CN116162555A - Engineering bacterium for producing citric acid and construction method and application thereof - Google Patents

Engineering bacterium for producing citric acid and construction method and application thereof Download PDF

Info

Publication number
CN116162555A
CN116162555A CN202111407487.1A CN202111407487A CN116162555A CN 116162555 A CN116162555 A CN 116162555A CN 202111407487 A CN202111407487 A CN 202111407487A CN 116162555 A CN116162555 A CN 116162555A
Authority
CN
China
Prior art keywords
polypeptide
citric acid
endogenous
seq
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111407487.1A
Other languages
Chinese (zh)
Inventor
郑平
郑小梅
孙际宾
陈美玲
周文娟
卢玉丹
马延和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN202111407487.1A priority Critical patent/CN116162555A/en
Publication of CN116162555A publication Critical patent/CN116162555A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/38—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Aspergillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/48—Tricarboxylic acids, e.g. citric acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11011—Protein-serine/threonine kinases (2.7.11) cAMP-dependent protein kinase (2.7.11.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01098—Histone deacetylase (3.5.1.98), i.e. sirtuin deacetylase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses engineering bacteria for producing citric acid, a construction method thereof and a method for producing citric acid by using the strain. The citric acid yield of the engineering bacteria constructed by the invention is improved, so that the production cost can be reduced. Further, the activity of the citric acid transporter is enhanced in engineering bacteria, and the yield of citric acid can be further improved.

Description

Engineering bacterium for producing citric acid and construction method and application thereof
Technical Field
The invention relates to the technical field of bioengineering and genetic engineering, in particular to a construction method and application of engineering bacteria for producing citric acid and a method for producing citric acid.
Background
Citric acid is an important organic acid, is a natural preservative and food additive, and is widely applied to industries, foods and cosmetics. Mainly produced by microbial fermentation, and the main production strains thereof comprise yeast and aspergillus niger. Aspergillus niger is the most competitive industrial strain in the citric acid industry, producing citric acid in global annual yields of 200 ten thousand tons with yields exceeding $20 hundred million, and increasing at a rate of 5% per year.
Because of the great difficulty of genetic transformation of aspergillus niger, early researches have mainly focused on optimization of fermentation processes to improve the yield of aspergillus niger, such as continuous optimization of fermentation conditions of carbon source, nitrogen source, pH and the like. In recent years, with the development of metabolic engineering and the continuous development of genetic manipulation tools for aspergillus niger, reports of improving the yield of citric acid through genetic engineering also appear successively, and targets for engineering include increasing the supply of acetyl-coa as a substrate thereof, increasing the excretion of citric acid, increasing respiratory chain regulation and the like. These genetic alterations increase the yield of A.niger citric acid to varying degrees.
However, along with the increasing demand of the global market for citric acid, how to find new transformation targets, and how to construct efficient aspergillus niger engineering bacteria to improve the yield of citric acid and further reduce the production cost are problems to be solved in the field.
Disclosure of Invention
The invention aims to provide engineering bacteria for producing citric acid, a construction method of the bacteria and a method for producing citric acid by using the bacteria.
In a first aspect, the invention provides An engineered bacterium for citric acid production, said strain being modified such that An endogenous active polypeptide is inactivated, wherein said endogenous active polypeptide is An a 01g02600, an01g10200, an02g01210, an02g05870, an02g08630, an02g14400, an05g00280, an07g04000, an08g03270, an08g05190, an09g06580, an13g 00140 or An15g00910, or a homologous gene thereof, corresponding to the aspergillus niger CBS513.88 genome; preferably, the endogenous active polypeptide comprises any of (a) - (b):
(a) Comprising SEQ ID NO:1 to SEQ ID NO:5, and a polypeptide having the amino acid sequence shown in any one of the above.
(b) And SEQ ID NO:1 to SEQ ID NO:5 above 98% and is derived from an endogenous active polypeptide of aspergillus niger.
Preferably, inactivation of the endogenous polypeptide refers to a decrease or disappearance of the activity of the polypeptide or a decrease or disappearance of the expression level of the gene encoding the polypeptide. Still further, inactivation of the endogenous polypeptide may be accomplished by one or a combination of the following methods: partial or complete knockout of the gene encoding the polypeptide; mutation of the coding gene; altering the promoter, translational regulatory region or coding region codon of the coding gene to attenuate transcription or translation; altering the coding gene sequence to make its mRNA stability weakened or make the structure of coded protein unstable; or any other means of inactivating the coding region of the gene by modifying the region adjacent to the region upstream and downstream thereof.
In preferred embodiments, the gene coding sequence is subjected to frameshift mutations, missense mutations, deletions, start codon changes, and the like.
Further preferably, a reduced activity of an endogenous active polypeptide in said strain relative to an unmodified endogenous active polypeptide means that transcription, expression of a gene encoding said endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, such as by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent.
Preferably, the engineered bacteria producing citric acid have an increase in citric acid yield of at least 10%, preferably an increase of at least 20%, more preferably an increase of at least 30% compared to a wild type strain comprising the endogenous polypeptide.
Furthermore, the activity of the citrate transporter CexA in the engineering bacteria for producing the citric acid is enhanced.
Preferably, the citrate transporter is a polypeptide with an amino acid sequence shown as SEQ ID NO. 6.
Alternatively, the engineering bacteria for producing citric acid include, but are not limited to, any one of Aspergillus niger (Aspergillus niger), aspergillus nidulans (Aspergillus nidulans), aspergillus oryzae (Aspergillus oryzae), penicillium chrysogenum (Penicillium chrysogenum), trichoderma reesei (Trichoderma reesei), semen Maydis (Ustilago maydis), myceliophthora thermophila (Myceliophthora thermophila), and the like, preferably Aspergillus niger, aspergillus nidulans, aspergillus oryzae, trichoderma reesei, and most preferably Aspergillus niger.
In a specific embodiment of the invention, the endogenous active polypeptide is a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs 1-5.
In a second aspect, the invention provides a method of constructing an engineered bacterium for citric acid production, the method comprising modifying a wild-type strain comprising an endogenous polypeptide to inactivate the endogenous polypeptide of the wild-type strain, wherein the endogenous active polypeptide comprises any one of (a) - (b):
(a) Comprising SEQ ID NO:1 to SEQ ID NO:5, and a polypeptide having the amino acid sequence shown in any one of the above.
(b) And SEQ ID NO:1 to SEQ ID NO:5 above 98% or above 99% and is derived from an endogenous active polypeptide of a. Niger.
Preferably, inactivation of the endogenous polypeptide refers to a decrease or disappearance of the activity of the polypeptide or a decrease or disappearance of the expression level of the gene encoding the polypeptide. Still further, inactivation of the endogenous polypeptide may be accomplished by one or a combination of the following methods: partial or complete knockout of the gene encoding the polypeptide; mutation of the coding gene; altering the promoter, translational regulatory region or coding region codon of the coding gene to attenuate transcription or translation; altering the coding gene sequence to make its mRNA stability weakened or make the structure of coded protein unstable; or any other means of inactivating the coding region of the gene by modifying the region adjacent to the region upstream and downstream thereof.
In preferred embodiments, the gene coding sequence is subjected to frameshift mutations, missense mutations, deletions, start codon changes, and the like.
Further preferably, a reduced activity of an endogenous active polypeptide in said strain relative to an unmodified endogenous active polypeptide means that transcription, expression of a gene encoding said endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, such as by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent.
Furthermore, the activity of the citrate transporter CexA in the engineering bacteria for producing the citric acid is enhanced.
Preferably, the citrate transporter is a polypeptide with an amino acid sequence shown as SEQ ID NO. 6.
Preferably, the engineering bacteria for producing citric acid include, but are not limited to, any one of Aspergillus niger (Aspergillus niger), aspergillus nidulans (Aspergillus nidulans), aspergillus oryzae (Aspergillus oryzae), penicillium chrysogenum (Penicillium chrysogenum), trichoderma reesei (Trichoderma reesei), semen Maydis (Ustilago maydis), myceliophthora thermophila (Myceliophthora thermophila), and the like, preferably Aspergillus niger, aspergillus nidulans, aspergillus oryzae, trichoderma reesei, and most preferably Aspergillus niger.
In a third aspect, the present invention provides a method of producing citric acid, the method comprising the steps of:
(1) Culturing the citric acid producing strain of the first aspect, or the citric acid producing strain constructed of the second aspect, to produce citric acid; optionally, further comprising:
(2) Separating the citric acid from step (1).
In a fourth aspect, the present invention provides a citric acid producing strain of the first aspect, the use of a citric acid producing strain constructed of the second aspect in the production of citric acid.
Compared with wild type bacteria, the engineering bacteria constructed by the invention have the advantages that the citric acid yield is obviously improved, so that the production cost can be reduced, and the engineering bacteria have practical significance.
Detailed Description
The inventor of the present invention has conducted extensive and intensive studies and has unexpectedly found that inactivation of 5 endogenous polypeptides can increase the yield of citric acid from Aspergillus niger, and significantly increase the acid production level of the strain, thereby completing the present invention.
Definition of terms
The invention uses "endogenous active polypeptide" or "endogenous polypeptide", concretely speaking, refers to 5 proteins with unknown functions, and the invention respectively presumes that Protein Kinase (PKH), cAMP activated protein kinase (SIP), ubiquitin protease cofactor (BRE), protein kinase (SWE) involved in cell division regulation and subunit (CTI) of histone deacetylase complex have amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO: 5.
As used herein, "citrate transporter" or "CexA" refers to an efflux protein capable of transporting intracellular citrate to the outside of the cell. Specifically, the citric acid efflux protein has the amino acid sequence shown in SEQ ID NO. 6, or the derivative protein or polypeptide which is formed by substituting, deleting or adding one or a plurality of amino acid residues in the amino acid sequence shown in SEQ ID NO. 6 and still has the function of the citric acid efflux protein.
The terms "polypeptide", "active polypeptide" and "protein" of the present invention are used interchangeably herein and are polymers of amino acids of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
The term "expression" of the present invention includes any step involving the production of a polypeptide, including, but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
The term "exogenous" as used herein means that a system contains materials that were not originally present. For example, a gene encoding a gene that is not originally present in a strain is introduced into the strain by transformation or the like, and is "exogenous" to the strain.
The term "wild-type/endogenous" as used herein refers to an activity of a polypeptide in a microorganism in an unmodified state, i.e. in a natural state.
In some embodiments, wild-type strains of the invention are strains comprising an endogenous polypeptide, which is a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs 1-5, or a polypeptide having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to any one of SEQ ID NOs 1-5.
In a specific embodiment, the wild-type strain is a. Niger comprising an endogenous polypeptide. As used herein, "genetic modification" refers to any genetic manipulation of wild-type strains, including but not limited to various molecular biological means.
"sequence homology" and "percent identity" as used herein refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides may be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or by deleting nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or by deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.
The term "inactivation of an endogenous polypeptide" as used herein refers to a modification that results in a decrease, attenuation or even complete disappearance of the intracellular activity of a protein in a microorganism as compared to the activity of the protein in its natural state. Including not only effects lower than the original function due to the decrease in the activity of the protein itself, but also the generation of genes that are not expressed, or expression products that are inactive or have reduced activity in spite of the expression. The term "inactivation of an endogenous polypeptide" in the present invention may be accomplished by modification, and also includes, but is not limited to, modification by the following methods: deletion of part or all of the coding gene, frame shift mutation of the gene, attenuation of the transcription or translation strength, or use of a gene or allele which codes for the corresponding enzyme or protein with lower activity, or inactivation of the corresponding gene or enzyme, and optionally a combination of these methods. The reduction of gene expression can be achieved by suitable culture methods or genetic modification (mutation) of the signal structure of gene expression, for example, the signal structure of gene expression is a repressor gene, an active gene, an operator, a promoter, a attenuator, a ribosome binding site, a start codon and a terminator. The terms "deactivated", "reduced or disappeared", "reduced" according to the invention are interchangeable.
The "engineering bacteria for producing citric acid" according to the present invention has a meaning generally understood by those skilled in the art, and means engineering bacteria which can produce citric acid and can accumulate citric acid when cultured in a medium, or can secrete citric acid into the medium, that is, can obtain extracellular free citric acid. The citric acid producing strain of the present invention may be any of eukaryotic cells including, but not limited to, aspergillus niger (Aspergillus niger), aspergillus nidulans (Aspergillus nidulans), aspergillus oryzae (Aspergillus oryzae), penicillium chrysogenum (Penicillium chrysogenum), trichoderma reesei (Trichoderma reesei), aspergillus niger (Ustilago maydis), myceliophthora thermophila (Myceliophthora thermophila), etc., preferably Aspergillus niger, aspergillus nidulans, aspergillus oryzae, trichoderma reesei, most preferably Aspergillus niger, and citric acid producing mutants or strains prepared from the above strains.
The term "transformation" according to the invention has the meaning generally understood by the person skilled in the art, i.e.the process of introducing exogenous DNA into a host. The transformation method includes any method of introducing nucleic acid into cells, including but not limited to electroporation, calcium phosphate (CaPO) 4 ) Precipitation method, calcium chloride (CaCl) 2 ) Precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposome, and lithium acetate-DMSO.
In the present invention, the culture of the strain may be performed according to a conventional method in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture, fed-batch culture, etc., and various culture conditions such as temperature, time, pH of the medium, etc., may be appropriately adjusted according to the actual situation.
The terms "comprising," "having," "including," or "containing," as used herein, are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
As used herein, "about" means: one value includes the standard deviation of the error of the device or method used to determine the value.
As used herein, the term "or" is defined as only alternatives and "and/or" but, unless expressly indicated otherwise as only alternatives or as mutually exclusive between alternatives, the term "or" in the claims means "and/or".
Compared with wild strains, the genetically modified engineering bacteria of the aspergillus niger citric acid have the advantages that the citric acid yield is obviously improved, the production cost of the citric acid can be further reduced, a new thought is provided for the genetic modification of the aspergillus niger, and the engineering bacteria have better industrial application potential.
The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention.
Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, fourth edition) or as recommended by the manufacturer.
Examples
Example 1 construction of expression plasmid for sgRNA of endogenous polypeptide encoding Gene
Genome data of Aspergillus niger M202 strain (purchased from Shanghai institute of technology, inc. resource pool, published accession number M202) was mined using a co-expression network analysis of Aspergillus niger (Schape, P., kwon, M.J., baumann, B., jung, S., lenz, S., nitsche, B., paege, N., schutze, T., cairns, T.C., meyer, V.2019, update genome annotation for the microbial cell factory Aspergillus niger using gene co-expression networks Res,47 (2), 559-569), and the homologous genes of the 13 genes in Aspergillus niger CBS513.88 genome were An01g02600, an01g0, an02g01210, an02g05 08630, an02g1440, an02g14400, an02g 85808, an 35 g 0008 and An 35 g 0008, respectively. In order to verify the functions of these genes, 5 genes are preferred in this example by changing spore morphology and the like, careful gene function prediction is performed, the protein shown in SEQ ID NO. 1 is predicted to be a putative Protein Kinase (PKH), the protein shown in SEQ ID NO. 2 is predicted to be a cAMP activated protein kinase (SIP), the protein shown in SEQ ID NO. 3 is predicted to be a ubiquitin protease cofactor (BRE), the protein shown in SEQ ID NO. 4 is predicted to be a protein kinase (SWE) involved in regulation of cell division, and the protein shown in SEQ ID NO. 5 is predicted to be a subunit (CTI) of a histone deacetylase complex, and specific amino acid sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, respectively.
The genome of Aspergillus niger M202 is used as a template, an upstream primer and a downstream primer constructed by an sgRNA expression cassette are designed, 5S rRNA of Aspergillus niger itself is used as a promoter, and a GoldenGate method is adopted to construct an expression plasmid of the sgRNA. The Golden Gate reaction product is transformed into escherichia coli Trans-T1, after corresponding recombinant plasmids are extracted, enzyme digestion and sequencing verification are adopted, and expression plasmids pPKH-sgRNA1, pPKH-sgRNA2, pSIP-sgRNA1, pSIP-sgRNA2, pBRE-sgRNA1, pBRE-sgRNA2, pSWE-sgRNA1, pSWE-sgRNA2, pCTI-sgRNA1 and pCTI-sgRNA2 of each protein sgRNA are obtained. The specific primer sequences are shown in Table 1.
TABLE 1 primers for construction of sgRNA expression plasmids
Figure BDA0003373268350000081
EXAMPLE 2 construction of endogenous polypeptide-inactivating strains
Cas9 protein expression vector pCas9 (see Zhang L, et al dis-ruption or reduced express ion of the orotidine-5' -decarboxylase gene pyrG increases citric acid product ion: a new discovery during recyclable genome editing in Aspergillus niger. M micro Cell face. 2020Mar24; 19 (1): 76), sgRNA expression cassette fragment and donor DNA fragment were co-transformed into protoplast cells of A.niger M202 to construct each gene inactivated strain. The specific operation is as follows:
(1) Preparation of sgRNA expression cassette fragments
PCR amplification was performed using 5S-Fm (SEQ ID NO: 27:GGTTGGAGATTCCAGACTAG) and sgRNA-Rm (SEQ ID NO:28:A AAAAAGCACCGACTCGGTGCCAC) as primers, respectively, using the sgRNA expression plasmid constructed in example 1 as a template, to obtain the sgRNA expression cassette fragments PKH-sgRNA1/PKH-sgRNA2, SI P-sgRNA1/SIP-sgRNA2, BRE-sgRNA1/BRE-sgRNA2, SWE-sgRNA1/SWE-sgRNA2 and CTI-sgRNA1/CTI-sgRNA2, respectively, for each gene knockout.
The PCR reaction was carried out in the form of 5 XFastpfu buffer 10. Mu.L, 10mM dNTPs 1. Mu.L, 2.5. Mu.L each of the upstream/downstream primers, 0.5. Mu.L of the DNA template, fastPfu (TransGene) 1.5.5. Mu.L, and 32. Mu.L of ultrapure water.
The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 45sec,35 cycles; finally, the extension is carried out for 10min at 72 ℃. The PCR products were purified and PEG-mediated protoplast transformation was performed.
(2) Preparation of donor DNA fragments
Preparation of donor DNA fragments was accomplished by one-step PCR, designing the upstream and downstream primers containing 5 homology arms, respectively, and carrying out PCR amplification using plasmids pSilent-1 (see Nakayashiki H, hanada S, quoc NB, kadotani N, tosa Y, mayama S.RNA silencing as a tool for exploring gene function in asco mycete fungi.Fungal Genet biol.2005; 42:275-83) as templates to obtain donor DNA fragments for 5 gene knockouts, which were designated as MH-PKH-sgRNA1/PKH-sgRNA2, MH-SIP-sgRN A1/SIP-sgRNA2, MH-BRE-sgRNA1/BRE-sgRNA2, MH-SWE-sgRNA1/SWE-sgRNA2 and MH-CTI-sgRNA 1/CTI-sgRNA2, respectively. The PCR reaction system and the reaction conditions are the same as above, and the related primer sequences are shown in Table 2.
TABLE 2 primers used for preparation of donor DNA
Figure BDA0003373268350000091
Figure BDA0003373268350000101
(3) PEG-mediated protoplast transformation
Preparation of a suspension of protoplasts of Aspergillus niger M202 is described in patent CN112250740A. 100. Mu.L of the protoplast suspension, 2. Mu.g of pCas9, 2. Mu.g of the sgRNA expression cassette fragment and 2. Mu.g of donor DNA were taken, 1mL of solution C (Tris-HCl 10mM, caCl 2.54 g/L, PEG6000 50% (w/v), pH 7.5) was added to it, ice-washed for 10min,2mL of solution B and mixed well. Uniformly mixing with the preheated upper layer culture medium MMSH containing hygromycin, and then spreading on a lower layer culture medium MMSH flat plate. The plates were incubated in a 30℃incubator for 3-5 days until transformants developed.
(4) Genotyping of genetically inactivated strains
Extracting genome DNA of the transformant after secondary passage and purification by adopting a novel plant genome extraction kit DP350 of the plant, and then carrying out gene PCR verification on the transformant by using the extracted genome DNA as a template and using genome up-and-down verification primers of each gene. The specific sequences of the primers are shown in Table 3.
Table 3 verification primers for Gene-inactivated strains
Figure BDA0003373268350000102
Figure BDA0003373268350000111
The PCR reaction system and the PCR reaction conditions are the same as above. And (3) carrying out 1% agarose gel electrophoresis (150V voltage, 20 minutes) on the PCR amplified products, observing gene amplified bands under a gel imaging system, and carrying out sequencing verification on each PCR product to finally obtain 5 strains with predicted protein coding gene knockouts, which are named AndPKH, andSIP, andBRE, andSWE and AndCTI respectively.
EXAMPLE 3 citric acid fermentation of polypeptide-inactivating strains
Each of the gene-inactivated strain AndPKH, andSIP, andBRE, andSWE, andCTI and the control strain M202 was inoculated onto PDA medium at 30℃for 5 days, and spores were collected with 0.9% physiological saline and counted using a hemocytometer. At 10 6 The inoculated amount per mL was inoculated into a citric acid fermentation medium (see patent CN 112250740B), and the culture was carried out at 34℃and 250r/min for 96 hours.
The fermentation supernatant was collected by rapid suction filtration, diluted 10-fold, boiled for 10min, filtered with a filter membrane and tested for citric acid content by HPLC. For specific detection conditions, refer to patent CN112250740a. As a result, the inactivation of each gene can obviously promote the production of citric acid, and compared with the original strain, the citric acid fermentation level of the engineering bacteria inactivated by each endogenous polypeptide is increased to 1.1-1.4 times.
EXAMPLE 4 polypeptide inactivation and enhanced citric acid excretion to increase citric acid fermentation levels
The over-expression plasmid pGm-CexA of the citrate efflux protein (see patent CN 112250740A) was transformed into A.niger strain M202 by the method of example 2 to obtain the over-expression strain AnCex of the citrate efflux protein. Then, 5 genes in the citric acid high-yield strain AnCex are knocked out respectively by adopting the method of the embodiment 1-3, and an inactivated strain AnCdPKH, anCdSIP, anCdBRE, anCdSWE and AnCdCTI are obtained. The method in example 3 is adopted to carry out fermentation verification on the strain, and meanwhile, the strain AnCex is used as a control, so that the inactivation of the gene can further promote the production of citric acid on the basis of strengthening the discharge of citric acid, and compared with the original strain, the fermentation level of citric acid is increased to 2.05-2.5 times.
In addition, by adopting the method of the embodiment 1-3, the invention constructs the single knockout engineering bacteria of other 8 endogenous polypeptide coding genes (homologous genes are An01g02600, an02g01210, an02g05870, an02g14400, an07g04000, an08g03270, an08g05190 and An13g 00140 respectively), and compared with the original strain, the citric acid fermentation level of the single knockout engineering bacteria can be improved by more than 5 percent, which indicates that the knockout of the 8 genes has positive influence on the yield of citric acid.
<110> institute of Tianjin Industrial biotechnology, national academy of sciences
<120> engineering bacterium for producing citric acid, construction method and application thereof
<130> China
<160> 48
<170>PatentIn version 3.5
<210> 1
<211>841
<212> PRT
<213>Aspergillus niger
<400> 1
MDGDLSLSQSLGGLRIANPDDSSLHSSEDAATTPAASAADVTEAELVREPTIISERPASSLSITPPRPSASPSTTDLQDTLTSASVEPAVKPRDNRSSLYNPYSDLPQQTSPQYTPYASSSQSHPAPQSSRPMSAFYANGSTSTLAAAREGSYRIRTDSAASSASESQARAESRGGSAAFQAGVPVRDSNHNDRSYRTAQLPPTNGPMIMRQTSRAHARGGAAPQMGGSPYAMENGPGASSEDWQDRGAAVAVRQEIDANGKPVARYIKKGVRDFSFAHTLGEGSYSTVVLGTDRQTLKEYAIKILDKRHIIKEKKVKYVNIEKDTLNRLTEHPGIVRLYYTFQDERSLYFVLDLCKGGELLGVLKRMTTFDEECTRFYGAQILDTIDYMHKRGVIHRDLKPENVLLDSQMHIKITDFGTAKILKSQRKPQNSSGMPPLDATDIPEEERASSFVGTAEYVSPELLTDKNACKASDLWAFGCIIFQLLAGRPPFKAGNEYQTFQKIVALDYDFPAGFPAVARDLVERLLVLDPARRLPIEHIKNHEFFQGIAWGPDLWKRKAPRLKAYVPPPREPIKLNGGGGEGYASSANPAASSTNVSSRVVPRLVTELPPPSQLDIEWSPVLTKTNERILKLGNLVVLSSPAAHSPVSKHGGEYEAPRKFSRFFGGSTTKKRQRLVMVTSSGRIIMAASGGDEKKAKLELSLLTPGTSYRTSTDSKGFSCWVVDTRDKHFVFEDPKPSSSNVGATAISAQEWLDSLDRAREMALSQQGNGSYSDDAFRDLSSGLSSHANTLDRSSEIQNESAPAGRATLVKHQNTDTESVKGKKRFSRRHSKNGLAAVF 841
<210>2
<211>458
<212> PRT
<213>Aspergillus niger
<400>2
MGNNPSKPPAGDAQSPSAPSAAAGDKKVARRSSIHTPSGTTKASAADPSATRETATGHPTSQAQPSVQQRLQSRNVTDLPTRNLDRPDRQVPKKPDTRSKDIPAPDPSNPVQVPGSRAAAKRDPVAPSGPPPHAYYSASVHLQRPPRMPLPIGDATATPGSPIIGPEDSYMGSVAPDHLLDEHHQSRQSAVSGATVDDDEALDELQPYTPSGVGRAVPTLIEWTAPGDKVYVTGTFVNWEKKFRLHRSENNPGVLSTRLNLRPGTHHLKFIVDGEMRASDNLPTAVDFTNHLVNYIEISADDVNRSRRESDKVPDGVRPPQVIPGPVGNDQVGSTVEEQSDREEPEEIPLGDFRGVIPQFLLDLDREEETPEYQQAVNIVGDAPTPPSLPLFLGKSILNGTTPMKDDSSVLNYPNHTVLNHLATSSIKNGVLATSVTTRYKRKYVTTILYKPTGDITD 458
<210>3
<211>537
<212> PRT
<213>Aspergillus niger
<400>3
MADTTQAPINGGYPAQHAYPDSFTHAPANVNSAASFQPAPSSTPSNAPANDQKNGISKDEVGWYFVEQYYTNMSRSPEKLHLFYSRRSQLVFGTEAETVQVAVGQKAINDKIKQLDFQDCKVRVLNVDSQASFDNILISVIGEISNRSEPSRKFVQTFVLAEQPNGYYVLNDIFRYLVDEEEEIEQEEAAPAAAPAAPAAPVEEPAAEEPAQPEAETVPEPEKAQVDSEPAAAQVDEKLEEAEQTAEAKPAKEDAPQTNGTAAQETPVEAAPEAAAPVETEAPKAEKPATPEPTPVPEQKEAPAPVKESAPARAVPKTWATIASKSGASAPVVPAVPVAPVKPAPAASSAQPTAPAPAPAAAPAPAAAAAPEAASSQPSSTDGSGWQTAGHDHKKTQSRAGEENVLAYIKNVTEKVDASLLKQTLSRFGKLKHFDVSRAKNCAFVEFGDAAGYAAAVAANPHQIGTEQIYVEERRPRTNAFGNGSYGAGRGGAGRGRGDRAGSQGRGGFQREGRGGFAPRGRGGNVNAKGRNQAQTA 537
<210>4
<211>1063
<212> PRT
<213>Aspergillus niger
<400>4
MVATFSPHRDAGGTLHLPSHTGIHHMDANSAIRQLRRSLSRSPSKSSNFSLLASRGHSPSKTAPYISSPLSPSRRSTQSNFVLFPSSSHQSPFAVPYHPSGKITRPTMRRVRTSPRSPVKRALNVSTDQGNAKPAPSVPTTPGVENTPSTPGLVQPDNAARDIFPSDTPACAESTLGPRPALSRIEKRRSGTFGSYATVSPLKRSDGIMNLDRVSRGSPSAKRRSVQAASLSGEFSIFDNEVTPNNAEEPEVEAFPESTTPSFPPPITPFSPFATIPKRSSSLRRSTLQQRQSDRSLFARAKAMDDSPDALDNGTPLSVRPRMSLDQNLFQPNRDSPFLSRPSPGTPLFASTGNNAEQPRPSAHPLSRTITQSSSSSSLGDDSPTHEPVHKGDRPRGIINFSKSLPAGTARPAPLRHLNREDSTSSVDSFATPENYKLVKPLPAAFMSTGLISKKNRNADDPQNTLGFSKNMPDTPCKRPINLFPTGGRIQPERPLEMSGLVRQSDTIPPSPFNPSSTRPKSGPFARGMGIFGSSFNRPEVSRRGSFASIDGDDLLPSQSPCGRNSQPLSENDFPPTPTKQSFFPSRTYPPPVSQIASLERLAEAKGTNSSPLHDRFLRGSPRTPQDHLFPDPSGLSISNEQQSGQPDFNSSNLPATPTGPRDSFQSGKRPSLPLAGYHAPDVDPSLTSRFERVELVGTGEFSQVYRVSEPHDTSISTYPSEMFPPKVLPEQVWAVKKSKQPYSGLKDRERRIREVDILKSLTNADHIISFMNSWEDSGHLYIQTEFCEEGSLDVFLAQVGLKARLDDFRIWKIMLELSMGLKHIHDMGFIHLDLKPANILITFEGVLKIADFGMAARWPAEDGIEGEGDREYIGPEILMGRYDKPADIFSLGLIMFEIAGNVELPDNGLSWQKLRNGDMSDIPSLTWSFETSVFRDASGNPISEEPSFEELCTSDFGEDDYGTDSFLGGRTSKRDMTSTARIGELVDPPSFMVDAGHEQALDKIVRWMISPEPLDRPTADQVLETYGVQFVARRRRAGATVYEGNWGPADEVLAEDAEMIDV 1063
<210>5
<211>767
<212> PRT
<213>Aspergillus niger
<400>5
MMLTEPSFSFSFSYPNGEPQTPTRTPPTTTIFGDSAFQTPKLESSFFDPRVTWDTSDPYASSPEFLRTPQKFGLSTPSINPLRLPDTAPDRPTDTEDNSRNGKAAEQDTDTAKRRRPSRPHGHVGDDGPRTVDSAKSAATIQTPPPSSASRKKVTGLDEATGTGRRPSASSMVGGHLETPSRLLGASPRLFGDLQSSPDPFQLGAIDSAASTFFPQQRLFWDHDFNQHESNMGLSASNNLDLFDLHANDSFHVNHTTAPDSHIPQLPIIEGNTDLPDFNSSTYNLSSGVTTTDAALFPAPFSTSPRRPITKAEDPALFLSSPARRFGGLQPTPEKRLFSRPTRQPYHHQTEESKREELRRARSVNHHIPVYEDDDDDDYTPRQMRPALTRSLTHSAIAGSASRSASGCMMASNGIRKSPSKGRSSPIKPIRHQLSRANSVAASLPRRSQSVVLKIGKDGRAKAEMQPVPEASTGLTDPLTGMDLDGSTTESEYDSVDYCEYPLVPSRNPSFAFSDASGATIARSDCGSRPHSKGSYTSTAASSSGRASPWADAGRGPSRRPQYKPTLDDWKRTPKKQLTTLHSDLSYLSAGSLGEPFADPEDDSGDAQHALRKVLQERGRIPRPHTVSYGSRISRSARSLAHLRSSPPRFGAELDLSSRTTNTSPTTMTDPDIATPVTDRFSNPSNGTRCVCNSMDNGGHLMIQCESCSHWLHTKCVGLERANLPSVYVCIFCAQTPTRKNHRVRVPVGAPGHAPTSPLAHKSYRFR 767
<210>6
<211>524
<212> PRT
<213>Aspergillus niger
<400>6
MSSTTSSSRSDLEKVPVPQVIPRDSDSDKGSLSPEPSTLEAQSSEKPPHHIFTRSRKLQMVCIVSLAAIFSPLSSNIYFPALDDVSKSLNISMSLATLTITVYMIVQGLAPSFWGSMSDATGRRPVFIGTFIVYLVANIALAESKNYGELMAFRALQAAGSAATISIGAGVIGDITNSEERGSLVGIFGGVRMLGQGIGPVFGGIFTQYLGYRSIFWFLTIAGGVSLLSILVLLPETLRPIAGNGTVKLNGIHKPFIYTITGQTGVVEGAQPEAKKTKTSWKSVFAPLTFLVEKDVFITLFFGSIVYTVWSMVTSSTTDLFSEVYGLSSLDIGLTFLGNGFGCMSGSYLVGYLMDYNHRLTEREYCEKHGYPAGTRVNLKSHPDFPIEVARMRNTWWVIAIFIVTVALYGVSLRTHLAVPIILQYFIAFCSTGLFTINSALVIDLYPGASASATAVNNLMRCLLGAGGVAIVQPILDALKPDYTFLLLAGITLVMTPLLYVEDRWGPGWRHARERRLKAKANGN 524
<210>7
<211>24
<212>DNA
<213> artificial sequence
<400>7
caccatctctacctccatcatgga 24
<210>8
<211>24
<212>DNA
<213> artificial sequence
<400>8
aaactccatgatggaggtagagat 24
<210>9
<211>24
<212>DNA
<213> artificial sequence
<400>9
caccgttctggtgcttaaccagtg 24
<210>10
<211>24
<212>DNA
<213> artificial sequence
<400>10
aaaccactggttaagcaccagaac 24
<210>11
<211>24
<212>DNA
<213> artificial sequence
<400>11
caccatcctacaagcgccttccac 24
<210>12
<211>24
<212>DNA
<213> artificial sequence
<400>12
aaacgtggaaggcgcttgtaggat 24
<210>13
<211>24
<212>DNA
<213> artificial sequence
<400>13
cacctctgtgagtccgtgacaaag 24
<210>14
<211>24
<212>DNA
<213> artificial sequence
<400>14
aaacctttgtcacggactcacaga 24
<210>15
<211>24
<212>DNA
<213> artificial sequence
<400>15
caccatacgaggctaggcttgatg 24
<210>16
<211>24
<212>DNA
<213> artificial sequence
<400>16
aaaccatcaagcctagcctcgtat 24
<210>17
<211>24
<212>DNA
<213> artificial sequence
<400>17
cacccgtaccaatgccttcggtaa 24
<210>18
<211>24
<212>DNA
<213> artificial sequence
<400>18
aaacttaccgaaggcattggtacg 24
<210>19
<211>24
<212>DNA
<213> artificial sequence
<400>19
cacccggtctcatcttaccagatt 24
<210>20
<211>24
<212>DNA
<213> artificial sequence
<400>20
aaacaatctggtaagatgagaccg 24
<210>21
<211>24
<212>DNA
<213> artificial sequence
<400>21
cacctgtcggtctagccagtgaca 24
<210>22
<211>24
<212>DNA
<213> artificial sequence
<400>22
aaactgtcactggctagaccgaca 24
<210>23
<211>24
<212>DNA
<213> artificial sequence
<400>23
caccttcctgctcactcctgttga 24
<210>24
<211>24
<212>DNA
<213> artificial sequence
<400>24
aaactcaacaggagtgagcaggaa 24
<210>25
<211>24
<212>DNA
<213> artificial sequence
<400>25
cacctgttgcacactagctatcgc 24
<210>26
<211>24
<212>DNA
<213> artificial sequence
<400>26
aaacgcgatagctagtgtgcaaca 24
<210>27
<211>20
<212>DNA
<213> artificial sequence
<400>27
ggttggagattccagactca 20
<210>28
<211>24
<212>DNA
<213> artificial sequence
<400>28
aaaaaagcaccgactcggtgccac 24
<210>29
<211>57
<212>DNA
<213> artificial sequence
<400>29
cccctccccccccaaaaaggtttggtgtatcaccaaaccccaggaaacagctatgac 57
<210>30
<211>58
<212>DNA
<213> artificial sequence
<400>30
gactgaatcgcttcttgcctttgacggactccgtgtctgttgtaaaacgacggccagt 58
<210>31
<211>57
<212>DNA
<213> artificial sequence
<400>31
ttaatacggcattggacccgcctgactcagttccctttcccaggaaacagctatgac 57
<210>32
<211>58
<212>DNA
<213> artificial sequence
<400>32
gtttgtacaatatcgttgtgacgtactacataccattagttgtaaaacgacggccagt 58
<210>33
<211>57
<212>DNA
<213> artificial sequence
<400>33
tcggggaatatttcttactagatttttttcccttccctcgcaggaaacagctatgac 57
<210>34
<211>58
<212>DNA
<213> artificial sequence
<400>34
cacgaccacgaccggcaccaccgcggcccgcaccgtagcttgtaaaacgacggccagt 58
<210>35
<211>57
<212>DNA
<213> artificial sequence
<400>35
ttttcctagcattccaccgcggtcaacaacaacttccgaccaggaaacagctatgac 57
<210>36
<211>58
<212>DNA
<213> artificial sequence
<400>36
tgccacccgcatcacggtgcggcgaaaatgtcgcgaccattgtaaaacgacggccagt 58
<210>37
<211>57
<212>DNA
<213> artificial sequence
<400>37
tggtctccttttttcactttttcctgctcactcctgttgacaggaaacagctatgac 57
<210>38
<211>58
<212>DNA
<213> artificial sequence
<400>38
agctgaagctgaacgagaaagacggctctgtcagcatcattgtaaaacgacggccagt 58
<210>39
<211>21
<212>DNA
<213> artificial sequence
<400>39
ctccttttccttcccagcttc 21
<210>40
<211>23
<212>DNA
<213> artificial sequence
<400>40
ggaaactctcagggatatcaagc 23
<210>41
<211>21
<212>DNA
<213> artificial sequence
<400>41
cccatcgcattctttctcttc 21
<210>42
<211>20
<212>DNA
<213> artificial sequence
<400>42
ggtctcttatcctccagctc 20
<210>43
<211>21
<212>DNA
<213> artificial sequence
<400>43
ccacctttctatctttcattg 21
<210>44
<211>23
<212>DNA
<213> artificial sequence
<400>44
ggaagggctaggaatcatataag 23
<210>45
<211>20
<212>DNA
<213> artificial sequence
<400>45
gccctcatccacacactctt 20
<210>46
<211>20
<212>DNA
<213> artificial sequence
<400>46
ggcgtgtcacttggaaagat 20
<210>47
<211>23
<212>DNA
<213> artificial sequence
<400>47
tttggagcagcctcatttgtcac 23
<210>48
<211>23
<212>DNA
<213> artificial sequence
<400>48
gaattgtcctcagtgtctgtcgg 23

Claims (9)

1. An engineered bacterium that produces citric acid, wherein An endogenous active polypeptide is inactivated, wherein the endogenous active polypeptide is An01g02600, an01g10200, an02g01210, an02g05870, an02g08630, an02g14400, an05g00280, an07g04000, an08g03270, an08g05190, an09g06580, an13g 00140, or An15g00910, or a homologous gene thereof, corresponding to the aspergillus niger CBS513.88 genome;
preferably, the endogenous active polypeptide is any one of (a) - (b):
(a) Comprising SEQ ID NO:1 to SEQ ID NO:5, or a polypeptide having an amino acid sequence as set forth in any one of claims;
(b) And SEQ ID NO:1 to SEQ ID NO:5 above 98% and derived from an endogenous active polypeptide of aspergillus niger;
more preferably, inactivation of the endogenous polypeptide refers to a decrease or disappearance of the activity of the polypeptide, or a decrease or disappearance of the expression level of the gene encoding the polypeptide;
still further, inactivation of the endogenous polypeptide may be accomplished by one or a combination of the following methods: partial or complete knockout of the gene encoding the polypeptide; mutation of the coding gene; altering the promoter, translational regulatory region or coding region codon of the coding gene to attenuate transcription or translation; altering the coding gene sequence to make its mRNA stability weakened or make the structure of coded protein unstable; or any other gene that is inactivated by modification of the coding region of the gene and adjacent upstream and downstream regions thereof;
further preferably, a reduced activity of an endogenous active polypeptide in said strain relative to an unmodified endogenous active polypeptide means that transcription, expression of a gene encoding said endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, such as by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent.
2. The engineered bacterium for producing citric acid of claim 1, wherein SEQ ID NO:1 to SEQ ID NO:5, inactivating a polypeptide having an amino acid sequence set forth in any one of claims; preferably, the citrate production by the citrate producing strain is increased by at least 10%, preferably by at least 20%, more preferably by at least 30% as compared to a wild type strain comprising the endogenous polypeptide.
3. The engineered citric acid producing strain of claim 1 or 2, wherein the activity of a citrate transporter in the production strain is enhanced; preferably, the citrate transporter is a CexA protein with an amino acid sequence shown as SEQ ID NO. 6.
4. An engineered strain for the production of citric acid as claimed in any one of claims 1 to 3, wherein the strain includes but is not limited to aspergillus niger @Aspergilus niger) Aspergillus nidulansAspergillus nidulans) Aspergillus oryzaeAspergillus oryzae) Penicillium chrysogenum (L.) kuntzePenicillium chrysogenum) Trichoderma reesei (Trichoderma reesei)Trichoderma reesei）Semen Maydis black powder fungusUstilago maydis) Myceliophthora thermophila @Myceliophthora thermophila) Any of Aspergillus niger, aspergillus nidulans, aspergillus oryzae, trichoderma reesei are preferred, and Aspergillus niger is most preferred.
5. A method of constructing an engineered bacterium that produces citric acid, the method comprising modifying a wild-type strain comprising an endogenous polypeptide to inactivate the endogenous polypeptide of the wild-type strain, wherein the endogenous active polypeptide comprises any one of (a) - (b):
(a) Comprising SEQ ID NO:1 to SEQ ID NO:5, or a polypeptide having an amino acid sequence as set forth in any one of claims;
(b) And SEQ ID NO:1 to SEQ ID NO:5 above 98% and derived from an endogenous active polypeptide of aspergillus niger;
preferably, inactivation of the endogenous polypeptide refers to a decrease or disappearance of the activity of the polypeptide, or a decrease or disappearance of the expression level of the gene encoding the polypeptide;
still further, inactivation of the endogenous polypeptide may be accomplished by one or a combination of the following methods: partial or complete knockout of the gene encoding the polypeptide; mutation of the coding gene; altering the promoter, translational regulatory region or coding region codon of the coding gene to attenuate transcription or translation; altering the coding gene sequence to make its mRNA stability weakened or make the structure of coded protein unstable; or any other means of inactivating the coding region of the gene by modifying it in its immediate upstream and downstream regions;
further preferably, a reduced activity of an endogenous active polypeptide in said strain relative to an unmodified endogenous active polypeptide means that transcription, expression of a gene encoding said endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, such as by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is completely absent.
6. The method according to claim 5, wherein the method further comprises enhancing the activity of a citrate transporter in the strain; preferably, the citrate transporter is a CexA protein with an amino acid sequence shown as SEQ ID NO. 6.
7. The method for constructing engineering bacteria for producing citric acid according to claim 5 or 6, wherein the citric acid producing strain comprises but is not limited to Aspergillus nigerAspergilus niger) Aspergillus nidulansAspergillus nidulans) Aspergillus oryzaeAspergillus oryzae) Penicillium chrysogenum (L.) kuntzePenicillium chrysogenum) Trichoderma reesei (Trichoderma reesei)Trichoderma reesei) Semen Maydis black powder fungusUstilago maydis) Myceliophthora thermophila @Myceliophthora thermophila) Any of the strains, etc., is preferably Aspergillus niger, aspergillus nidulans, aspergillus oryzae, trichoderma reesei, and most preferably Aspergillus niger.
8. A method of producing citric acid comprising the steps of:
(1) Culturing the engineering bacteria for producing citric acid according to any one of claims 1 to 4 or the engineering bacteria for producing citric acid constructed by the method according to claims 5 to 7 to produce citric acid; optionally, further comprising:
(2) Separating the citric acid from step (1).
9. Use of the engineering bacteria for producing citric acid constructed by the method of any one of claims 1 to 4 or the engineering bacteria for producing citric acid constructed by the method of any one of claims 5 to 7 in producing citric acid.
CN202111407487.1A 2021-11-24 2021-11-24 Engineering bacterium for producing citric acid and construction method and application thereof Pending CN116162555A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111407487.1A CN116162555A (en) 2021-11-24 2021-11-24 Engineering bacterium for producing citric acid and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111407487.1A CN116162555A (en) 2021-11-24 2021-11-24 Engineering bacterium for producing citric acid and construction method and application thereof

Publications (1)

Publication Number Publication Date
CN116162555A true CN116162555A (en) 2023-05-26

Family

ID=86411880

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111407487.1A Pending CN116162555A (en) 2021-11-24 2021-11-24 Engineering bacterium for producing citric acid and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN116162555A (en)

Similar Documents

Publication Publication Date Title
JP5052899B2 (en) Gene expression method
DK2875119T3 (en) AGSE-DEFICIENT TRIALS
EP2565262A1 (en) Protein expression
EP3374377A1 (en) Wap genes and proteins that improve bacillus competitiveness
EP2665812B1 (en) Expression of plant peroxidases in filamentous fungi
Arentshorst et al. A CRISPR/Cas9‐based multicopy integration system for protein production in Aspergillus niger
CN116162555A (en) Engineering bacterium for producing citric acid and construction method and application thereof
CN110592084A (en) Recombinant strain modified by rhtA gene promoter and construction method and application thereof
JP6864308B2 (en) Isoamyl Acetate High Productivity, Acetic Acid Productivity Low Productivity and Isoamyl Alcohol High Productivity Method for Producing Brewed Yeast
CN115725489A (en) Oxidized endotoxin-free escherichia coli genetic engineering strain and construction and application thereof
EP4359423A1 (en) Bacillus licheniformis host cell for production of a compound of interest with increased purity
CN110628802B (en) Sorangium cellulosum for high-yield epothilone D and construction method and application thereof
JP6599583B1 (en) Multigene disrupted Aspergillus microorganism and method for producing the same
US20080299616A1 (en) Malate Synthase Regulatory Sequences for Heterologous Gene Expression in Pichia
CN109715809B (en) Method for selective carbon source independent expression of protein coding sequences in filamentous fungal cells
US20060121564A1 (en) Novel expression vector suitable for expression of recombinant protein at low temperature
CN112105740A (en) Long-chain non-coding RNA expression in fungal hosts
KR20140018850A (en) Compositions and methods of producing enterokinase in yeast
Yamada et al. Cloning and heterologous expression of the antibiotic peptide (ABP) genes from Rhizopus oligosporus NBRC 8631
WO2017163946A1 (en) Induction-type promoter
JP4413557B2 (en) Efficient production of proteins using filamentous fungi
JP6274502B2 (en) Method for obtaining a uracil-requiring strain of Cryptococcus having an increased frequency of homologous recombination
KR102551064B1 (en) Novel U6 promoter separated form grapevine and use of the same
Lou et al. Screening and Functional Verification of Selectable Marker Genes for Cordyceps militaris
KR100687884B1 (en) 1 2 A Method for Mass Production of Recombinant Trypsin by Employing Regulatory Genes sgtR1 and sgtR2 from Streptomyces griseus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination