQ IDNo.9 is measured in the sequential analysis of carrying out once more through GATC GmbH.
Sequence table
Sequence table＜110〉Aventis CropScience GmbH＜120〉from nucleic acid molecule, transgenic plant cells and the plant of wheat
And application＜130 in producing treated starch〉AGR 1999/M 214＜150〉DE 199 26 771.5＜151〉1999-06-11＜160〉10＜170〉PatentIn Ver.2.1＜210〉1＜211〉672＜212〉DNA＜213〉common wheat＜220〉＜221〉CDS＜222, (3) .., (449)＜400〉1ct gaa gtg gtg aaa gga ctt gga gag aca ctt gtg gga gct tat cct 47 Glu Val Val Lys Gly Leu Gly Glu Thr Leu Val Gly Ala Tyr Pro
1 5 10 15ggc?cgt?gcc?atg?agc?ttc?gtg?tgt?aag?aaa?gat?gac?ctt?gac?tct?ccc 95Gly?Arg?Ala?Met?Ser?Phe?Val?Cys?Lys?Lys?Asp?Asp?Leu?Asp?Ser?Pro
20 25 30aag?gta?ctg?ggt?tac?cct?agc?aag?cca?att?ggt?ctc?ttc?ata?aag?cgg 143Lys?Val?Leu?Gly?Tyr?Pro?Ser?Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg
35 40 45tca?atc?atc?ttc?cgc?tca?gac?tct?aat?ggt?gag?gat?ctg?gaa?ggt?tac 191Ser?Ile?Ile?Phe?Arg?Ser?Asp?Ser?Asn?Gly?Glu?Asp?Leu?Glu?Gly?Tyr
50 55 60gct?gga?gca?ggg?ctg?tat?gat?agt?gtc?cct?atg?gat?gtg?gaa?gat?gaa 239Ala?Gly?Ala?Gly?Leu?Tyr?Asp?Ser?Val?Pro?Met?Asp?Val?Glu?Asp?Glu
65 70 75gtt?gta?ctc?gac?tac?acg?acc?gac?cct?ctc?atc?act?gac?tct?gga?ttc 287Val?Val?Leu?Asp?Tyr?Thr?Thr?Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?80 85 90 95cgg?aac?tca?atc?ctc?tca?agc?att?gca?cgg?gct?ggc?cac?gcc?atc?gag 335Arg?Asn?Ser?Ile?Leu?Ser?Ser?Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu
100 105 110gag?ctc?tat?ggg?tca?cca?cag?gat?gtt?gag?gga?gta?gtg?aag?gat?ggg 383Glu?Leu?Tyr?Gly?Ser?Pro?Gln?Asp?Val?Glu?Gly?Val?Val?Lys?Asp?Gly
115 120 125aag?atc?tac?gta?gtc?cag?aca?tac?cac?aga?tgt?aat?atg?tat?gta?tac 431Lys?Ile?Tyr?Val?Val?Gln?Thr?Tyr?His?Arg?Cys?Asn?Met?Tyr?Val?Tyr
130 135 140gcg?gct?caa?gtt?gta?gag?tagtaggata?tatggtcctt?gctggcatgt 479Ala?Ala?Gln?Val?Val?Glugcg?gct?caa?gtt?gta?gag?tagtaggata?tatggtcctt?gctggcatgt 479Ala?Ala?Gln?Val?Val?Glu
145atagttgtac tcataggtgc acaacacatc tacgttgtta tttatttgca tatacgctca 539gaataagctt tgatcacata ctgtatttcc tagagtacca gaaagtgtat gtacgatcag 599gaatatgacc ttattaaaac cattgagggg aaatgttttg acttttgagc aatctaaaaa 659aaaaaaaaaa aaa 672＜210〉2＜211〉149＜212〉PRT＜213〉common wheat＜400〉2Glu Val Val Lys Gly Leu Gly Glu Thr Leu Val Gly Ala Tyr Pro Gly 15 10 15Arg Ala Met Ser Phe Val Cys Lys Lys Asp Asp Leu Asp Ser Pro Lys
20 25 30Val?Leu?Gly?Tyr?Pro?Ser?Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg?Ser
35 40 45Ile?Ile?Phe?Arg?Ser?Asp?Ser?Asn?Gly?Glu?Asp?Leu?Glu?Gly?Tyr?Ala
50 55 60Gly?Ala?Gly?Leu?Tyr?Asp?Ssr?Val?Pro?Met?Asp?Val?Glu?Asp?Glu?Val?65 70 75 80Val?Leu?Asp?Tyr?Thr?Thr?Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?Arg
85 90 95Asn?Ser?Ile?Leu?Ser?Ser?Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu?Glu
100 105 110Leu?Tyr?Gly?Ser?Pro?Gln?Asp?Val?Glu?Gly?Val?Val?Lys?Asp?Gly?Lys
115 120 125Ile?Tyr?Val?Val?Gln?Thr?Tyr?His?Arg?Cys?Asn?Met?Tyr?Val?Tyr?Ala
130 135 140Ala Gln Val Val Glu145＜210〉3＜211〉21＜212〉DNA＜213〉＜400〉3tattggaagc tcgagttgaa c 21＜210〉4＜211〉21＜212〉DNA＜213〉＜400〉4ttgagctgtc taatagatgc a 21＜210〉5＜211〉17＜212〉DNA＜213〉＜400〉5ctgtggtctt gtctggac 18＜210〉6＜211〉24＜212〉DNA＜213〉＜400〉6aggaagcaa ggaaggaact gcag 24＜210〉7＜211〉3418＜212〉DNA＜213〉＜220〉＜221〉CDS＜222〉 （ 3 ） .. （ 3416 ）＜400〉7ga gga aga agg aag gaa ctg cag gct gag ttg gat aat gga gcc tca 47 Gly Arg Arg Lys Glu Leu Gln Ala Glu Leu Asp Asn Gly Ala Ser。
1 5 10 15gtt?gat?caa?tta?agg?aag?aaa?att?gtg?aaa?gga?aac?ctt?gaa?aag?aaa 95Val?Asp?Gln?Leu?Arg?Lys?Lys?Ile?Val?Lys?Gly?Asn?Leu?Glu?Lys?Lys
20 25 30gtt?tcc?aag?caa?ctg?gag?aag?aag?aag?tac?ttc?tca?gta?gaa?agg?att 143Val?Ser?Lys?Gln?Leu?Glu?Lys?Lys?Lys?Tyr?Phe?Ser?Val?Glu?Arg?Ile
35 40 45cag?cgc?aga?aac?aga?gat?atc?acg?caa?ctt?ctt?aat?aaa?cat?aag?cct 191Gln?Arg?Arg?Asn?Arg?Asp?Ile?Thr?Gln?Leu?Leu?Asn?Lys?His?Lys?Pro
50 55 60gtg?gtt?aca?gaa?cag?caa?gta?aaa?gct?gca?ccc?aaa?cag?cca?act?gtt 239Val?Val?Thr?Glu?Gln?Gln?Val?Lys?Ala?Ala?Pro?Lys?Gln?Pro?Thr?Val
65 70 75ttg?gat?ctc?ttc?aca?aag?tcc?ttg?caa?gag?ggg?gat?aac?tgt?gac?gtc 287Leu?Asp?Leu?phe?Thr?Lys?Ser?Leu?Gln?Glu?Gly?Asp?Asn?Cys?Asp?Val?80 85 90 95cta?agc?agg?aag?ctt?ttc?aag?atc?ggt?gat?gag?gag?ata?ctg?gca?att 335Leu?Ser?Arg?Lys?Leu?Phe?Lys?Ile?Gly?Asp?Glu?Glu?Ile?Leu?Ala?Ile
100 105 110gcc?aca?aat?gct?cta?ggt?aaa?acc?aga?gtt?cac?ttg?gca?aca?aac?cgt 383Ala?Thr?Asn?Ala?Leu?Gly?Lys?Thr?Arg?Val?His?Leu?Ala?Thr?Asn?Arg
115 120 125atg?gag?cca?ctt?att?ctt?cac?tgg?gca?ctg?gca?aaa?aat?ccc?gga?gaa 431Met?Glu?Pro?Leu?Ile?Leu?His?Trp?Ala?Leu?Ala?Lys?Asn?Pro?Gly?Glu
130 135 140tgg?gag?gca?cct?cct?tct?agc?ata?gtg?cct?tct?ggc?tca?aca?gtt?ctc 479Trp?Glu?Ala?Pro?Pro?Ser?Ser?Ile?Val?Pro?Ser?Gly?Ser?Thr?Val?Leu
145 150 155gac?aag?gca?tgt?gaa?act?tca?ttc?ggt?gag?tct?gaa?ttg?gat?ggt?ttg 527Asp?Lys?Ala?Cys?Glu?Thr?Ser?Phe?Gly?Glu?Ser?Glu?Leu?Asp?Gly?Leu160 165 170 175caa?tac?cag?gtt?gtt?gag?ata?gag?crt?gat?gac?ggc?aga?tac?aag?ggg 575Gln?Tyr?Gln?Val?Val?Glu?Ile?Glu?Leu?Asp?Asp?Gly?Arg?Tyr?Lys?Gly
180 185 190atg?ccc?ttt?gtt?ctc?cgg?cgt?ggt?gaa?aca?tgg?ata?aag?aac?aac?gac 623Met?Pro?Phe?Val?Leu?Arg?Arg?Gly?Glu?Thr?Trp?Ile?Lys?Asn?Asn?Asp
195 200 205tct?gac?ttc?tat?ttg?gat?ttc?aac?acc?aaa?gtt?acc?aag?aaa?tca?aag 671Ser?Asp?Phe?Tyr?Leu?Asp?Phe?Asn?Thr?Lys?Val?Thr?Lys?Lys?Ser?Lys
210 215 220gat?acg?ggt?gat?gcc?ggt?aaa?ggc?acc?gca?aag?gat?ttc?ctg?gaa?aga 719Asp?Thr?Gly?Asp?Ala?Gly?Lys?Gly?Thr?Ala?Lys?Asp?Phe?Leu?Glu?Arg
225 230 235ata?gca?gat?ctg?gag?gaa?gat?gcc?cag?cga?tct?ttt?atg?cac?aga?ttt 767Ile?Ala?Asp?Leu?Glu?Glu?Asp?Ala?Gln?Arg?Ser?Phe?Met?His?Arg?Phe240 245 250 255aat?att?gcg?gcg?gat?cta?gtt?gac?caa?gcc?aga?gat?gct?gga?cta?ttg 815Asn?Ile?Ala?Ala?Asp?Leu?Val?Asp?Gln?Ala?Arg?Asp?Ala?Gly?Leu?Leu
260 265 270ggt?atc?gtt?gga?ctt?ttt?gtt?tgg?att?aga?ttc?atg?tct?acc?agg?caa 863Gly?Ile?Val?Gly?Leu?Phe?Val?Trp?Ile?Arg?Phe?Met?Ser?Thr?Arg?Gln
275 280 285cta?ata?tgg?aac?aag?aac?tac?aat?gtg?aaa?cca?cgt?gag?ata?agc?caa 911Leu?Ile?Trp?Asn?Lys?Asn?Tyr?Asn?Val?Lys?Pro?Arg?Glu?Ile?Ser?Gln
290 295 300gca?caa?gac?agg?ttt?aca?gat?gac?ctt?gag?aat?atg?tac?aaa?agt?tac 959Ala?Gln?Asp?Arg?Phe?Thr?Asp?Asp?Leu?Glu?Asn?Met?Tyr?Lys?Ser?Tyr
305 310 315cca?cag?tac?aga?gag?atc?tta?aga?atg?tta?ttg?tct?gct?gtt?ggt?cgt 1007Pro?Gln?Tyr?Arg?Glu?Ile?Leu?Arg?Met?Leu?Leu?Ser?Ala?Val?Gly?Arg320 325 330 335gga?ggt?gaa?ggt?gat?gtt?ggt?cag?cgt?atc?cgt?gat?gag?ata?tta?gta 1055Gly?Gly?Glu?Gly?Asp?Val?Gly?Gln?Arg?Ile?Arg?Asp?Glu?Ile?Leu?Val
340 345 350atc?cag?aga?aat?aat?gac?tgc?aaa?ggt?gga?att?atg?gaa?gaa?tgg?cac 1103Ile?Gln?Arg?Asn?Asn?Asp?Cys?Lys?Gly?Gly?Ile?Met?Glu?Glu?Trp?His
355 360 365cag?aaa?ctg?cac?aac?aat?aca?agc?cca?gat?gat?gta?gtc?ata?tgc?cag 1151Gln?Lys?Leu?His?Asn?Asn?Thr?Ser?Pro?Asp?Asp?Val?Val?Ile?Cys?Gln
370 375 380gcg?ata?att?gat?tat?atc?aag?agc?gat?ttc?gat?atc?aac?gtt?tac?tgg 1199Ala?Ile?Ile?Asp?Tyr?Ile?Lys?Ser?Asp?Phe?Asp?Ile?Asn?Val?Tyr?Trp
385 390 395gac?acc?ttg?aac?aaa?aat?ggc?ata?acc?aaa?gaa?cga?ctg?ttg?agc?tat 1247Asp?Thr?Leu?Asn?Lys?Asn?Gly?Ile?Thr?Lys?Glu?Arg?Leu?Leu?Ser?Tyr400 405 410 415gat?cgt?gca?att?cat?tca?gaa?cca?aaa?ttc?agg?agt?gac?cag?aaa?gag 1295Asp?Arg?Ala?Ile?His?Ser?Glu?Pro?Lys?Phe?Arg?Ser?Asp?Gln?Lys?Glu
420 425 430ggg?tta?ctc?cgt?gat?ttg?ggc?aac?tat?atg?aga?agc?ctg?aag?gct?gtg 1343Gly?Leu?Leu?Arg?Asp?Leu?Gly?Asn?Tyr?Met?Arg?Ser?Leu?Lys?Ala?Val
435 440 445cac?tct?ggt?gct?gat?ctt?gag?tct?gct?att?gcg?aca?tgt?atg?gga?tac 1391His?Ser?Gly?Ala?Asp?Leu?Glu?Ser?Ala?Ile?Ala?Thr?Cys?Met?Gly?Tyr
450 455 460aaa?tca?gag?ggt?gaa?ggt?ttc?atg?gtt?ggt?gtt?caa?atc?aac?ccg?gtg 1439Lys?Ser?Glu?Gly?Glu?Gly?Phe?Met?Val?Gly?Val?Gln?Ile?Asn?Pro?Val
465 470 475aat?ggt?tta?tca?tct?ggt?ttt?cct?gat?ttg?ctt?caa?ttt?gtg?ctt?gac 1487Asn?Gly?Leu?Ser?Ser?Gly?Phe?Pro?Asp?Leu?Leu?Gln?Phe?Val?Leu?Asp480 485 490 495cat?gtt?gag?gat?aaa?tca?gca?gag?cca?ctt?ctt?gag?ggg?tta?ttg?gag 1535His?Val?Glu?Asp?Lys?Ser?Ala?Glu?Pro?Leu?Leu?Glu?Gly?Leu?Leu?Glu
500 505 510gct?cgt?gtt?gaa?cta?cgc?cct?ttg?ctc?act?ggc?tca?tct?gaa?cgc?ttg 1583Ala?Arg?Val?Glu?Leu?Arg?Pro?Leu?Leu?Thr?Gly?Ser?Ser?Glu?Arg?Leu
515 520 525aag?gat?ctt?atc?ttt?ttg?gac?att?gct?ctt?gat?tct?act?ttc?agg?aca 1631Lys?Asp?Leu?Ile?Phe?Leu?Asp?Ile?Ala?Leu?Asp?Ser?Thr?Phe?Arg?Thr
530 535 540gca?gtt?gaa?agg?tcg?tat?gag?gag?ctg?aat?gat?gca?gca?ccg?gag?aaa 1679Ala?Val?Glu?Arg?Ser?Tyr?Glu?Glu?Leu?Asn?Asp?Ala?Ala?Pro?Glu?Lys
545 550 555att?atg?tac?ttc?atc?agt?ctt?gtt?ctt?gaa?aat?ctt?gcc?ttg?tcc?act 1727Ile?Met?Tyr?Phe?Ile?Ser?Leu?Val?Leu?Glu?Asn?Leu?Ala?Leu?Ser?Thr560 565 570 575gac?gac?aac?gaa?gac?atc?tta?tat?tgc?tta?aag?gga?tgg?aat?cga?gcc 1775Asp?Asp?Asn?Glu?Asp?Ile?Leu?Tyr?Cys?Leu?Lys?Gly?Trp?Asn?Arg?Ala
580 585 590atg?gac?atg?gtt?aag?caa?aag?gat?gac?caa?tgg?gct?ctc?tac?gct?aaa 1823Met?Asp?Met?Val?Lys?Gln?Lys?Asp?Asp?Gln?Trp?Ala?Leu?Tyr?Ala?Lys
595 600 605gca?ttt?ctt?gac?aga?acc?aga?ctt?gcc?ctt?gcg?agc?aag?ggc?gaa?caa 1871Ala?Phe?Leu?Asp?Arg?Thr?Arg?Leu?Ala?Leu?Ala?Ser?Lys?Gly?Glu?Gln
610 615 620tac?tac?aat?atg?atg?cag?ccc?tcg?gct?gaa?tat?ctt?ggc?tca?tta?ctc 1919Tyr?Tyr?Asn?Met?Met?Gln?Pro?Ser?Ala?Glu?Tyr?Leu?Gly?Ser?Leu?Leu
625 630 635aac?gtt?gag?gaa?tgg?gct?gtt?gac?atc?ttc?aca?gaa?gaa?gta?att?cgt 1967Asn?Val?Glu?Glu?Trp?Ala?Val?Asp?Ile?Phe?Thr?Glu?Glu?Val?Ile?Arg640 645 650 655ggt?gga?tca?gct?gcc?act?tta?tct?gct?ctt?ctg?aac?cga?ttt?gac?cct 2015Gly?Gly?Ser?Ala?Ala?Thr?Leu?Ser?Ala?Leu?Leu?Asn?Arg?Phe?Asp?Pro
660 665 670gtt?ctc?aga?aat?gtc?gca?cac?ctt?gga?agt?tgg?cag?gtt?att?agc?cca 2063Val?Leu?Arg?Asn?Val?Ala?His?Leu?Gly?Ser?Trp?Gln?Val?Ile?Ser?Pro
675 680 685gtt?gaa?gta?aca?ggt?tat?att?gta?gtg?gtt?gat?aag?ttg?ctt?tct?gtt 2111Val?Glu?Val?Thr?Gly?Tyr?Ile?Val?Val?Val?Asp?Lys?Leu?Leu?Ser?Val
690 695 700caa?aac?aaa?act?tat?gat?aaa?cca?aca?atc?ctt?gtg?gca?aag?agt?gtc 2159Gln?Asn?Lys?Thr?Tyr?Asp?Lys?Pro?Thr?Ile?Leu?Val?Ala?Lys?Ser?Val
705 710 715aag?gga?gag?gaa?gaa?ata?cca?gat?ggt?gtt?gtt?ggc?gtg?ata?aca?cct 2207Lys?Gly?Glu?Glu?Glu?Ile?Pro?Asp?Gly?Val?Val?Gly?Val?Ile?Thr?Pro720 725 730 735gat?atg?cca?gat?gtt?ctg?tct?cat?gtg?tca?gtt?cga?gca?agg?aat?tgc 2255Asp?Met?Pro?Asp?Val?Leu?Ser?His?Val?Ser?Val?Arg?Ala?Arg?Asn?Cys
740 745 750aag?gtg?ttg?ttt?gcg?aca?tgc?ttt?gac?ccg?aat?acc?ctg?tct?gaa?ttt 2303Lys?Val?Leu?Phe?Ala?Thr?Cys?Phe?Asp?Pro?Asn?Thr?Leu?Ser?Glu?Phe
755 760 765caa?gga?cat?gaa?ggg?aag?gtg?ttt?tcc?ttc?aaa?act?act?tct?gca?gat 2351Gln?Gly?His?Glu?Gly?Lys?Val?Phe?Ser?Phe?Lys?Thr?Thr?Ser?Ala?Asp
770 775 780gtc?acc?tac?agg?gag?gta?tcg?gac?agt?gaa?ctt?atg?cag?tca?agt?tct 2399Val?Thr?Tyr?Arg?Glu?Val?Ser?Asp?Ser?Glu?Leu?Met?Gln?Ser?Ser?Ser
785 790 795tca?gat?gca?caa?ggt?ggt?gaa?gca?ata?cca?tct?tta?tca?tta?gtc?aag 2447Ser?Asp?Ala?Gln?Gly?Gly?Glu?Ala?Ile?Pro?Ser?Leu?Ser?Leu?Val?Lys800 805 810 815aaa?aag?ttc?ctt?gga?aaa?tat?gca?ata?tca?gcg?gaa?gag?ttc?tct?gat 2495Lys?Lys?Phe?Leu?Gly?Lys?Tyr?Ala?Ile?Ser?Ala?Glu?Glu?Phe?Ser?Asp
820 825 830gaa?atg?gtt?gga?gca?aag?tcc?cgc?aac?ata?gca?tac?ctg?aaa?gga?aaa 2543Glu?Met?Val?Gly?Ala?Lys?Ser?Arg?Asn?Ile?Ala?Tyr?Leu?Lys?Gly?Lys
835 840 845gta?cct?tca?tgg?gtt?ggt?atc?cca?aca?tca?gtt?gcg?ata?cca?ttt?ggg 2591Val?Pro?Ser?Trp?Val?Gly?Ile?Pro?Thr?Ser?Val?Ala?Ile?Pro?Phe?Gly
850 855 860acc?ttt?gag?aag?ata?ttg?tct?gat?gag?acc?aat?aag?gaa?gta?gca?caa 2639Thr?Phe?Glu?Lys?Ile?Leu?Ser?Asp?Glu?Thr?Asn?Lys?Glu?Val?Ala?Gln
865 870 875aac?ata?cag?atg?ctg?aag?ggc?aga?ctt?gct?caa?gaa?gat?ttt?agt?gct 2687Asn?Ile?Gln?Met?Leu?Lys?Gly?Arg?Leu?Ala?Gln?Glu?Asp?Phe?Ser?Ala880 885 890 895cta?gga?gaa?atc?cgg?aaa?act?gtt?ctt?aat?cta?act?gct?cca?act?caa 2735Leu?Gly?Glu?Ile?Arg?Lys?Thr?Val?Leu?Asn?Leu?Thr?Ala?Pro?Thr?Gln
900 905 910ccg?gtt?aag?gag?ctg?aag?gag?aag?atg?cta?agc?tcc?gga?atg?ccc?tgg 2783Pro?Val?Lys?Glu?Leu?Lys?Glu?Lys?Met?Leu?Ser?Ser?Gly?Met?Pro?Trp
915 920 925cct?gga?gat?gaa?agt?gac?cac?cgt?tgg?gag?caa?gca?tgg?atg?gca?att 2831Pro?Gly?Asp?Glu?Ser?Asp?His?Arg?Trp?Glu?Gln?Ala?Trp?Met?Ala?Ile
930 935 940aaa?aag?gtt?tgg?gca?tca?aaa?tgg?aat?gaa?aga?gca?tac?ttt?agt?aca 2879Lys?Lys?Val?Trp?Ala?Ser?Lys?Trp?Asn?Glu?Arg?Ala?Tyr?Phe?Ser?Thr
945 950 955cgc?aag?gtg?aag?ctc?gat?cat?gag?tac?ctt?tcc?atg?gct?gtt?ctt?gta 2927Arg?Lys?Val?Lys?Leu?Asp?His?Glu?Tyr?Leu?Ser?Met?Ala?Val?Leu?Val960 965 970 975caa?gaa?att?gtc?aac?gca?gac?tat?gcc?ttt?gtc?att?cat?act?acg?aac 2975Gln?Glu?Ile?Val?Asn?Ala?Asp?Tyr?Ala?Phe?Val?Ile?His?Thr?Thr?Asn
980 985 990ccg?tca?tct?gga?gat?tct?tct?gag?ata?tat?gct?gaa?gtg?gtg?aaa?gga 3023Pro?Ser?Ser?Gly?Asp?Ser?Ser?Glu?Ile?Tyr?Ala?Glu?Val?Val?Lys?Gly
995 1000 1005ctt?gga?gag?aca?ctt?gtg?gga?gct?tat?cct?ggc?cgt?gcc?atg?agc?ttc 3071Leu?Gly?Glu?Thr?Leu?Val?Gly?Ala?Tyr?Pro?Gly?Arg?Ala?Met?Ser?Phe
1010 1015 1020gtg?tgt?aag?aaa?gat?gac?ctt?gac?tct?ccc?aag?gta?ctg?ggt?tac?cct 3119Val?Cys?Lys?Lys?Asp?Asp?Leu?Asp?Ser?Pro?Lys?Val?Leu?Gly?Tyr?Pro
1025 1030 1035agc?aag?cca?att?ggt?ctc?ttc?ata?aag?cgg?tca?atc?atc?ttc?cgc?tca 3167Ser?Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg?Ser?Ile?Ile?Phe?Arg?Ser1040 1045 1050 1055gac?tct?aat?ggt?gag?gat?ctg?gaa?ggt?tac?gct?gga?gca?ggg?ctg?tat 3215Asp?Ser?Asn?Gly?Glu?Asp?Leu?Glu?Gly?Tyr?Ala?Gly?Ala?Gly?Leu?Tyr
1060 1065 1070gat?agt?gtc?cct?atg?gat?gtg?gaa?gat?gaa?gtt?gta?ctc?gac?tac?acg 3263Asp?Ser?Val?Pro?Met?Asp?Val?Glu?Asp?Glu?Val?Val?Leu?Asp?Tyr?Thr
1075 1080 1085acc?gac?cct?ctc?atc?act?gac?tct?gga?ttc?cgg?aac?tca?atc?ctc?tca 3311Thr?Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?Arg?Asn?Ser?Ile?Leu?Ser
1090 1095 1100agc?att?gca?cgg?gct?ggc?cac?gcc?atc?gag?gag?ctc?tat?ggg?tca?cca 3359Ser?Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu?Glu?Leu?Tyr?Gly?Ser?Pro
1105 11l0 1115cag gat gtt gag gga gta gtg aag gat ggg aag atc tac gta gtc cag 3407Gln Asp Val Glu Gly Val Val Lys Asp Gly Lys Ile Tyr Val Val Gln1120,1,125 1130 1135aca tac cac ag 3418Thr Tyr His＜210〉8＜211〉1138＜212〉PRT＜213〉common wheat＜400〉8Gly Arg Arg Lys Glu Leu Gln Ala Glu Leu Asp Asn Gly Ala Ser Val, 15 10 15Asp Gln Leu Arg Lys Lys Ile Val Lys Gly Asn Leu Glu Lys Lys Val
20 25 30Ser?Lys?Gln?Leu?Glu?Lys?Lys?Lys?Tyr?Phe?Ser?Val?Glu?Arg?Ile?Gln
35 40 45Arg?Arg?Asn?Arg?Asp?Ile?Thr?Gln?Leu?Leu?Asn?Lys?His?Lys?Pro?Val
50 55 60Val?Thr?Glu?Gln?Gln?Val?Lys?Ala?Ala?Pro?Lys?Gln?pro?Thr?Val?Leu?65 70 75 80Asp?Leu?Phe?Thr?Lys?Ser?Leu?Gln?Glu?Gly?Asp?Asn?Cys?Asp?Val?Leu
85 90 95Ser?Arg?Lys?Leu?Phe?Lys?Ile?Gly?Asp?Glu?Glu?Ile?Leu?Ala?Ile?Ala
100 105 110Thr?Asn?Ala?Leu?Gly?Lys?Thr?Arg?Val?His?Leu?Ala?Thr?Asn?Arg?Met
115 120 125Glu?Pro?Leu?Ile?Leu?His?Trp?Ala?Leu?Ala?Lys?Asn?Pro?Gly?Glu?Trp
130 135 140Glu?Ala?Pro?Pro?Ser?Ser?Ile?Val?Pro?Ser?GlV?Ser?Thr?Val?Leu?Asp145 150 155 160Lys?Ala?Cys?Glu?Thr?Ser?Phe?Gly?Glu?Ser?Glu?Leu?Asp?Gly?Leu?Gln
165 170 175Tyr?Gln?Val?Val?Glu?Ile?Glu?Leu?Asp?Asp?Gly?Arg?Tyr?Lys?Gly?Met
180 185 190Pro?Phe?Val?Leu?Arg?Arg?Gly?Glu?Thr?Trp?Ile?Lys?Asn?Asn?Asp?Ser
195 200 205Asp?Phe?Tyr?Leu?Asp?Phe?Asn?Thr?Lys?Val?Thr?Lys?Lys?Ser?Lys?Asp
210 215 220 Thr?Gly?Asp?Ala?Gly?Lys?Gly?Thr?Ala?Lys?Asp?Phe?Leu?Glu?Arg?Ile225 230 235 240Ala?Asp?Leu?Glu?Glu?Asp?Ala?Gln?Arg?Ser?Phe?Met?His?Arg?Phe?Asn
245 250 255Ile?Ala?Ala?Asp?Leu?Val?Asp?Gln?Ala?Arg?Asp?Ala?Gly?Leu?Leu?Gly
260 265 270Ile?Val?Gly?Leu?Phe?Val?Trp?Ile?Arg?Phe?Met?Ser?Thr?Arg?Gln?Leu
275 280 285Ile?Trp?Asn?Lys?Asn?Tyr?Asn?Val?Lys?Pro?Arg?Glu?Ile?Ser?Gln?Ala
290 295 300Gln?Asp?Arg?Phe?Thr?Asp?Asp?Leu?Glu?Asn?Met?Tyr?Lys?Ser?Tyr?Pro305 310 315 320Gln?Tyr?Arg?Glu?Ile?Leu?Arg?Met?Leu?Leu?Ser?Ala?Val?Gly?Arg?Gly
325 330 335Gly?Glu?Gly?Asp?Val?Gly?Gln?Arg?Ile?Arg?Asp?Glu?Ile?Leu?Val?Ile
340 345 350Gln?Arg?Asn?Asn?Asp?Cys?Lys?Gly?Gly?Ile?Met?Glu?Glu?Trp?His?Gln
355 360 365Lys?Leu?His?Asn?Asn?Thr?Ser?Pro?Asp?Asp?Val?Val?Ile?Cys?Gln?Ala
370 375 380Ile?Ile?Asp?Tyr?Ile?Lys?Ser?Asp?Phe?Asp?Ile?Asn?Val?Tyr?Trp?Asp385 390 395 400Thr?Leu?Asn?Lys?Asn?Gly?Ile?Thr?Lys?Glu?Arg?Leu?Leu?Ser?Tyr?Asp
405 410 415Arg?Ala?Ile?His?Ser?Glu?Pro?Lys?Phe?Arg?Ser?Asp?Gln?Lys?Glu?Gly
420 425 430Leu?Leu?Arg?Asp?Leu?Gly?Asn?Tyr?Met?Arg?Ser?Leu?Lys?Ala?Val?His
435 440 445Ser?Gly?Ala?Asp?Leu?Glu?Ser?Ala?Ile?Ala?Thr?Cys?Met?Gly?Tyr?Lys
450 455 460Ser?Glu?Gly?Glu?Gly?Phe?Met?Val?Gly?Val?Gln?Ile?Asn?Pro?Val?Asn465 470 475 480Gly?Leu?Ser?Ser?Gly?Phe?Pro?Asp?Leu?Leu?Gln?Phe?Val?Leu?Asp?His
485 490 495Val?Glu?Asp?Lys?Ser?Ala?Glu?Pro?Leu?Leu?Glu?Gly?Leu?Leu?Glu?Ala
500 505 510Arg?Val?Glu?Leu?Arg?Pro?Leu?Leu?Thr?Gly?Ser?Ser?Glu?Arg?Leu?Lys
515 520 525Asp?Leu?Ile?Phe?Leu?Asp?Ile?Ala?Leu?Asp?Ser?Thr?Phe?Arg?Thr?Ala
530 535 540Val?Glu?Arg?Ser?Tyr?Glu?Glu?Leu?Asn?Asp?Ala?Ala?Pro?Glu?Lys?Ile545 550 555 560Met?Tyr?Phe?Ile?Ser?Leu?Val?Leu?Glu?Asn?Leu?Ala?Leu?Ser?Thr?Asp
565 570 575Asp?Asn?Glu?Asp?Ile?Leu?Tyr?Cys?Leu?Lys?Gly?Trp?Asn?Arg?Ala?Met
580 585 590Asp?Met?Val?Lys?Gln?Lys?Asp?Asp?Gln?Trp?Ala?Leu?Tyr?Ala?Lys?Ala
595 600 605Phe?Leu?Asp?Arg?Thr?Arg?Leu?Ala?Leu?Ala?Ser?Lys?Gly?Glu?Gln?Tyr
610 615 620Tyr?Asn?Met?Met?Gln?Pro?Ser?Ala?Glu?Tyr?Leu?Gly?Ser?Leu?Leu?Asn625 630 635 640Val?Glu?Glu?Trp?Ala?Val?Asp?Ile?Phe?Thr?Glu?Glu?Val?Ile?Arg?Gly
645 650 655Gly?Ser?Ala?Ala?Thr?Leu?Ser?Ala?Leu?Leu?Asn?Arg?Phe?Asp?Pro?Val
660 665 670Leu?Arg?Asn?Val?Ala?His?Leu?Gly?Ser?Trp?Gln?Val?Ile?Ser?Pro?Val
675 680 685Glu?Val?Thr?Gly?Tyr?Ile?Val?Val?Val?Asp?Lys?Leu?Leu?Ser?Val?Gln
690 695 700Asn?Lys?Thr?Tyr?Asp?Lys?Pro?Thr?Ile?Leu?Val?Ala?Lys?Ser?Val?Lys705 710 715 720Gly?Glu?Glu?Glu?Ile?Pro?Asp?Gly?Val?Val?Gly?Val?Ile?Thr?Pro?Asp
725 730 735Met?Pro?Asp?Val?Leu?Ser?His?Val?Ser?Val?Arg?Ala?Arg?Asn?Cys?Lys
740 745 750Val?Leu?Phe?Ala?Thr?Cys?Phe?Asp?Pro?Asn?Thr?Leu?Ser?Glu?Phe?Gln
755 760 765Gly?His?Glu?Gly?Lys?Val?Phe?Ser?Phe?Lys?Thr?Thr?Ser?Ala?Asp?Val
770 775 780Thr?Tyr?Arg?Glu?Val?Ser?Asp?Ser?Glu?Leu?Met?Gln?Ser?Ser?Ser?Ser785 790 795 800Asp?Ala?Gln?Gly?Gly?Glu?Ala?Ile?Pro?Ser?Leu?Ser?Leu?Val?Lys?Lys
805 810 815Lys?Phe?Leu?Gly?Lys?Tyr?Ala?Ile?Ser?Ala?Glu?Glu?Phe?Ser?Asp?Glu
820 825 830Met?Val?Gly?Ala?Lys?Ser?Arg?Asn?Ile?Ala?Tyr?Leu?Lys?Gly?Lys?Val
835 840 845Pro?Ser?Trp?Val?Gly?Ile?Pro?Thr?Ser?Val?Ala?Ile?Pro?Phe?Gly?Thr
850 855 860Phe?Glu?Lys?Ile?Leu?Ser?Asp?Glu?Thr?Asn?Lys?Glu?Val?Ala?Gln?Asn865 870 875 880Ile?Gln?Met?Leu?Lys?Gly?Arg?Leu?Ala?Gln?Glu?Asp?Phe?Ser?Ala?Leu
885 890 895Gly?Glu?Ile?Arg?Lys?Thr?Val?Leu?Asn?Leu?Thr?Ala?Pro?Thr?Gln?Pro
900 905 910Val?Lys?Glu?Leu?Lys?Glu?Lys?Met?Leu?Ser?Ser?Gly?Met?Pro?Trp?Pro
915 920 925Gly?Asp?Glu?Ser?Asp?His?Arg?Trp?Glu?Gln?Ala?Trp?Met?Ala?Ile?Lys
930 935 940Lys?Val?Trp?Ala?Ser?Lys?Trp?Asn?Glu?Arg?Ala?Tyr?Phe?Ser?Thr?Arg945 950 955 960Lys?Val?Lys?Leu?Asp?His?Glu?Tyr?Leu?Ser?Met?Ala?Val?Leu?Val?Gln
965 970 975Glu?Ile?Val?Asn?Ala?Asp?Tyr?Ala?Phe?Val?Ile?His?Thr?Thr?Asn?Pro
980 985 990Ser?Ser?Gly?Asp?Ser?Ser?Glu?Ile?Tyr?Ala?Glu?Val?Val?Lys?Gly?Leu
995 1000 1005Gly?Glu?Thr?Leu?Val?Gly?Ala?Tyr?Pro?Gly?Arg?Ala?Met?Ser?Phe?Val 1010 1015 1020Cys?Lys?Lys?Asp?Asp?Leu?Asp?Ser?Pro?Lys?Val?Leu?Gly?Tyr?Pro?Ser1025 1030 1035 1040Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg?Ser?Ile?Ile?Phe?Arg?Ser?Asp
1045 1050 1055Ser?Asn?Gly?Glu?Asp?Leu?Glu?Gly?Tyr?Ala?Gly?Ala?Gly?Leu?Tyr?Asp
1060 1065 1070Ser?Val?Pro?Met?Asp?Val?Glu?Asp?Glu?Val?Val?Leu?Asp?Tyr?Thr?Thr
1075 1080 1085Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?Arg?Asn?Ser?Ile?Leu?Ser?Ser 1090 1095 1100Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu?Glu?Leu?Tyr?Gly?Ser?Pro?Gln1105 1110 1115 1120Asp?Val?Glu?Gly?Val?Val?Lys?Asp?Gly?Lys?Ile?Tyr?Val?Val?Gln?Thr
1,125 1130 1135Tyr His＜210〉9＜211〉3678＜212〉DNA＜213〉common wheat＜220〉＜221〉CDS＜222〉(3) .. (3458)＜400〉9ga gga aga agg aag gaa ctg cag gct gag ttg gat aat gga gcc tca 47 Gly Arg Arg Lys Glu Leu Gln Ala Glu Leu Asp Asn Gly Ala Ser
1 5 10 15gtt?gat?caa?tta?agg?aag?aaa?att?gtg?aaa?gga?aac?ctt?gaa?aag?aaa 95Val?Asp?Gln?Leu?Arg?Lys?Lys?Ile?Val?Lys?Gly?Asn?Leu?Glu?Lys?Lys
20 25 30gtt?tcc?aag?caa?ctg?gag?aag?aag?aag?tac?ttc?tca?gta?gaa?agg?att 143Val?Ser?Lys?Gln?Leu?Glu?Lys?Lys?Lys?Tyr?Phe?Ser?Val?Glu?Arg?Ile
35 40 45cag?cgc?aga?aac?aga?gat?atc?acg?caa?ctt?ctt?aat?aaa?cat?aag?cct 191Gln?Arg?Arg?Asn?Arg?Asp?Ile?Thr?Gln?Leu?Leu?Asn?Lys?His?Lys?Pro
50 55 60gtg?gtt?aca?gaa?cag?caa?gta?aaa?gct?gca?ccc?aaa?cag?cca?act?gtt 239Val?Val?Thr?Glu?Gln?Gln?Val?Lys?Ala?Ala?Pro?Lys?Gln?Pro?Thr?Val
65 70 75ttg?gat?ctc?ttc?aca?aag?tcc?ttg?caa?gag?ggg?gat?aac?tgt?gac?gtc 287Leu?Asp?Leu?Phe?Thr?Lys?Ser?Leu?Gln?Glu?Gly?Asp?Asn?Cys?Asp?Val?80 85 90 95cta?agc?agg?aag?ctt?ttc?aag?atc?ggt?gat?gag?gag?ata?ctg?gca?att 335Leu?Ser?Arg?Lys?Leu?Phe?Lys?Ile?Gly?Asp?Glu?Glu?Ile?Leu?Ala?Ile
100 105 110gcc?aca?aat?gct?cta?ggt?aaa?acc?aga?gtt?cac?ttg?gca?aca?aac?cgt 383Ala?Thr?Asn?Ala?Leu?Gly?Lys?Thr?Arg?Val?His?Leu?Ala?Thr?Asn?Arg
115 120 125atg?gag?cca?ctt?att?ctt?cac?tgg?gca?ctg?gca?aaa?aat?ccc?gga?gaa 431Met?Glu?Pro?Leu?Ile?Leu?His?Trp?Ala?Leu?Ala?Lys?Asn?Pro?Gly?Glu
130 135 140tgg?gag?gca?cct?cct?tct?agc?ata?gtg?cct?tct?ggc?tca?aca?gtt?ctc 479Trp?Glu?Ala?Pro?Pro?Ser?Ser?Ile?Val?Pro?Ser?Gly?Ser?Thr?Val?Leu
145 150 155gac?aag?gca?tgt?gaa?act?tca?ttc?ggt?gag?tct?gaa?ttg?gat?ggt?ttg 527Asp?Lys?Ala?Cys?Glu?Thr?Ser?Phe?Gly?Glu?Ser?Glu?Leu?Asp?Gly?Leu160 165 170 175caa?tac?cag?gtt?gtt?gag?ata?gag?ctt?gat?gac?ggc?aga?tac?aag?ggg 575Gln?Tyr?Gln?Val?Val?Glu?Ile?Glu?Leu?Asp?Asp?Gly?Arg?Tyr?Lys?Gly
180 185 190atg?ccc?ttt?gtt?ctc?cgg?cgt?ggt?gaa?aca?tgg?ata?aag?aac?aac?gac 623Met?Pro?Phe?Val?Leu?Arg?Arg?Gly?Glu?Thr?Trp?Ile?Lys?Asn?Asn?Asp
195 200 205tct?gac?ttc?tat?ttg?gat?ttc?aac?acc?aaa?gtt?acc?aag?aaa?tca?aag 671Ser?Asp?Phe?Tyr?Leu?Asp?Phe?Asn?Thr?Lys?Val?Thr?Lys?Lys?Ser?Lys
210 215 220gat?acg?ggt?gat?gcc?ggt?aaa?ggc?acc?gca?aag?gat?ttc?ctg?gaa?aga 719Asp?Thr?Gly?Asp?Ala?Gly?Lys?Gly?Thr?Ala?Lys?Asp?Phe?Leu?Glu?Arg
225 230 235ata?gca?gat?ctg?gag?gaa?gat?gcc?cag?cga?tct?ttt?atg?cac?aga?ttt 767Ile?Ala?Asp?Leu?Glu?Glu?Asp?Ala?Gln?Arg?Ser?Phe?Met?His?Arg?Phe240 245 250 255aat?att?gcg?gcg?gat?cta?gtt?gac?caa?gcc?aga?gat?gct?gga?cta?ttg 815Asn?Ile?Ala?Ala?Asp?Leu?Val?Asp?Gln?Ala?Arg?Asp?Ala?Gly?Leu?Leu
260 265 270ggt?atc?gtt?gga?ctt?ttt?gtt?tgg?att?aga?ttc?atg?tct?acc?agg?caa 863Gly?Ile?Val?Gly?Leu?Phe?Val?Trp?Ile?Arg?Phe?Met?Ser?Thr?Arg?Gln
275 280 285cta?ata?tgg?aac?aag?aac?tac?aat?gtg?aaa?cca?cgt?gag?ata?agc?caa 911Leu?Ile?Trp?Asn?Lys?Asn?Tyr?Asn?Val?Lys?Pro?Arg?Glu?Ile?Ser?Gln
290 295 300gca?caa?gac?agg?ttt?aca?gat?gac?ctt?gag?aat?atg?tac?aaa?agt?tac 959Ala?Gln?Asp?Arg?Phe?Thr?Asp?Asp?Leu?Glu?Asn?Met?Tyr?Lys?Ser?Tyr
305 310 315cca?cag?tac?aga?gag?atc?tta?aga?atg?tta?ttg?tct?gct?gtt?ggt?cgt 1007Pro?Gln?Tyr?Arg?Glu?Ile?Leu?Arg?Met?Leu?Leu?SerAla?Val?Gly?Arg320 325 330 335gga?ggt?gaa?ggt?gat?gtt?ggt?cag?cgt?atc?cgt?gat?gag?ata?tta?gta 1055Gly?Gly?Glu?Gly?Asp?Val?Gly?Gln?Arg?Ile?Arg?Asp?Glu?Ile?Leu?Val
340 345 350atc?cag?aga?aat?aat?gac?tgc?aaa?ggt?gga?att?atg?gaa?gaa?tgg?cac 1103Ile?Gln?Arg?Asn?Asn?Asp?Cys?Lys?Gly?Gly?Ile?Met?Glu?Glu?Trp?His
355 360 365cag?aaa?ctg?cac?aac?aat?aca?agc?cca?gat?gat?gta?gtc?ata?tgc?cag 1151Gln?Lys?Leu?His?Asn?Asn?Thr?Ser?Pro?Asp?Asp?Val?Val?Ile?Cys?Gln
370 375 380gcg?ata?att?gat?tat?atc?aag?agc?gat?ttc?gat?atc?aac?gtt?tac?tgg 1199Ala?Ile?Ile?Asp?Tyr?Ile?Lys?Ser?Asp?Phe?Asp?Ile?Asn?Val?Tyr?Trp
385 390 395gac?acc?ttg?aac?aaa?aat?ggc?ata?acc?aaa?gaa?cga?ctg?ttg?agc?tat 1247Asp?Thr?Leu?Asn?Lys?Asn?Gly?Ile?Thr?Lys?Glu?Arg?Leu?Leu?Ser?Tyr400 405 410 415gat?cgt?gca?att?cat?tca?gaa?cca?aaa?ttc?agg?agt?gac?cag?aaa?gag 1295Asp?Arg?Ala?Ile?His?Ser?Glu?Pro?Lys?Phe?Arg?Ser?Asp?Gln?Lys?Glu
420 425 430ggg?tta?ctc?cgt?gat?ttg?ggc?aac?tat?atg?aga?agc?ctg?aag?gct?gtg 1343Gly?Leu?Leu?Arg?Asp?Leu?Gly?Ash?Tyr?Met?Arg?Ser?Leu?Lys?Ala?Val
435 440 445cac?tct?ggt?gct?gat?ctt?gag?tct?gct?att?gcg?aca?tgt?atg?gga?tac 1391His?Ser?Gly?Ala?Asp?Leu?Glu?Ser?Ala?Ile?Ala?Thr?Cys?Met?Gly?Tyr
450 455 460aaa?tca?gag?ggt?gaa?ggt?ttc?atg?gtt?ggt?gtt?caa?atc?aac?ccg?gtg 1439Lys?Ser?Glu?Gly?Glu?Gly?Phe?Met?Val?Gly?Val?Gln?Ile?Asn?Pro?Val
465 470 475aat?ggt?tta?tca?tct?ggt?ttt?cct?gat?ttg?ctt?caa?ttt?gtg?ctt?gac 1487Asn?Gly?Leu?Ser?Ser?Gly?Phe?Pro?Asp?Leu?Leu?Gln?Phe?Val?Leu?Asp480 485 490 495cat?gtt?gag?gat?aaa?tca?gca?gag?cca?ctt?ctt?gag?ggg?tta?ttg?gag 1535His?Val?Glu?Asp?Lys?Ser?Ala?Glu?Pro?Leu?Leu?Glu?Gly?Leu?Leu?Glu
500 505 510gct?cgt?gtt?gaa?cta?cgc?cct?ttg?ctc?act?ggc?tca?tct?gaa?cgc?ttg 1583Ala?Arg?Val?Glu?Leu?Arg?Pro?Leu?Leu?Thr?Gly?Ser?Ser?Glu?Arg?Leu
515 520 525aag?gat?ctt?atc?ttt?ttg?gac?att?gct?ctt?gat?tct?act?ttc?agg?aca 1631Lys?Asp?Leu?Ile?Phe?Leu?Asp?Ile?Ala?Leu?Asp?Ser?Thr?Phe?Arg?Thr
530 535 540gca?gtt?gaa?agg?tcg?tat?gag?gag?ctg?aat?gat?gca?gca?ccg?gag?aaa 1679Ala?Val?Glu?Arg?Ser?Tyr?Glu?Glu?Leu?Asn?Asp?Ala?Ala?Pro?Glu?Lys
545 550 555att?atg?tac?ttc?atc?agt?ctt?gtt?ctt?gaa?aat?ctt?gcc?ttg?tcc?act 1727Ile?Met?Tyr?Phe?Ile?Ser?Leu?Val?Leu?Glu?Asn?Leu?Ala?Leu?Ser?Thr560 565 570 575gac?gac?aac?gaa?gac?atc?tta?tat?tgc?tta?aag?gga?tgg?aat?cga?gcc 1775Asp?Asp?Asn?Glu?Asp?Ile?Leu?Tyr?Cys?Leu?Lys?Gly?Trp?Asn?Arg?Ala
580 585 590atg?gac?atg?gtt?aag?caa?aag?gat?gac?caa?tgg?gct?ctc?tac?gct?aaa 1823Met?Asp?Met?Val?Lys?Gln?Lys?Asp?Asp?Gln?Trp?Ala?Leu?Tyr?Ala?Lys
595 600 605gca?ttt?ctt?gac?aga?acc?aga?ctt?gcc?ctt?gcg?agc?aag?ggc?gaa?caa 1871Ala?Phe?Leu?Asp?Arg?Thr?Arg?Leu?Ala?Leu?Ala?Ser?Lys?Gly?Glu?Gln
610 615 620tac?tac?aat?atg?atg?cag?ccc?tcg?gct?gaa?tat?ctt?ggc?tca?tta?ctc 1919Tyr?Tyr?Asn?Met?Met?Gln?Pro?Ser?Ala?Glu?Tyr?Leu?Gly?Ser?Leu?Leu
625 630 635aac?gtt?gag?gaa?tgg?gct?gtt?gac?atc?ttc?aca?gaa?gaa?gta?att?cgt 1967Asn?Val?Glu?Glu?Trp?Ala?Val?Asp?Ile?Phe?Thr?Glu?Glu?Val?Ile?Arg640 645 650 655ggt?gga?tca?gct?gcc?act?tta?tct?gct?ctt?ctg?aac?cga?ttt?gac?cct 2015Gly?Gly?Ser?Ala?Ala?Thr?Leu?Ser?Ala?Leu?Leu?Asn?Arg?Phe?Asp?Pro
660 665 670gtt?ctc?aga?aat?gtc?gca?cac?ctt?gga?agt?tgg?cag?gtt?att?agc?cca 2063Val?Leu?Arg?Asn?Val?Ala?His?Leu?Gly?Ser?Trp?Gln?Val?Ile?Ser?Pro
675 680 685gtt?gaa?gta?aca?ggt?tat?att?gta?gtg?gtt?gat?aag?ttg?ctt?tct?gtt 2111Val?Glu?Val?Thr?Gly?Tyr?Ile?Val?Val?Val?Asp?Lys?Leu?Leu?Ser?Val
690 695 700caa?aac?aaa?act?tat?gat?aaa?cca?aca?atc?ctt?gtg?gca?aag?agt?gtc 2159Gln?Asn?Lys?Thr?Tyr?Asp?Lys?Pro?Thr?Ile?Leu?Val?Ala?Lys?Ser?Val
705 710 715aag?gga?gag?gaa?gaa?ata?cca?gat?ggt?gtt?gtt?ggc?gtg?ata?aca?cct 2207Lys?Gly?Glu?Glu?Glu?Ile?Pro?Asp?Gly?Val?Val?Gly?Val?Ile?Thr?Pro720 725 730 735gat?atg?cca?gat?gtt?ctg?tct?cat?gtg?tca?gtt?cga?gca?agg?aat?tgc 2255Asp?Met?Pro?Asp?Val?Leu?Ser?His?Val?Ser?Val?Arg?Ala?Arg?Asn?Cys
740 745 750aag?gtg?ttg?ttt?gcg?aca?tgc?ttt?gac?ccg?aat?acc?ctg?tct?gaa?ttt 2303Lys?Val?Leu?Phe?Ala?Thr?Cys?Phe?Asp?Pro?Asn?Thr?Leu?Ser?Glu?Phe
755 760 765caa?gga?cat?gaa?ggg?aag?gtg?ttt?tcc?ttc?aaa?act?act?tct?gca?gat 2351Gln?Gly?His?Glu?Gly?Lys?Val?Phe?Ser?Phe?Lys?Thr?Thr?Ser?Ala?Asp
770 775 780gtc?acc?tac?agg?gag?gta?tcg?gac?agt?gaa?ctt?atg?cag?tca?agt?tct 2399Val?Thr?Tyr?Arg?Glu?Val?Ser?Asp?Ser?Glu?Leu?Met?Gln?Ser?Ser?Ser
785 790 795tca?gat?gca?caa?ggt?ggt?gaa?gca?ata?cca?tct?tta?tca?tta?gtc?aag 2447Ser?Asp?Ala?Gln?Gly?Gly?Glu?Ala?Ile?Pro?Ser?Leu?Ser?Leu?Val?Lys800 805 810 815aaa?aag?ttc?ctt?gga?aaa?tat?gca?ata?tca?gcg?gaa?gag?ttc?tct?gat 2495Lys?Lys?Phe?Leu?Gly?Lys?Tyr?Ala?Ile?Ser?Ala?Glu?Glu?Phe?Ser?Asp
820 825 830gaa?atg?gtt?gga?gca?aag?tcc?cgc?aac?ata?gca?tac?ctg?aaa?gga?aaa 2543Glu?Met?Val?Gly?Ala?Lys?Ser?Arg?Asn?Ile?Ala?Tyr?Leu?Lys?Gly?Lys
835 840 845gta?cct?tca?tgg?gtt?ggt?atc?cca?aca?tca?gtt?gcg?ata?cca?ttt?ggg 2591Val?Pro?Ser?Trp?Val?Gly?Ile?Pro?Thr?Ser?Val?Ala?Ile?Pro?Phe?Gly
850 855 860acc?ttt?gag?aag?ata?ttg?tct?gat?gag?acc?aat?aag?gaa?gta?gca?caa 2639Thr?Phe?Glu?Lys?Ile?Leu?Ser?Asp?Glu?Thr?Asn?Lys?Glu?Val?Ala?Gln
865 870 875aac?ata?cag?atg?ctg?aag?ggc?aga?ctt?gct?caa?gaa?gat?ttt?agt?gct 2687Asn?Ile?Gln?Met?Leu?Lys?Gly?Arg?Leu?Ala?Gln?Glu?Asp?Phe?Ser?Ala880 885 890 895cta?gga?gaa?atc?cgg?aaa?act?gtt?ctt?aat?cta?act?gct?cca?act?caa 2735Leu?Gly?Glu?Ile?Arg?Lys?Thr?Val?Leu?Asn?Leu?Thr?Ala?Pro?Thr?Gln
900 905 910ccg?gtt?aag?gag?ctg?aag?gag?aag?atg?cta?agc?tcc?gga?atg?ccc?tgg 2783Pro?Val?Lys?Glu?Leu?Lys?Glu?Lys?Met?Leu?Ser?Ser?Gly?Met?Pro?Trp
915 920 925cct?gga?gat?gaa?agt?gac?cac?cgt?tgg?gag?caa?gca?tgg?atg?gca?att 2831Pro?Gly?Asp?Glu?Ser?Asp?His?Arg?Trp?Glu?Gln?Ala?Trp?Met?Ala?Ile
930 935 940aaa?aag?gtt?tgg?gca?tca?aaa?tgg?aat?gaa?aga?gca?tac?ttt?agt?aca 2879Lys?Lys?Val?Trp?Ala?Ser?Lys?Trp?Asn?Glu?Arg?Ala?Tyr?Phe?Ser?Thr
945 950 955cgc?aag?gtg?aag?ctc?gat?cat?gag?tac?ctt?tcc?atg?gct?gtt?ctt?gta 2927Arg?Lys?Val?Lys?Leu?Asp?His?Glu?Tyr?Leu?Ser?Met?Ala?Val?Leu?Val960 965 970 975caa?gaa?att?gtc?aac?gca?gac?tat?gcc?ttt?gtc?att?cat?act?acg?aac 2975Gln?Glu?Ile?Val?Asn?Ala?Asp?Tyr?Ala?Phe?Val?Ile?His?Thr?Thr?Asn
980 985 990ccg?tca?tct?gga?gat?tct?tct?gag?ata?tat?gct?gaa?gtg?gtg?aaa?gga 3023Pro?Ser?Ser?Gly?Asp?Ser?Ser?Glu?Ile?Tyr?Ala?Glu?Val?Val?Lys?Gly
995 1000 1005ctt?gga?gag?aca?ctt?gtg?gga?gct?tat?cct?ggc?cgt?gcc?atg?agc?ttc 3071Leu?Gly?Glu?Thr?Leu?Val?Gly?Ala?Tyr?Pro?Gly?Arg?Ala?Met?Ser?Phe
1010 1015 1020gtg?tgt?aag?aaa?gat?gac?ctt?gac?tct?ccc?aag?gta?ctg?ggt?tac?cct 3119Val?Cys?Lys?Lys?Asp?Asp?Leu?Asp?Ser?Pro?Lys?Val?Leu?Gly?Tyr?Pro 1025 1030 1035agc?aag?cca?att?ggt?ctc?ttc?ata?aag?cgg?tca?atc?atc?ttc?cgc?tca 3167Ser?Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg?Ser?Ile?Ile?Phe?Arg?Ser1040 1045 1050 1055gac?tct?aat?ggt?gag?gat?ctg?gaa?ggt?tac?gct?gga?gca?ggg?ctg?tat 3215Asp?Ser?Asn?Gly?Glu?Asp?Leu?Glu?Gly?Tyr?Ala?Gly?Ala?Gly?Leu?Tyr
1060 1065 1070gat?agt?gtc?cct?atg?gat?gtg?gaa?gat?gaa?gtt?gta?ctc?gac?tac?acg 3263Asp?Ser?Val?Pro?Met?Asp?Val?Glu?Asp?Glu?Val?Val?Leu?Asp?Tyr?Thr
1075 1080 1085acc?gac?cct?ctc?atc?act?gac?tct?gga?ttc?cgg?aac?tca?atc?ctc?tca 3311Thr?Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?Arg?Asn?Ser?Ile?Leu?Ser
1090 1095 1100agc?att?gca?cgg?gct?ggc?cac?gcc?atc?gag?gag?ctc?tat?ggg?tca?cca 3359Ser?Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu?Glu?Leu?Tyr?Gly?Ser?Pro 1105 1110 1115cag?gat?gtt?gag?gga?gta?gtg?aag?gat?ggg?aag?atc?tac?gta?gtc?cag 3407Gln?Asp?Val?Glu?Gly?Val?Val?Lys?Asp?Gly?Lys?Ile?Tyr?Val?Val?Gln1120 1125 1130 1135aca?tac?cac?aga?tgt?aat?atg?tat?gta?tac?gcg?gct?caa?gtt?gta?gag 3455Thr?Tyr?His?Arg?Cys?Asn?Met?Tyr?Val?Tyr?Ala?Ala?Gln?Val?Val?Glu
1,140 1145 1150tag taggatatat ggtccttgct ggcatgtata gttgtactca taggtgcaca 3508acacatctac gttgttattt atttgcatat acgctcagaa taagctttga tcacatactg 3568tatttcctag agtaccagaa agtgtatgta cgatcaggaa tatgacctta ttaaaaccat 3628tgaggggaaa tgttttgact tttgagcaat ctaaaaaaaa aaaaaaaaaa, 3678＜210〉10＜211〉1152＜212〉PRT＜213〉common wheat＜400〉l0Gly Arg Arg Lys Glu Leu Gln Ala Glu Leu Asp Asn Gly Ala Ser Val, 15 10 15Asp Gln Leu Arg Lys Lys Ile Val Lys Gly Asn Leu Glu Lys Lys Val
20 25 30Ser?Lys?Gln?Leu?Glu?Lys?Lys?Lys?Tyr?Phe?Ser?Val?Glu?Arg?Ile?Gln
35 40 45Arg?Arg?Asn?Arg?Asp?Ile?Thr?Gln?Leu?Leu?Asn?Lys?His?Lys Pro?Val
50 55 60Val?Thr?Glu?Gln?Gln?Val?Lys?Ala?Ala?Pro?Lys?Gln?Pro?Thr?Val?Leu?65 70 75 80Asp?Leu?Phe?Thr?Lys?Ser?Leu?Gln?Glu?Gly?Asp?Asn?Cys?Asp?Val?Leu
85 90 95Ser?Arg?Lys?Leu?Phe?Lys?Ile?Gly?Asp?Glu?Glu?Ile?Leu?Ala?Ile?Ala
100 105 110Thr?Asn?Ala?Leu?Gly?Lys?Thr?Arg?Val?His?Leu?Ala?Thr?Asn?Arg?Met
115 120 125Glu?Pro?Leu?Ile?Leu?His?Trp?Ala?Leu?Ala?Lys?Asn?Pro?Gly?Glu?Trp
130 135 140Glu?Ala?Pro?Pro?Ser?Ser?Ile?Val?Pro?Ser?Gly?Ser?Thr?Val?Leu?Asp145 150 155 160Lys?Ala?Cys?Glu?Thr?Ser?Phe?Gly?Glu?Ser?Glu?Leu?Asp?Gly?Leu?Gln
165 170 175Tyr?Gln?Val?Val?Glu?Ile?Glu?Leu?Asp?Asp?Gly?Arg?Tyr?Lys?Gly?Met
180 185 190Pro?Phe?Val?Leu?Arg?Arg?Gly?Glu?Thr?Trp?Ile?Lys?Asn?Asn?Asp?Ser
195 200 205Asp?Phe?Tyr?Leu?Asp?Phe?Asn?Thr?Lys?Val?Thr?Lys?Lys?Ser?Lys?Asp
210 215 220Thr?Gly?Asp?Ala?Gly?Lys?Gly?Thr?Ala?Lys?Asp?Phe?Leu?Glu?Arg?Ile225 230 235 240Ala?Asp?Leu?Glu?Glu?Asp?Ala?Gln?Arg?Ser?Phe?Met?His?Arg?Phe?Asn
245 250 255Ile?Ala?Ala?Asp?Leu?Val?Asp?Gln?Ala?Arg?Asp?Ala?Gly?Leu?Leu?Gly
260 265 270Ile?Val?Gly?Leu?Phe?Val?Trp?Ile?Arg?Phe?Met?Ser?Thr?Arg?Gln?Leu
275 280 285Ile?Trp?Asn?Lys?Asn?Tyr?Asn?Val?Lys?Pro?Arg?Glu?Ile?Ser?Gln?Ala
290 295 300Gln?Asp?Arg?Phe?Thr?Asp?Asp?Leu?Glu?Asn?Met?Tyr?Lys?Ser?Tyr?Pro305 310 315 320Gln?Tyr?Arg?Glu?Ile?Leu?Arg?Met?Leu?Leu?Ser?Ala?Val?Gly?Arg?Gly
325 330 335Gly?Glu?Gly?Asp?Val?Gly?Gln?Arg?Ile?Arg?Asp?Glu?Ile?Leu?Val?Ile
340 345 350Gln?Arg?Asn?Asn?Asp?Cys?Lys?Gly?Gly?Ile?Met?Glu?Glu?Trp?His?Gln
355 360 365Lys?Leu?His?Asn?Asn?Thr?Ser?Pro?Asp?Asp?Val?Val?Ile?Cys?Gln?Ala
370 375 380Ile?Ile?Asp?Tyr?Ile?Lys?Ser?Asp?Phe?Asp?Ile?Asn?Val?Tyr?Trp?Asp385 390 395 400Thr?Leu?Asn?Lys?Asn?Gly?Ile?Thr?Lys?Glu?Arg?Leu?Leu?Ser?Tyr?Asp
405 410 415Arg?Ala?Ile?His?Ser?Glu?Pro?Lys?Phe?Arg?Ser?Asp?Gln?Lys?Glu?Gly
420 425 430Leu?Leu?Arg?Asp?Leu?Gly?Asn?Tyr?Met?Arg?Ser?Leu?Lys?Ala?Val?His
435 440 445Ser?Gly?Ala?Asp?Leu?Glu?Ser?Ala?Ile?Ala?Thr?Cys?Met?Gly?Tyr?Lys
450 455 460Ser?Glu?Gly?Glu?Gly?Phe?Met?Val?Gly?Val?Gln?Ile?Asn?Pro?Val?Asn465 470 475 480Gly?Leu?Ser?Ser?Gly?Phe?Pro?Asp?Leu?Leu?Gln?Phe?Val?Leu?Asp?His
485 490 495Val?Glu?Asp?Lys?Ser?Ala?Glu?Pro?Leu?Leu?Glu?Gly?Leu?Leu?Glu?Ala
500 505 510Arg?Val?Glu?Leu?Arg?Pro?Leu?Leu?Thr?Gly?Ser?Ser?Glu?Arg?Leu?Lys
515 520 525Asp?Leu?Ile?Phe?Leu?Asp?Ile?Ala?Leu?Asp?Ser?Thr?Phe?Arg?Thr?Ala
530 535 540Val?Glu?Arg?Ser?Tyr?Glu?Glu?Leu?Asn?Asp?Ala?Ala?Pro?Glu?Lys?Ile545 550 555 560Met?Tyr?Phe?Ile?Ser?Leu?Val?Leu?Glu?Asn?Leu?Ala?Leu?Ser?Thr?Asp
565 570 575Asp?Asn?Glu?Asp?Ile?Leu?Tyr?Cys?Leu?Lys?Gly?Trp?Asn?Arg?Ala?Met
580 585 590Asp?Met?Val?Lys?Gln?Lys?Asp?Asp?Gln?Trp?Ala?Leu?Tyr?Ala?Lys?Ala
595 600 605Phe?Leu?Asp?Arg?Thr?Arg?Leu?Ala?Leu?Ala?Ser?Lys?Gly?Glu?Gln?Tyr
610 615 620Tyr?Asn?Met?Met?Gln?Pro?Ser?Ala?Glu?Tyr?Leu?Gly?Ser?Leu?Leu?Asn625 630 635 640Val?Glu?Glu?Trp?Ala?Val?Asp?Ile?Phe?Thr?Glu?Glu?Val?Ile?Arg?Gly
645 650 655Gly?Ser?Ala?Ala?Thr?Leu?Ser?Ala?Leu?Leu?Asn?Arg?Phe?Asp?Pro?Val
660 665 670Leu?Arg?Asn?Val?Ala?His?Leu?Gly?Ser?Trp?Gln?Val?Ile?Ser?Pro?Val
675 680 685Glu?Val?Thr?Gly?Tyr?Ile?Val?Val?Val?Asp?Lys?Leu?Leu?Ser?Val?Gln
690 695 700Asn?Lys?Thr?Tyr?Asp?Lys?Pro?Thr?Ile?Leu?Val?Ala?Lys?Ser?Val?Lys705 710 715 720Gly?Glu?Glu?Glu?Ile?Pro?Asp?Gly?Val?Val?Gly?Val?Ile?Thr?Pro?Asp
725 730 735Met?Pro?Asp?Val?Leu?Ser?His?Val?Ser?Val?Arg?Ala?Arg?Asn?Cys?Lys
740 745 750Val?Leu?Phe?Ala?Thr?Cys?Phe?Asp?Pro?Asn?Thr?Leu?Ser?Glu?Phe?Gln
755 760 765Gly?His?Glu?Gly?Lys?Val?Phe?Ser?Phe?Lys?Thr?Thr?Ser?Ala?Asp?Val
770 775 780Thr?Tyr?Arg?Glu?Val?Ser?Asp?Ser?Glu?Leu?Met?Gln?Ser?Ser?Ser?Ser785 790 795 800Asp?Ala?Gln?Gly?Gly?Glu?Ala?Ile?Pro?Ser?Leu?Ser?Leu?Val?Lys?Lys
805 810 815Lys?Phe?Leu?Gly?Lys?Tyr?Ala?Ile?Ser?Ala?Glu?Glu?Phe?Ser?Asp?Glu
820 825 830Met?Val?Gly?Ala?Lys?Ser?Arg?Asn?Ile?Ala?Tyr?Leu?Lys?Gly?Lys?Val
835 840 845Pro?Ser?Trp?Val?Gly?Ile?Pro?Thr?Ser?Val?Ala?Ile?Pro?Phe?Gly?Thr
850 855 860Phe?Glu?Lys?Ile?Leu?Ser?Asp?Glu?Thr?Asn?Lys?Glu?Val?Ala?Gln?Asn865 870 875 880Ile?Gln?Met?Leu?Lys?Gly?Arg?Leu?Ala?Gln?Glu?Asp?Phe?Ser?Ala?Leu
885 890 895Gly?Glu?Ile?Arg?Lys?Thr?Val?Leu?Asn?Leu?Thr?Ala?Pro?Thr?Gln?Pro
900 905 910Val?Lys?Glu?Leu?Lys?Glu?Lys?Met?Leu?Ser?Ser?Gly?Met?Pro?Trp?Pro
915 920 925Gly?Asp?Glu?Ser?Asp?His?Arg?Trp?Glu?Gln?Ala?Trp?Met?Ala?Ile?Lys
930 935 940Lys?Val?Trp?Ala?Ser?Lys?Trp?Asn?Glu?Arg?Ala?Tyr?Phe?Ser?Thr?Arg945 950 955 960Lys?Val?Lys?Leu?Asp?His?Glu?Tyr?Leu?Ser?Met?Ala?Val?Leu?Val?Gln
965 970 975Glu?Ile?Val?Asn?Ala?Asp?Tyr?Ala?Phe?Val?Ile?His?Thr?Thr?Asn?Pro
980 985 990Ser?Ser?Gly?Asp?Ser?Ser?Glu?Ile?Tyr?Ala?Glu?Val?Val?Lys?Gly?Leu
995 1000 1005Gly?Glu?Thr?Leu?Val?Gly?Ala?Tyr?Pro?Gly?Arg?Ala?Met?Ser?Phe?Val 1010 1015 1020Cys?Lys?Lys?Asp?Asp?Leu?Asp?Ser?Pro?Lys?Val?Leu?Gly?Tyr?Pro?Ser1025 1030 1035 1040Lys?Pro?Ile?Gly?Leu?Phe?Ile?Lys?Arg?Ser?Ile?Ile?Phe?Arg?Ser?Asp
1045 1050 1055Ser?Ash?Gly?Glu?Asp?Leu?Glu?Gly?Tyr?Ala?Gly?Ala?Gly?Leu?Tyr?Asp
1060 1065 1070Ser?Val?Pro?Met?Asp?Val?Glu?Asp?Glu?Val?Val?Leu?Asp?Tyr?Thr?Thr
1075 1080 1085Asp?Pro?Leu?Ile?Thr?Asp?Ser?Gly?Phe?Arg?Asn?Ser?Ile?Leu?Ser?Ser 1090 1095 1100Ile?Ala?Arg?Ala?Gly?His?Ala?Ile?Glu?Glu?Leu?Tyr?Gly?Ser?Pro?Gln1105 1110 1115 1120Asp?Val?Glu?Gly?Val?Val?Lys?Asp?Gly?Lys?Ile?Tyr?Val?Val?Gln?Thr
1125 1130 1135Tyr?His?Arg?Cys?Asn?Met?Tyr?Val?Tyr?Ala?Ala?Gln?Val?Val?Glu
1140 1145 1150

Claims (22)

1. nucleic acid molecule of R1-protein or proteinic part of R1-or derivative of encoding, it is selected from the group that following nucleic acid molecule is formed:
(a) coding comprises the proteinic nucleic acid molecule of R1 or its part or derivatives thereof of the polypeptide of the group that is selected from Seq.ID No.2 and Seq.ID No.10 composition;
(b) coding is selected from nucleic acid molecule or its part or derivatives thereof of the group of Seq.ID No.1 and Seq.ID No.9 composition;
(c) comprise that the cDNA that is selected from the group of forming according to the plasmid pTa R1-11 of DSM numbers 12810 with according to the plasmid RS26-88 of DSM numbers 13511 inserts nucleic acid molecule or its part or derivatives thereof in fragment coding district;
(d) nucleic acid molecule or its part or derivatives thereof of coding one peptide species, described polypeptide comprises the polypeptide that is inserted fragment coding by cDNA, and described cDNA inserts fragment and is selected from according to the plasmid pTa R1-11 of DSM numbers 12810 and the group formed according to the plasmid RS26-88 of DSM numbers 13511.
2. nucleic acid molecule according to claim 1, it comprises one or more regulatory elements of guaranteeing transit cell record and/or translation.
3. one kind according to one or multinomial nucleic acid molecule among the claim 1-2, and it is a dna molecular.
4. one kind according to one or multinomial nucleic acid molecule among the claim 1-2, and it is the RNA molecule.
5. carrier that comprises among the claim 1-4 one or multinomial nucleic acid molecule.
6. carrier according to claim 5, it comprises one or more regulatory elements of transcribing and/or translate in bacterium and/or the vegetable cell guaranteed.
7. genetically modified host cell, it comprises according to one or multinomial nucleic acid molecule among the claim 1-4 and/or according to one or multinomial carrier among the claim 5-6.
8. host cell according to claim 7, it is a vegetable cell.
9. method that is used for preparing according to one of claim 7-8 or multinomial transgenic cell, this method comprise and will introduce step in prokaryotic cell prokaryocyte or the eukaryotic genome according to one or multinomial nucleic acid molecule among the claim 1-4 and/or according to one or multinomial carrier among the claim 5-6.
10. method according to claim 9, wherein said cell is a vegetable cell.
11. transgenic plant that comprise the described host cell of claim 8.
12. a method that is used to produce according to the plant of claim 11, this method comprise according to one or multinomial nucleic acid molecule among the claim 1-4 and/or according to one or multinomial carrier introduced plant cell among the claim 5-6 and from the regenerate step of complete plant of this vegetable cell.
13. reproductive material from the described plant of claim 11.
14. seed from the transgenic plant of claim 11.
15. a method that is used to produce starch, this method comprise with according to Claim 8 vegetable cell, according to the plant of claim 11, according to the reproductive material of claim 13 and/or introduce the step of the technology that is used for producing starch according to the seed of claim 14.
16. one kind can be available from according to Claim 8 vegetable cell, according to the plant of claim 11, according to the reproductive material of claim 13 and/or the starch that obtains according to the method for the seed of claim 14 or available claim 15.
17. comprising, a method that is used to produce treated starch, this method starch is carried out step in the technology of chemistry and/or physical modification with introducing according to the starch of claim 16.
18. one kind is used to produce the R1-polypeptide or derivatives thereof of Seq.ID No.2 and Seq.ID No.10 or the method for its part, this method is included in cultivates under the condition that allows marking protein according to one or multinomial host cell and the step of separating described R1-polypeptide from described cell and/or substratum among the claim 7-8.
19. one kind by R1-polypeptide or derivatives thereof or its part according to one or multinomial nucleic acid molecule encoding among the claim 1-4.
20. the application of R1-polypeptide in manufacture order clonal antibody or polyclonal antibody according to claim 19.
21. in the screening nucleic acid library and/or as the application in the hybridization probe, described nucleic acid molecule or derivatives thereof or its part randomly are labeled according to one or multinomial nucleic acid molecule or derivatives thereof among the claim 1-4 or its part.
22. according to one or multinomial nucleic acid molecule or derivatives thereof or the application of its part in preparation transgenic cell or transgenic plant among the claim 1-4.
CN00808513A 1999-06-11 2000-06-02 Nucleic acid molecules from wheat, transgenic plant cells and plants, and use thereof for production of modified starch Pending CN1402789A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19926771A DE19926771A1 (en) 1999-06-11 1999-06-11 Nucleic acid molecules from wheat, transgenic plant cells and plants and their use for the production of modified starch
DE19926771.5 1999-06-11

Publications (1)

Publication Number Publication Date
CN1402789A true CN1402789A (en) 2003-03-12

Family

ID=7910992

Family Applications (1)

Application Number Title Priority Date Filing Date
CN00808513A Pending CN1402789A (en) 1999-06-11 2000-06-02 Nucleic acid molecules from wheat, transgenic plant cells and plants, and use thereof for production of modified starch

Country Status (10)

Country Link
US (2) US6462256B1 (en)
EP (1) EP1185678A2 (en)
JP (1) JP2003502049A (en)
CN (1) CN1402789A (en)
AR (1) AR024318A1 (en)
AU (1) AU781687B2 (en)
BR (1) BR0011499A (en)
CA (1) CA2370405C (en)
DE (1) DE19926771A1 (en)
WO (1) WO2000077229A2 (en)

Families Citing this family (190)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19926771A1 (en) * 1999-06-11 2000-12-14 Aventis Cropscience Gmbh Nucleic acid molecules from wheat, transgenic plant cells and plants and their use for the production of modified starch
US6734340B2 (en) * 2000-10-23 2004-05-11 Bayer Cropscience Gmbh Monocotyledon plant cells and plants which synthesise modified starch
NZ514547A (en) * 2001-09-28 2004-10-29 Duncan Stanley Plastid alph-amylase protein and nucleic acids encoding same and methods for altering the starch content of a plant
DE10208133A1 (en) * 2002-02-26 2003-09-11 Planttec Biotechnologie Gmbh Transgenic fodder plants with increased leaf starch content
US7401288B2 (en) * 2003-06-30 2008-07-15 International Business Machines Corporation Method and apparatus for transmitting accessibility requirements to a server
AR048024A1 (en) 2004-03-05 2006-03-22 Bayer Cropscience Gmbh PLANTS WITH INCREASED ACTIVITY OF DIFFERENT ENZYMES FOSFORILANTES DEL ALMIDON
AR048026A1 (en) 2004-03-05 2006-03-22 Bayer Cropscience Gmbh PROCEDURES FOR THE IDENTIFICATION OF PROTEINS WITH ENZYMATIC ACTIVITY FOSFORILADORA DE ALMIDON
CA2557843C (en) 2004-03-05 2015-06-02 Bayer Cropscience Gmbh Plants with reduced activity of a starch phosphorylating enzyme
AR048025A1 (en) 2004-03-05 2006-03-22 Bayer Cropscience Gmbh PLANTS WITH INCREASED ACTIVITY OF AN ALMIDON FOSFORILING ENZYME
ES2340183T3 (en) * 2004-08-18 2010-05-31 Bayer Cropscience Ag PLANTS WITH GREATER PLASTIC ACTIVITY OF ENZIMA R3 FOSFORILANTE DE ALMIDON.
CL2007003743A1 (en) * 2006-12-22 2008-07-11 Bayer Cropscience Ag COMPOSITION THAT INCLUDES FENAMIDONA AND AN INSECTICIDE COMPOUND; AND METHOD TO CONTROL FITOPATOGENOS CULTURES AND INSECTS FACING OR PREVENTIVELY.
CL2007003744A1 (en) 2006-12-22 2008-07-11 Bayer Cropscience Ag COMPOSITION THAT INCLUDES A 2-PYRIDILMETILBENZAMIDE DERIVATIVE AND AN INSECTICIDE COMPOUND; AND METHOD TO CONTROL FITOPATOGENOS CULTURES AND INSECTS FACING OR PREVENTIVELY.
EP1969934A1 (en) 2007-03-12 2008-09-17 Bayer CropScience AG 4-cycloalkyl or 4-aryl substituted phenoxy phenylamidines and their use as fungicides
US8080688B2 (en) 2007-03-12 2011-12-20 Bayer Cropscience Ag 3, 4-disubstituted phenoxyphenylamidines and use thereof as fungicides
BRPI0808846A2 (en) 2007-03-12 2019-09-24 Bayer Cropscience Ag 3-substituted phenoxyphenylamidines and their use as fungicides
EP1969931A1 (en) * 2007-03-12 2008-09-17 Bayer CropScience Aktiengesellschaft Fluoroalkyl phenylamidines and their use as fungicides
BRPI0808786A2 (en) 2007-03-12 2014-09-16 Bayer Cropscience Ag DI-HALOGENOPHENOXYPHYMYLAMIDINES AND ITS USE AS FUNGICIDES
EP1969929A1 (en) 2007-03-12 2008-09-17 Bayer CropScience AG Substituted phenylamidines and their use as fungicides
JP2010524869A (en) * 2007-04-19 2010-07-22 バイエル・クロツプサイエンス・アクチエンゲゼルシヤフト Thiadiazolyloxyphenylamidines and their use as fungicides
DE102007045919B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Drug combinations with insecticidal and acaricidal properties
DE102007045953B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Drug combinations with insecticidal and acaricidal properties
DE102007045956A1 (en) 2007-09-26 2009-04-09 Bayer Cropscience Ag Combination of active ingredients with insecticidal and acaricidal properties
DE102007045922A1 (en) 2007-09-26 2009-04-02 Bayer Cropscience Ag Drug combinations with insecticidal and acaricidal properties
DE102007045920B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Synergistic drug combinations
EP2090168A1 (en) 2008-02-12 2009-08-19 Bayer CropScience AG Method for improving plant growth
BRPI0818691A2 (en) * 2007-10-02 2014-09-30 Bayer Cropscience Ag METHODS TO IMPROVE VEGETABLE GROWTH.
EP2222855B1 (en) * 2007-11-27 2018-08-01 Commonwealth Scientific and Industrial Research Organisation Plants with modified starch metabolism
EP2072506A1 (en) 2007-12-21 2009-06-24 Bayer CropScience AG Thiazolyloxyphenylamidine or thiadiazolyloxyphenylamidine und its use as fungicide
EP2168434A1 (en) 2008-08-02 2010-03-31 Bayer CropScience AG Use of azols to increase resistance of plants of parts of plants to abiotic stress
JP2011530548A (en) 2008-08-14 2011-12-22 バイエル・クロップサイエンス・アーゲー Insecticidal 4-phenyl-1H-pyrazoles
DE102008041695A1 (en) 2008-08-29 2010-03-04 Bayer Cropscience Ag Methods for improving plant growth
EP2201838A1 (en) 2008-12-05 2010-06-30 Bayer CropScience AG Active ingredient-beneficial organism combinations with insecticide and acaricide properties
EP2198709A1 (en) 2008-12-19 2010-06-23 Bayer CropScience AG Method for treating resistant animal pests
EP2223602A1 (en) 2009-02-23 2010-09-01 Bayer CropScience AG Method for improved utilisation of the production potential of genetically modified plants
AU2009335333B2 (en) 2008-12-29 2015-04-09 Bayer Intellectual Property Gmbh Method for improved use of the production potential of genetically modified plants
EP2204094A1 (en) 2008-12-29 2010-07-07 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants Introduction
EP2039772A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants introduction
EP2039771A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
EP2039770A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
JP5558490B2 (en) 2009-01-19 2014-07-23 バイエル・クロップサイエンス・アーゲー Cyclic diones and their use as insecticides, acaricides and / or fungicides
EP2227951A1 (en) 2009-01-23 2010-09-15 Bayer CropScience AG Application of enaminocarbonyl compounds for combating viruses transmitted by insects
US8349884B2 (en) 2009-01-28 2013-01-08 Bayer Cropscience Ag Fungicide N-cycloalkyl-N-bicyclimethylene-carboxamide derivatives
AR075126A1 (en) 2009-01-29 2011-03-09 Bayer Cropscience Ag METHOD FOR THE BEST USE OF THE TRANSGENIC PLANTS PRODUCTION POTENTIAL
EP2218717A1 (en) 2009-02-17 2010-08-18 Bayer CropScience AG Fungicidal N-((HET)Arylethyl)thiocarboxamide derivatives
EP2398770B1 (en) 2009-02-17 2016-12-28 Bayer Intellectual Property GmbH Fungicidal n-(phenylcycloalkyl)carboxamide, n-(benzylcycloalkyl)carboxamide and thiocarboxamide derivatives
TW201031331A (en) 2009-02-19 2010-09-01 Bayer Cropscience Ag Pesticide composition comprising a tetrazolyloxime derivative and a fungicide or an insecticide active substance
DE102009001469A1 (en) 2009-03-11 2009-09-24 Bayer Cropscience Ag Improving utilization of productive potential of transgenic plant by controlling e.g. animal pest, and/or by improving plant health, comprises treating the transgenic plant with active agent composition comprising prothioconazole
DE102009001681A1 (en) 2009-03-20 2010-09-23 Bayer Cropscience Ag Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi, microorganisms and/or improving plant health, comprises treating plant with a drug composition comprising iprovalicarb
DE102009001730A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi and/or microorganisms and/or the plant health, comprises treating plant with a drug composition comprising spiroxamine
DE102009001732A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising trifloxystrobin
DE102009001728A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising fluoxastrobin
KR101647702B1 (en) 2009-03-25 2016-08-11 바이엘 인텔렉쳐 프로퍼티 게엠베하 Active ingredient combinations with insecticidal and acaricidal properties
EP2232995A1 (en) 2009-03-25 2010-09-29 Bayer CropScience AG Method for improved utilisation of the production potential of transgenic plants
BRPI0924425B1 (en) 2009-03-25 2017-05-16 Bayer Cropscience Ag combinations of active substances, their use and method for controlling insect pests and / or plant pathogens
BRPI0924451B1 (en) 2009-03-25 2017-12-26 Bayer Intellectual Property Gmbh Combinations of active substances and their uses, as well as methods for the control of animal pests and method for the manufacture of insecticides and acaricides
US8828907B2 (en) 2009-03-25 2014-09-09 Bayer Cropscience Ag Active ingredient combinations having insecticidal and acaricidal properties
JP2012521371A (en) 2009-03-25 2012-09-13 バイエル・クロップサイエンス・アーゲー Combination of active compounds having insecticidal and acaricidal properties
EP2239331A1 (en) 2009-04-07 2010-10-13 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
BRPI1015543A8 (en) 2009-05-06 2016-05-24 Bayer Cropscience Ag CYCLOPENTANEDIONE COMPOUNDS AND THEIR USE AS INSECTICIDES, ACARICIDES AND/OR FUNGICIDES.
AR076839A1 (en) 2009-05-15 2011-07-13 Bayer Cropscience Ag FUNGICIDE DERIVATIVES OF PIRAZOL CARBOXAMIDAS
EP2251331A1 (en) 2009-05-15 2010-11-17 Bayer CropScience AG Fungicide pyrazole carboxamides derivatives
EP2255626A1 (en) 2009-05-27 2010-12-01 Bayer CropScience AG Use of succinate dehydrogenase inhibitors to increase resistance of plants or parts of plants to abiotic stress
EP2437595B1 (en) 2009-06-02 2018-10-31 Bayer CropScience AG Use of fluopyram for controlling sclerotinia ssp
AU2010272872B2 (en) 2009-07-16 2014-08-28 Bayer Intellectual Property Gmbh Synergistic active substance combinations containing phenyl triazoles
WO2011015524A2 (en) 2009-08-03 2011-02-10 Bayer Cropscience Ag Fungicide heterocycles derivatives
EP2292094A1 (en) 2009-09-02 2011-03-09 Bayer CropScience AG Active compound combinations
EP2343280A1 (en) 2009-12-10 2011-07-13 Bayer CropScience AG Fungicide quinoline derivatives
EP2519502A2 (en) 2009-12-28 2012-11-07 Bayer CropScience AG Fungicidal hydroximoyl-heterocycles derivatives
MX2012007539A (en) 2009-12-28 2012-07-23 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives.
CN102725282B (en) 2009-12-28 2015-12-16 拜尔农科股份公司 Fungicide hydroximoyl-tetrazole derivatives
PE20121693A1 (en) 2010-01-22 2012-12-01 Bayer Ip Gmbh COMBINATION OF SPIROMESIPHENE AND ABAMECTIN AS INSECTICIDES
CN102884054B (en) 2010-03-04 2015-01-14 拜耳知识产权有限责任公司 Fluoroalkyl-substituted 2-amidobenzimidazoles and the use thereof for boosting stress tolerance in plants
WO2011124554A2 (en) 2010-04-06 2011-10-13 Bayer Cropscience Ag Use of 4-phenylbutyric acid and/or the salts thereof for enhancing the stress tolerance of plants
CN102933083B (en) 2010-04-09 2015-08-12 拜耳知识产权有限责任公司 The derivative of (1-anocy clopropyl) phenyl phosphinic acid or its ester and/or its salt improve the purposes of plants against abiotic stress tolerance
JP2013525400A (en) 2010-04-28 2013-06-20 バイエル・クロップサイエンス・アーゲー Fungicide hydroxymoyl-heterocyclic derivative
WO2011134911A2 (en) 2010-04-28 2011-11-03 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
CN102985419A (en) 2010-04-28 2013-03-20 拜尔农科股份公司 Fungicide hydroximoyl-heterocycles derivatives
JP5730993B2 (en) 2010-06-03 2015-06-10 バイエル・クロップサイエンス・アーゲーＢａｙｅｒ Ｃｒｏｐｓｃｉｅｎｃｅ Ａｇ N-[(Heta) arylalkyl)] pyrazole (thio) carboxamides and their hetero-substituted analogues
AU2011260332B2 (en) 2010-06-03 2014-10-02 Bayer Cropscience Ag N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues
UA110703C2 (en) 2010-06-03 2016-02-10 Байєр Кропсайнс Аг Fungicidal n-[(trisubstitutedsilyl)methyl]carboxamide
EP2580336B1 (en) 2010-06-09 2017-05-10 Bayer CropScience NV Methods and means to modify a plant genome at a nucleotide sequence commonly used in plant genome engineering
WO2011154159A1 (en) 2010-06-09 2011-12-15 Bayer Bioscience N.V. Methods and means to modify a plant genome at a nucleotide sequence commonly used in plant genome engineering
KR20130041225A (en) 2010-07-20 2013-04-24 바이엘 크롭사이언스 아게 Benzocycloalkenes as antifungal agents
ES2587657T3 (en) 2010-09-03 2016-10-26 Bayer Intellectual Property Gmbh Substituted condensed dihydropyrimidinone derivatives
CN103298341B (en) 2010-09-22 2016-06-08 拜耳知识产权有限责任公司 Active component is used for preventing and treating the purposes of nematicide in nematicide crop
EP2460406A1 (en) 2010-12-01 2012-06-06 Bayer CropScience AG Use of fluopyram for controlling nematodes in nematode resistant crops
PL2624699T3 (en) 2010-10-07 2019-05-31 Bayer Cropscience Ag Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative
JP2013541553A (en) 2010-10-21 2013-11-14 バイエル・インテレクチユアル・プロパテイー・ゲー・エム・ベー・ハー 1- (Heterocycliccarbonyl) piperidines
CA2815105A1 (en) 2010-10-21 2012-04-26 Bayer Intellectual Property Gmbh N-benzyl heterocyclic carboxamides
MX2013004878A (en) 2010-11-02 2013-07-02 Bayer Ip Gmbh N-hetarylmethyl pyrazolylcarboxamides.
WO2012065945A1 (en) 2010-11-15 2012-05-24 Bayer Cropscience Ag 5-halogenopyrazole(thio)carboxamides
CN107266368A (en) 2010-11-15 2017-10-20 拜耳知识产权有限责任公司 5 halo-pyrazole formamides
AR083875A1 (en) 2010-11-15 2013-03-27 Bayer Cropscience Ag N-ARIL PIRAZOL (UNCLE) CARBOXAMIDS
EP2460407A1 (en) 2010-12-01 2012-06-06 Bayer CropScience AG Agent combinations comprising pyridylethyl benzamides and other agents
BR112013013670A2 (en) 2010-12-01 2016-07-12 Bayer Ip Gmbh use of fluopiram to control nematodes in crops
EP2474542A1 (en) 2010-12-29 2012-07-11 Bayer CropScience AG Fungicide hydroximoyl-tetrazole derivatives
CN103380124A (en) 2010-12-29 2013-10-30 拜耳知识产权有限责任公司 Fungicide hydroximoyl-tetrazole derivatives
EP2471363A1 (en) 2010-12-30 2012-07-04 Bayer CropScience AG Use of aryl-, heteroaryl- and benzylsulfonamide carboxylic acids, -carboxylic acid esters, -carboxylic acid amides and -carbonitriles and/or its salts for increasing stress tolerance in plants
EP2494867A1 (en) 2011-03-01 2012-09-05 Bayer CropScience AG Halogen-substituted compounds in combination with fungicides
WO2012120105A1 (en) 2011-03-10 2012-09-13 Bayer Cropscience Ag Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds
JP2014509599A (en) 2011-03-14 2014-04-21 バイエル・インテレクチユアル・プロパテイー・ゲー・エム・ベー・ハー Fungicide hydroxymoyl-tetrazole derivative
US20140051575A1 (en) 2011-04-08 2014-02-20 Juergen Benting Fungicide hydroximoyl-tetrazole derivatives
AR085585A1 (en) 2011-04-15 2013-10-09 Bayer Cropscience Ag VINIL- AND ALQUINILCICLOHEXANOLES SUBSTITUTED AS ACTIVE PRINCIPLES AGAINST STRIPS ABIOTIQUE OF PLANTS
EP2511255A1 (en) 2011-04-15 2012-10-17 Bayer CropScience AG Substituted prop-2-in-1-ol and prop-2-en-1-ol derivatives
AR085568A1 (en) 2011-04-15 2013-10-09 Bayer Cropscience Ag 5- (BICYCLE [4.1.0] HEPT-3-EN-2-IL) -PENTA-2,4-DIENOS AND 5- (BICYCLE [4.1.0] HEPT-3-EN-2-IL) -PENT- 2-IN-4-INOS REPLACED AS ACTIVE PRINCIPLES AGAINST ABIOTIC STRESS OF PLANTS
AR090010A1 (en) 2011-04-15 2014-10-15 Bayer Cropscience Ag 5- (CICLOHEX-2-EN-1-IL) -PENTA-2,4-DIENOS AND 5- (CICLOHEX-2-EN-1-IL) -PENT-2-EN-4-INOS REPLACED AS ACTIVE PRINCIPLES AGAINST THE ABIOTIC STRESS OF PLANTS, USES AND TREATMENT METHODS
EP2997825B1 (en) 2011-04-22 2018-11-07 Bayer Intellectual Property GmbH Active compound compositions comprising a (thio)carboxamide derivative and a fungicidal compound
EP2718443B1 (en) 2011-06-06 2017-11-29 Bayer CropScience NV Methods and means to modify a plant genome at a preselected site
US9173395B2 (en) 2011-07-04 2015-11-03 Bayer Intellectual Property Gmbh Use of substituted isoquinolinones, isoquinolindiones, isoquinolintriones and dihydroisoquinolinones or in each case salts thereof as active agents against abiotic stress in plants
CN103717076B (en) 2011-08-10 2016-04-13 拜耳知识产权股份有限公司 Active compound combinations containing specific tetramic acid derivatives
EP2748161A1 (en) 2011-08-22 2014-07-02 Bayer Intellectual Property GmbH Fungicide hydroximoyl-tetrazole derivatives
CN103981149A (en) 2011-08-22 2014-08-13 拜尔作物科学公司 Methods and means to modify a plant genome
WO2013034621A1 (en) 2011-09-09 2013-03-14 Bayer Intellectual Property Gmbh Acyl-homoserine lactone derivatives for improving plant yield
JP6002225B2 (en) 2011-09-12 2016-10-05 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングＢａｙｅｒ Ｉｎｔｅｌｌｅｃｔｕａｌ Ｐｒｏｐｅｒｔｙ ＧｍｂＨ Bactericidal 4-substituted-3- {phenyl [(heterocyclylmethoxy) imino] methyl} -1,2,4-oxadiazol-5 (4H) -one derivatives
MX357718B (en) 2011-09-16 2018-07-20 Bayer Ip Gmbh Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield.
EA029005B1 (en) 2011-09-16 2018-01-31 Байер Интеллектчуал Проперти Гмбх Use of phenylpyrazolin-3-carboxylates for improving plant yield
WO2013037955A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of acylsulfonamides for improving plant yield
AR087971A1 (en) 2011-09-23 2014-04-30 Bayer Ip Gmbh USE OF ACID DERIVATIVES 1-PHENYL-PIRAZOL-3-CARBOXILIC 4-SUBSTITUTED AS ACTIVE PRINCIPLES AGAINST PLANTS ABIOTIC STRESS
EP2764101B1 (en) 2011-10-04 2017-03-29 Bayer Intellectual Property GmbH RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE
WO2013050324A1 (en) 2011-10-06 2013-04-11 Bayer Intellectual Property Gmbh Combination, containing 4-phenylbutyric acid (4-pba) or a salt thereof (component (a)) and one or more selected additional agronomically active compounds (component(s) (b)), that reduces abiotic plant stress
CN103958531B (en) 2011-11-21 2016-12-28 拜耳知识产权有限责任公司 Antifungal N [(trisubstituted silicyl) methyl] carboxamide derivative
MX2014006350A (en) 2011-11-30 2014-06-23 Bayer Ip Gmbh Fungicidal n- bicycloalkyl and n-tricycloalkyl pyrazole - 4 - (thio) carboxamide derivatives.
US9414595B2 (en) 2011-12-19 2016-08-16 Bayer Cropscience Ag Use of anthranilic acid diamide derivatives for pest control in transgenic crops
CN104039769B (en) 2011-12-29 2016-10-19 拜耳知识产权有限责任公司 3-[(1,3-thiazole-4-yl methoxyimino) (phenyl) methyl]-2-substituted-1,2,4-diazole-5 (2H) the-one derivant of antifungal
MX343871B (en) 2011-12-29 2016-11-25 Bayer Ip Gmbh Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substit uted-1,2,4-oxadiazol-5(2h)-one derivatives.
US9408386B2 (en) 2012-02-22 2016-08-09 Bayer Intellectual Property Gmbh Use of succinate dehydrogenase inhibitors (SDHIs) for controlling wood diseases in grape
PE20190344A1 (en) 2012-02-27 2019-03-07 Bayer Ip Gmbh ACTIVE COMPOUND COMBINATIONS
WO2013139949A1 (en) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprising a strigolactame compound for enhanced plant growth and yield
EP2836489B1 (en) 2012-04-12 2016-06-29 Bayer Cropscience AG N-acyl-2-(cyclo) alkylpyrrolidines and piperidines useful as fungicides
KR102062517B1 (en) 2012-04-20 2020-01-06 바이엘 크롭사이언스 악티엔게젤샤프트 N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives
EP2838363A1 (en) 2012-04-20 2015-02-25 Bayer Cropscience AG N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives
WO2013160230A1 (en) 2012-04-23 2013-10-31 Bayer Cropscience Nv Targeted genome engineering in plants
EP2662361A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazol indanyl carboxamides
EP2662370A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole benzofuranyl carboxamides
JP6326043B2 (en) 2012-05-09 2018-05-16 バイエル・クロップサイエンス・アクチェンゲゼルシャフト 5-halogenopyrazole indanyl carboxamides
EP2662362A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole indanyl carboxamides
EP2662360A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole indanyl carboxamides
EP2662364A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole tetrahydronaphthyl carboxamides
WO2013167545A1 (en) 2012-05-09 2013-11-14 Bayer Cropscience Ag Pyrazole indanyl carboxamides
EP2662363A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole biphenylcarboxamides
AR091104A1 (en) 2012-05-22 2015-01-14 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS THAT INCLUDE A LIPO-CHYTOOLIGOSACARIDE DERIVATIVE AND A NEMATICIDE, INSECTICIDE OR FUNGICIDE COMPOUND
AU2013289301A1 (en) 2012-07-11 2015-01-22 Bayer Cropscience Ag Use of fungicidal combinations for increasing the tolerance of a plant towards abiotic stress
WO2014037340A1 (en) 2012-09-05 2014-03-13 Bayer Cropscience Ag Use of substituted 2-amidobenzimidazoles, 2-amidobenzoxazoles and 2-amidobenzothiazoles or salts thereof as active substances against abiotic plant stress
US9801374B2 (en) 2012-10-19 2017-10-31 Bayer Cropscience Ag Active compound combinations comprising carboxamide derivatives
MX363731B (en) 2012-10-19 2019-04-01 Bayer Cropscience Ag Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives.
AU2013333846B2 (en) 2012-10-19 2017-04-20 Bayer Cropscience Ag Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives
AU2013333845B2 (en) 2012-10-19 2017-06-08 Bayer Cropscience Ag Method of plant growth promotion using carboxamide derivatives
EP2735231A1 (en) 2012-11-23 2014-05-28 Bayer CropScience AG Active compound combinations
WO2014079957A1 (en) 2012-11-23 2014-05-30 Bayer Cropscience Ag Selective inhibition of ethylene signal transduction
UA116222C2 (en) 2012-11-30 2018-02-26 Байєр Кропсайєнс Акцієнгезелльшафт Ternary fungicidal and pesticidal mixtures
MX2015006328A (en) 2012-11-30 2015-09-07 Bayer Cropscience Ag Binary fungicidal or pesticidal mixture.
UA117819C2 (en) 2012-11-30 2018-10-10 Байєр Кропсайєнс Акцієнгезелльшафт Binary pesticidal and fungicidal mixtures
UA116223C2 (en) 2012-11-30 2018-02-26 Байєр Кропсайєнс Акцієнгезелльшафт Binary fungicidal mixtures
MX2015006327A (en) 2012-11-30 2015-10-05 Bayer Cropscience Ag Ternary fungicidal mixtures.
EP2928296A1 (en) 2012-12-05 2015-10-14 Bayer CropScience AG Use of substituted 1-(aryl ethynyl)-, 1-(heteroaryl ethynyl)-, 1-(heterocyclyl ethynyl)- and 1-(cyloalkenyl ethynyl)-cyclohexanols as active agents against abiotic plant stress
EP2740720A1 (en) 2012-12-05 2014-06-11 Bayer CropScience AG Substituted bicyclic and tricyclic pent-2-en-4-inic acid derivatives and their use for enhancing the stress tolerance in plants
EP2740356A1 (en) 2012-12-05 2014-06-11 Bayer CropScience AG Substituted (2Z)-5(1-Hydroxycyclohexyl)pent-2-en-4-inic acid derivatives
AR093909A1 (en) 2012-12-12 2015-06-24 Bayer Cropscience Ag USE OF ACTIVE INGREDIENTS TO CONTROL NEMATODES IN CULTURES RESISTANT TO NEMATODES
AR093996A1 (en) 2012-12-18 2015-07-01 Bayer Cropscience Ag BACTERICIDAL COMBINATIONS AND BINARY FUNGICIDES
WO2014095677A1 (en) 2012-12-19 2014-06-26 Bayer Cropscience Ag Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides
US20160016944A1 (en) 2013-03-07 2016-01-21 Bayer Cropscience Aktiengesellschaft Fungicidal 3--heterocycle derivatives
AU2014247151A1 (en) 2013-04-02 2015-10-08 Bayer Cropscience Nv Targeted genome engineering in eukaryotes
WO2014167009A1 (en) 2013-04-12 2014-10-16 Bayer Cropscience Ag Novel triazole derivatives
US9550752B2 (en) 2013-04-12 2017-01-24 Bayer Cropscience Aktiengesellschaft Triazolinthione derivatives
KR20150144779A (en) 2013-04-19 2015-12-28 바이엘 크롭사이언스 악티엔게젤샤프트 Binary insecticidal or pesticidal mixture
AR095867A1 (en) 2013-04-19 2015-11-18 Bayer Cropscience Ag METHOD FOR IMPROVED USE OF THE POTENTIAL OF PRODUCTION OF TRANSGENIC PLANTS
TW201507722A (en) 2013-04-30 2015-03-01 Bayer Cropscience Ag N-(2-halogen-2-phenethyl)carboxamides as nematicides and endoparasiticides
WO2014177514A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag Nematicidal n-substituted phenethylcarboxamides
EP3013802B1 (en) 2013-06-26 2019-08-14 Bayer Cropscience AG N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives
US20160150782A1 (en) 2013-07-09 2016-06-02 Bayer Cropscience Aktiengesellschaft Use of selected pyridone carboxamides or salts thereof as active substances against abiotic plant stress
CN105873907B (en) 2013-12-05 2019-03-12 拜耳作物科学股份公司 N- naphthenic base-N- { [2- (naphthenic base that 1- replaces) phenyl] methylene }-(thio) carboxamides derivatives
WO2015082586A1 (en) 2013-12-05 2015-06-11 Bayer Cropscience Ag N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
AR101214A1 (en) 2014-07-22 2016-11-30 Bayer Cropscience Ag CIANO-CICLOALQUILPENTA-2,4-DIENOS, CIANO-CICLOALQUILPENT-2-EN-4-INAS, CIANO-HETEROCICLILPENTA-2,4-DIENOS AND CYANO-HETEROCICLILPENT-2-EN-4-INAS REPLACED AS ACTIVE PRINCIPLES PLANTS ABIOTIC
AR103024A1 (en) 2014-12-18 2017-04-12 Bayer Cropscience Ag SELECTED PYRIDONCARBOXAMIDS OR ITS SALTS AS ACTIVE SUBSTANCES AGAINST ABIOTIC PLANTS STRESS
BR112017022000A2 (en) 2015-04-13 2018-07-03 Bayer Cropscience Ag n-cycloalkyl-n- (biheterocyclylethylene) - (thio) carboxamide derivatives.
WO2016205749A1 (en) 2015-06-18 2016-12-22 The Broad Institute Inc. Novel crispr enzymes and systems
BR112019001764A2 (en) 2016-07-29 2019-05-07 Bayer Cropscience Ag combinations of active compounds and methods for plant propagation material protection
US20190281828A1 (en) 2016-09-22 2019-09-19 Bayer Cropscience Aktiengesellschaft Novel triazole derivatives
EP3515907A1 (en) 2016-09-22 2019-07-31 Bayer CropScience Aktiengesellschaft Novel triazole derivatives
US20190225974A1 (en) 2016-09-23 2019-07-25 BASF Agricultural Solutions Seed US LLC Targeted genome optimization in plants
CA3041351A1 (en) 2016-10-26 2018-05-03 Bayer Cropscience Aktiengesellschaft Use of pyraziflumid for controlling sclerotinia spp in seed treatment applications
EP3550973A1 (en) 2016-12-08 2019-10-16 Bayer CropScience Aktiengesellschaft Use of insecticides for controlling wireworms
WO2018108627A1 (en) 2016-12-12 2018-06-21 Bayer Cropscience Aktiengesellschaft Use of substituted indolinylmethyl sulfonamides, or the salts thereof for increasing the stress tolerance of plants
EP3332645A1 (en) 2016-12-12 2018-06-13 Bayer Cropscience AG Use of substituted pyrimidine diones or their salts as agents to combat abiotic plant stress
US11591601B2 (en) 2017-05-05 2023-02-28 The Broad Institute, Inc. Methods for identification and modification of lncRNA associated with target genotypes and phenotypes
WO2019025153A1 (en) 2017-07-31 2019-02-07 Bayer Cropscience Aktiengesellschaft Use of substituted n-sulfonyl-n'-aryl diaminoalkanes and n-sulfonyl-n'-heteroaryl diaminoalkanes or salts thereof for increasing the stress tolerance in plants
CA3073848A1 (en) 2017-09-21 2019-03-28 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
US10968257B2 (en) 2018-04-03 2021-04-06 The Broad Institute, Inc. Target recognition motifs and uses thereof
JP2021525774A (en) 2018-06-04 2021-09-27 バイエル アクチェンゲゼルシャフトＢａｙｅｒ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ Herbicidal active bicyclic benzoylpyrazole
EP3898958A1 (en) 2018-12-17 2021-10-27 The Broad Institute, Inc. Crispr-associated transposase systems and methods of use thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HU229777B1 (en) * 1995-09-19 2014-07-28 Bayer Cropscience Ag Plants which synthesise a modified starch, process for the production thereof and modified starch
DE19653176A1 (en) * 1996-12-19 1998-06-25 Planttec Biotechnologie Gmbh New maize nucleic acid molecules and their use to produce a modified starch
WO1999053072A1 (en) * 1998-04-09 1999-10-21 E.I. Du Pont De Nemours And Company Starch r1 phosphorylation protein homologs
JP2002529094A (en) * 1998-11-09 2002-09-10 プランテック バイオテクノロジー ゲーエムベーハー Rice-derived nucleic acid molecule and its use for the production of modified starch
DE19926771A1 (en) * 1999-06-11 2000-12-14 Aventis Cropscience Gmbh Nucleic acid molecules from wheat, transgenic plant cells and plants and their use for the production of modified starch

Also Published As

Publication number Publication date
US6462256B1 (en) 2002-10-08
AR024318A1 (en) 2002-09-25
JP2003502049A (en) 2003-01-21
AU781687B2 (en) 2005-06-09
CA2370405A1 (en) 2000-12-21
AU5810700A (en) 2001-01-02
CA2370405C (en) 2013-05-21
EP1185678A2 (en) 2002-03-13
WO2000077229A2 (en) 2000-12-21
US7122727B2 (en) 2006-10-17
BR0011499A (en) 2002-03-19
US20030077805A1 (en) 2003-04-24
WO2000077229A3 (en) 2001-05-31
DE19926771A1 (en) 2000-12-14

Similar Documents

Publication Publication Date Title
CN1402789A (en) Nucleic acid molecules from wheat, transgenic plant cells and plants, and use thereof for production of modified starch
CN1324408A (en) Nucleic acid molecules from rice and their use for the prodn. of modified starch
CN1309834C (en) Transgenic plants with modified activity of plastidial ADP/ATP translocator
CN1257978C (en) Nucleic acid molecules encoding enzymes from wheat which are involved in starch synthesis
CN1378600A (en) Nucleic acid molecules derived from plants whihc code for enzymes which are involved in synthesis of starch
CN1930296A (en) Plants with increased activity of a starch phosphorylating enzyme
CN1355840A (en) Genetically modified plant cells and plants with increased activity of amylosucrease protein and branching enzyme
CN1195861C (en) Encapsulation of polypeptides within starch matrix
CN1316003A (en) Nucleic acid module coding for alpha glucosidase, plants that synthesize modified starch, method for production and use of said plants, and modified starch
CN1253584A (en) Chimeric genes and methods for increasing lysine content of seeds of plants
CN1172416A (en) Enhanced carotenoid accumulation in storge organs of genetically engineered plants
CN1032030A (en) 5-enol pyruvoyl-3-phosphoric acid shikimic acid synthase with glyphosate-tolerant
CN1246461C (en) Method for compositions for modifying levels of secondary metabolic compounds in plants
CN1309699A (en) Phytase variants
CN1251136A (en) Plant with modified growth
CN1624135A (en) DNA encoding a plant deoxyhypusine synthase, a plant eukaryotic initiation factor 5a, transgenic plants and a method for controlling senescence programmed and cell death in plants
CN1753992A (en) Plant with reduced protein content in seed, method of constructing the same and method of using the same
CN1930293A (en) Transgenic plants with reduced level of saturated fatty acid and methods for making them
CN1127016A (en) Method of improving the quality of stored potatoes
CN101080492A (en) Methods for the modulation of oleosin expression in plants
CN1252097A (en) Selection for transgenic plants
CN1313616C (en) Transgenic cells expressing glucosyltransferase nucleic acids
CN1842601A (en) Enhancing accumulation of heterologous polypeptides in plant seeds through targeted suppression of endogenous storage proteins
CN1358230A (en) Promoter
CN1240837C (en) Modification of plant fibres

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication