CN116145266A - Cordyceps militaris P trpc Overlapping promoter library and application thereof - Google Patents

Cordyceps militaris P trpc Overlapping promoter library and application thereof Download PDF

Info

Publication number
CN116145266A
CN116145266A CN202111408176.7A CN202111408176A CN116145266A CN 116145266 A CN116145266 A CN 116145266A CN 202111408176 A CN202111408176 A CN 202111408176A CN 116145266 A CN116145266 A CN 116145266A
Authority
CN
China
Prior art keywords
promoter
trpc
copies
seq
cordyceps militaris
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111408176.7A
Other languages
Chinese (zh)
Inventor
魏韬
吕梦迪
邹苑
周越
曾家鹏
张同宇
林俊芳
郭丽琼
陈瑞萍
梁锦明
陈爱媚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Junyan Biotechnology Co ltd
South China Agricultural University
Original Assignee
Guangzhou Junyan Biotechnology Co ltd
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Junyan Biotechnology Co ltd, South China Agricultural University filed Critical Guangzhou Junyan Biotechnology Co ltd
Priority to CN202111408176.7A priority Critical patent/CN116145266A/en
Publication of CN116145266A publication Critical patent/CN116145266A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01048—Indole-3-glycerol-phosphate synthase (4.1.1.48)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a cordyceps militaris P trpc An overlapping promoter library and application thereof belong to the field of edible fungus synthetic biology. The invention adopts P trpC The promoter with moderate intensity and smaller size (369 bp) constructs P with 1-9 copies respectively by a Biobrick method trpc Overlapping promoters with different promoter strengthsThe promoter library realizes the linear enhancement of the promoter strength along with the increase of the copy number of the promoter, and lays a foundation for quantitatively controlling the expression level proportion of different genes in the cordyceps militaris.

Description

Cordyceps militaris P trpc Overlapping promoter library and application thereof
Technical Field
The invention belongs to the field of edible fungus synthetic biology, in particular relates to a promoter library with different gene expression initiation intensities in cordyceps militaris and a construction method thereof, and in particular relates to 1-9 copies of cordyceps militaris P based on Biobrick method series connection trpc Overlapping promoter libraries.
Background
Cordyceps militaris (Cordyceps militaris) is also called Cordyceps militaris, belongs to Ascomycota (Ascomycota), clavicepitaceae (Clavicipitaceae) and Cordyceps (Cordyceps), and is common edible and medicinal fungi in China. Cordyceps militaris is rich in cordycepin [1] Polysaccharide [2] The composition has anticancer and antitumor effects [3] Bioactive substances with anti-photoaging effect [4,5] And is the only species which can form a large amount of cordycepin in more than 350 cordyceps species reported at present. Natural cordyceps militaris fruiting bodies are difficult to obtain, which are limited in the number of parasitic hosts and special in the growing environment. 80 sFinally, the artificial culture of the cordyceps militaris is successful [6] . After more than 40 years of development, parameters such as culture medium composition, culture conditions and the like are perfected [7,8] Multiple Cordyceps militaris artificial culture techniques such as mycelium fermentation, shaking mycelium fermentation and solid fruiting body culture tend to be mature [9,10] . By 2015, the large-scale factory planting yield of the cordyceps militaris in China reaches 7.4 ten thousand tons [11] And 75% of Cordyceps militaris related patents are formed worldwide.
With the development of metabolic engineering and synthetic biology, top-down strain engineering research based on natural anabolic networks has become a hotspot. In recent years, development of DNA element excavation, gene editing technology and genome metabolism model using Cordyceps militaris as a material has advanced to some extent. This makes metabolic engineering research based on Cordyceps militaris and cordycepin as cores possible. However, due to the complexity of genetic background and growth morphology, the metabolic engineering and the research of the synthetic biology of the edible fungi are relatively slow compared with the mode microorganisms such as escherichia coli, saccharomyces cerevisiae, aspergillus oryzae and the like.
The diversity of DNA elements is central to metabolic engineering and synthetic biology research. A promoter is a sequence upstream of the transcription initiation site of gene expression, whose own strength and number can significantly affect the level of downstream gene expression. The current common promoters of Cordyceps militaris comprise the discovery of a constitutive promoter P from a U6 microribonucleoprotein gene cmlsm3 [12] Constitutive promoter P derived from 35S RNA CaMV [13,14] Constitutive promoter P found from glyceraldehyde-3-phosphate dehydrogenase gene gpd [15] Constitutive promoter P of 3-indole-phosphoglycerate synthase gene trpC [16] . In terms of expression intensity, P cmlsm3 、P CaMV P trpC The 3 promoters are medium strength promoters, while P gpd Belongs to a high-strength promoter. In terms of size, P trpC Length is 369bp, P cmlsm3 Length is 547bp, P CaMV The length is 678bp, and the sizes of the three are far smaller than P gpd (1035 bp). Smaller promoters when gene vector construction is performedThe seed has better convenience and is easier to be connected into the target carrier. At present, the cordyceps militaris has the advantages of few types and large size of the discovered promoters, and lacks quantitative analysis of gene expression intensity, so that the expression level of the target gene is difficult to accurately regulate and control. Shandong university Qiqingsheng subject group [17] It has been reported that by concatenating a plurality of constitutive promoters in E.coli, a library of E.coli promoters with a linear increase in promoter strength with increasing copy number is ultimately achieved. Therefore, the construction of the cordyceps militaris overlapped constitutive promoter is expected to realize the accurate regulation and control of the expression level of the target gene in the cordyceps militaris.
Disclosure of Invention
In order to overcome the defects and shortcomings in the prior art, the invention aims to provide the cordyceps militaris P trpc Overlapping promoter libraries.
Another object of the present invention is to provide the above Cordyceps militaris P trpc Use of overlapping promoter libraries.
The aim of the invention is achieved by the following technical scheme:
the invention provides a cordyceps militaris P trpc Overlapping promoter libraries, consisting of 1 copy of P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoter, 9 copies of P trpc A promoter.
Preferably, said 1 copy of P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc The promoter has the sequentially enhanced strength for promoting the expression of the target gene; the 7 copies of P trpc Promoter, 8 copies of P trpc Promoter, 9 copies of P trpc The promoter has sequentially weakened strength for promoting expression of target gene。
Further, the 2 copies of P trpc The interval between each copy in the promoter is less than or equal to 100bp, preferably less than or equal to 50bp, more preferably 6-50 bp, and even more preferably 6bp;3-9 copies of P trpc The promoters are the same.
Still further, the sequence represented by SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 and SEQ ID NO:9, and a promoter composition of the nucleotide sequence shown in seq id no.
The invention also provides a vector comprising 1 copy of P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoters or 9 copies of P trpc A promoter as a promoter element.
Preferably, the vector comprises SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 or SEQ ID NO:9 as a promoter element.
Preferably, said vector further comprises a gene of interest operably linked to said promoter element.
Further, the genes of interest include (but are not limited to): structural genes, genes encoding proteins with specific functions, and reporter genes (e.g., green fluorescent protein, luciferase gene, or galactosidase gene LacZ).
Still further, the target gene is located downstream of the promoter element and has a distance of 2000bp or less from the promoter; preferably less than or equal to 1000bp; more preferably 500bp or less, such as 200bp or less, 100bp or less, 50bp or less, and 6 to 50bp.
The invention also provides a genetically engineered recombinant strain, which:
comprising said carrier; or P with 1 copy integrated in its genome trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoters or 9 copies of P trpc Nucleic acid of the promoter.
Preferably, or the genome thereof has incorporated therein the sequence of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 or SEQ ID NO: 9.
The host strain of the recombinant strain is Cordyceps militaris.
The invention also provides the cordyceps militaris P trpc Use of overlapping promoter libraries for providing P trpc Overlapping promoters, the P trpc The overlapping promoters are operably linked to a gene of interest and regulate expression of the gene of interest.
The invention also provides a strong promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoters or 7 copies of P trpc A promoter.
Preferably, the strong promoter is SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO:6 or SEQ ID NO: 7.
The application of the strong promoter in expressing protein in Cordyceps militaris.
The application of the vector or the recombinant strain in expressing protein in Cordyceps militaris.
Compared with the prior art, the invention has the following advantages and effects:
the invention adopts P trpC The promoter with moderate intensity and smaller size (369 bp) constructs P with 1-9 copies respectively by a Biobrick method trpc Overlapping promoter libraries with different promoter strengths composed of promoters achieveThe promoter library with linearly enhanced promoter strength along with the increase of the copy number of the promoter lays a foundation for quantitatively controlling the expression level proportion of different genes in cordyceps militaris.
Drawings
FIG. 1 is pMD19T (simple) -1-9P trpc -gfp-T nos Enzyme cutting and identification; wherein, the plasmid pMD19T (simple) -1-9P trpc -gfp-T nos Double enzyme digestion (M: DNA marker; 1-9: pMD19T (simple) -1P, respectively trpc -gfp-T nos To pMD19T (simple) -9P trpc -gfp-T nos )。
FIG. 2 is pCambia0390-blpR-1-9P trpc -gfp-T nos Enzyme cutting and identification; wherein the plasmid pCambia0390-blpR-1-9P trpc -gfp-T nos Double cleavage (M: DNA marker; 1-9: pCambia0390-blpR-1P, respectively) trpc -gfp-T nos To pCambia0390-blpR-9P trpc -gfp-T nos )。
FIG. 3 is pCambia0390-blpR-1-6P trpc -gfp-T nos Plasmid map.
FIG. 4 is pCambia0390-blpR-7-9P trpc -gfp-T nos Plasmid map.
FIG. 5 is a colony of recombinant transformant of Cordyceps militaris.
FIG. 6 is a PCR identification result of a recombinant transformant of Cordyceps militaris; wherein a is Cm1-6, 8trpc, the third generation hypha PCR verification result of the pseudo transformant; m: marker3;1: cm1trpc;2: cm2trpc; 3. 4: cm3trpc;5: cm4trpc; 6. 7: cm5trpc;8: cm6trpc;9: cm8trpc; b is the result of PCR verification of the third generation hypha of the Cm6-9trpc pseudotransformant; m: marker3; 1. 2: cm6trpc;3-5: cm7trpc;6: cm8trpc; 7. 8: cm9trpc.
FIG. 7 shows the qRT-PCR expression level verification of gfp gene of recombinant strain of Cordyceps militaris; wherein, the data are the average value of three experiments, and the error bars show standard error. Statistical analysis was performed using t-test (P < 0.05).
FIG. 8 is a wild-type strain of Cordyceps militaris and a recombinant strain biomass assay; wherein, the data are the average value of three experiments, and the error bars show standard error. * Indicating that recombinant strain was compared significantly with wild-type strain biomass, p <0.05, p <0.01.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.
The test methods for specific experimental conditions are not noted in the examples below, and are generally performed under conventional experimental conditions or under experimental conditions recommended by the manufacturer. The materials, reagents and the like used, unless otherwise specified, are those obtained commercially.
Example 1
1 materials and methods
1.1 Strain and plasmid
pMD19T (simple) plasmid was purchased from Takara Shuzo Co., ltd (Takara China), pP rstA The GFP plasmid was given a benefit from the university of Zhongshan Liu Jianzhong and the pAg1-H3 plasmid was given a benefit from the institute of microbiology Liu Gang and Pan Yuanyuan, E.coli DH 5. Alpha. Was purchased from Shanghai Weidi Biotechnology Co., ltd for gene cloning; plasmid pCambia0390 was purchased from (Camcia, queensland, australia), AGL-1 was purchased from Shanghai Biotechnology Inc., AGL-1 and plasmid pCambia0390 were used to mediate fungal transformations; cordyceps militaris CM-10 strain is purchased from Ningyang county of Shandong and Hexin Biotech limited company and is used as a gene host; cordyceps militaris CM-10 strain and its product research [ D ] in literature' Cordyceps militaris solid fermentation system for high yield of carotenoid]Is disclosed in university of agricultural, south China, 2016 ". pAg1-H3 plasmid and its preparation are described in document "Cloning of the ben gene and its functional identification in Cordyceps militaris [ J ]]Scientia Horticulturae,2020 ". pP rstA GFP plasmid, described in the literature "Dynamic control of the mevalonate pathway expression for improvedzeaxanthin production in Escherichia coli and comparative proteomeanalysis [ J ]]Metabolic Engineering,2016 ".
1.2 preparation of Medium and reagents
PDB medium: is used for culturing Cordyceps militaris. 200g of potato (peeled), 20g of glucose and MgSO 4 ·7H 2 O 1.5g，KH 2 PO 4 3g, distilled water to a volume of 1L, natural pH, agar 20g (solid medium addition), and high pressure steam sterilization at 121 ℃ for 30min.
LB medium: is used for culturing escherichia coli. 10g of tryptone, 5g of yeast extract, 10g of NaCl, distilled water to a volume of 1L, pH 7.4 and sterilizing by high-pressure steam at 121 ℃ for 30min.
IM medium: is used for culturing the agrobacterium tumefaciens. 1.45g/L KH 2 PO 4 ，2.05g/L K 2 HPO 4 ，0.15g/L NaCl，0.5g/L MgSO 4 ·7H 2 O，66mg/L CaCl 2 ·2H 2 O，2.48mg/L FeSO4·7H 2 O，0.5g/L(NH 4 ) 2 SO 4 1.8g/L Glucose,5mL/L Glycerin, pH5.5, and autoclaved at 121℃for 30min.
IMA medium: is used for co-culturing agrobacterium tumefaciens and cordyceps militaris spores. 1.45g/L KH 2 PO 4 ，2.05g/L K 2 HPO 4 ，0.15g/L NaCl，0.5g/L MgSO 4 ·7H 2 O，66mg/L CaCl 2 ·2H 2 O，2.48mg/L FeSO4·7H 2 O，0.5g/L(NH 4 ) 2 SO 4 0.9g/L Glucose,5mL/L Glycerin,15g/L Agar, pH5.5, autoclaved at 121℃for 30min.
100mM Acetosyringone, AS: 196.2mg of powder (microphone) are weighed, dissolved in 10mL of DMSO and filtered for sterilization.
100g/L carbenicillin (Carb): 1g of carbenicillin was dissolved in ultrapure water, the volume was set to 10mL, and the solution was filtered and sterilized.
100g/L cephalosporin (Cef): 1g of cephalosporin is dissolved in ultrapure water, the volume is fixed to 10mL, and the filtration and the sterilization are carried out.
100g/L kananamycin (Kan): 1g of the kananamycin was dissolved in ultrapure water, the volume was set to 10mL, and the solution was filtered and sterilized.
100g/L ampicillin (Amp): 1g of ampicillin was dissolved in ultrapure water, the volume was set to 10mL, and the solution was filtered and sterilized.
1.3 enzymes and kits
The DNA polymerase PrimeSTAR Max (R045A) for amplifying the target gene was purchased from Takara, the DNA polymerase 2×Taqmix for adding the A base was purchased from Nanjinofizan Biotechnology Co., ltd, and the DNA polymerase KOD Fx (KFX-101) for identifying the Cordyceps militaris transformant was purchased from Toyobo. Restriction endonucleases BamHI, ecoRI, bgl II, scaI were purchased from Thermo Fisher Scientific, T4DNA ligase was purchased from Takara, and kit HiPure Plasmid Mini Kit for plasmid extraction and nucleic acid purification recovery kit HiPure Gel Pure DNA Mini Kit were purchased from Meier organisms.
1.4 primer sequences
Primer name Primer sequence (5 '-3')
Tnos-F CCGAATTCTTGGATCCGATCGTTCAAACATTTGGCA
Tnos-R CCCAGATCTGATCTAGTAACATAGATGAC
GFP-F CCGAATTCTTGGATCCAGTAAAGGAGAAGAACTTTT
GFP-R CCCAGATCTCTATTTGTATAGTTCATCC
trpc-F CCGAATTCTTGGATCCTCGACAGAAGATGATATTGAA
trpc-R CCCAGATCTATCGATGCTTGGGTAGAATA
Tu3-F CATTCGCATCGTCATTGTTGGCTC
18S rRNA-F GAGCCCAAGCACTTTGATTTCT
18S rRNA-R GCATTTGCCAAGGATGTTTTC
qPCR-GFP-F AGTTGTCCCAATTCTTGTTG
qPCR-GFP-R TGTCTTGTAGTTCCCGTCA
Note that: underline'GAATTC"represents EcoRI cleavage site"GGATCC"represents BamHI cleavage site"AGATCT"means BglII cleavage site.
2 vector construction
2.1pMD19T(simple)-1-9P trpc -gfp-T nos Construction of vectors
PCR amplification is carried out by taking forward primer Tnos-F with EcoRI and BamHI cleavage sites and reverse primer Tnos-R with Bgl II cleavage sites as primer combination, taking pCambia0390 plasmid as template, obtaining terminator T nos . Terminator T by TA cloning nos Is ligated to pMD19T (simple) vector.
The end of the DNA sequence of interest amplified by PrimeSTAR Max is blunt. To ligate it to pMD19T (simple), it is necessary to add a poly A tail sequence at the 3' of the fragment of interest using DNA polymerase 2 XTaqmix. The reaction system and the reaction parameters are as follows:
adding a base system:
composition of the components Volume (mu L)
T nos 25
2×TaqMix 25
Total 50
Adding base reaction parameters: incubate at 70℃for 30min.
The HiPure Gel Pure DNA Mini Kit kit is used for recovering the fragment added with the A base, and the detailed steps are shown in the specification. The base fragment A was ligated with pMD19T (simple), and the specific reaction system and reaction parameters were as follows:
composition of the components Volume (mu L)
pMD19T(simple) 1
Fragments of base A 4
Solution I 5
Total 10
Ligation reaction parameters: incubate at 16℃for 2h.
Conversion of the ligated product into 0.1M CaCl 2 In competent cells of the prepared escherichia coli DH5 alpha engineering bacteria, colony PCR identification and sequencing analysis are carried out on the quasi-transformants. The next experiment was performed with the plasmid constructed successfully.
In pP rstA The GFP vector DNA was used as a template, and the GFP-F/R primer combination was used to amplify the green fluorescent protein gene GFP using PrimeSTAR Max. Since EcoRI, bamHI cleavage site and protecting base are added to the forward primer and BglII cleavage site and protecting base are added to the reverse primer, gfp gene fragment and vector pMD19T (simple) -T are prepared by using the principle that BamHI and BglII are homotail enzymes nos After cleavage purification, the DNA fragments are ligated by T4DNA ligase. The enzyme digestion system is as follows:
composition of the components Volume (mu L)
10×FastDigest Buffer 2
Fragment/vector 1μg
EcoRI 1
BglII/BamHI 1
dd H 2 O Supplement to 20
Total 20
Cleavage reaction parameters: incubate at 37℃for 5min.
T4DNA ligation reaction System:
composition of the components Volume (mu L)
10×T4 DNA Ligase Buffer 1
T4 DNA Ligase 1
Fragments 6
Carrier body 2
Total 10
Connection reaction conditions: incubate at 16℃for 2h.
Conversion of the ligated product into 0.1M CaCl 2 Prepared byIn competent cells of escherichia coli DH5 alpha engineering bacteria, colony PCR identification and sequencing analysis are carried out on the quasi-transformant. The next experiment was performed with the plasmid constructed successfully.
P was amplified with PrimeSTAR Max using pAg1-H3 vector DNA as template and trpc-F/R as primer combination trpc A promoter fragment. In the amplification reaction, the forward primer is added with EcoRI and BamHI cleavage sites, the reverse primer is added with BglII cleavage sites, and the principle that BamHI and BglII are homotail enzymes is utilized to carry out P trpc With pMD19T (simple) -gfp-T nos Ligation was performed to construct pMD19T (simple) -P trpc -gfp-T nos And performing colony PCR identification and sequencing. Similarly, pMD19T (simple) -NP was constructed using the Biobrick method trpc -gfp-T nos A carrier. N in the carrier name refers to 8 kinds of P such as 2 to 9 trpc Vectors with different copy numbers of promoters. P (P) trpc The 9 vectors with the copy numbers of the promoters from 1 to 9 are subjected to enzyme digestion test to confirm that complete overlapped P is obtained trpc A library of promoters.
2.2 1-9P trpc -gfp-T nos The module was ligated to pCambia0390-blpR
Since Cordyceps militaris is fungi, common escherichia coli plasmids cannot be infected, and the infection can be performed by means of Ti plasmids, a promoter module is connected to an agrobacterium vector pCambia0390-blpR with a glufosinate screening marker. Firstly, connecting a glufosinate screening marker expression frame Pcmlsm3-blpR-Tcmura3 to an AvrII enzyme cutting site of a pCambia0390 vector in an enzyme cutting connection mode to form the pCambia0390-blpR vector; wherein the expression cassette Pcmlsm3-blpR-Tcmura3 is described in the literature "efficiency CRISPR-cas9 gene disruption system in edible-medicinal mushroom cordyceps militaris [ J ]]Frontiers in Microbiology,2018 ". pMD19T (simple) -1-9P trpC -gfp-T nos And pCambia0390-blpR was digested with EcoRI and BglII and transferred by ligation. Due to pMD19T (simple) -4P trpC -gfp-T nos 、pMD19T(simple)-5P trpC -gfp-T nos pMD19T (simple) -6P trpC -gfp-T nos The fragments after digestion with EcoRI and BglII have smaller differences in size and are difficult to distinguish, thus the three fragments are treatedThe vector was digested with EcoRI, bglII and ScaI to obtain NP trpC -gfp-T nos The module, thus, can be subjected to the next ligation transformation with the pCambia0390-blpR vector.
Double cleavage reaction system:
composition of the components Volume (mu L)
10×FastDigest Buffer 2
Fragment/vector 1μg
EcoRI 1
BglⅡ 1
dd H 2 O Supplement to 20
Total 20
Three enzyme digestion reaction systems:
composition of the components Volume (mu L)
10×FastDigest Buffer 3
Fragment/vector 1μg
EcoRI 1
ScaI 1
BglⅡ 1
ddH 2 O Supplement to 30
Total 30
Cleavage reaction parameters: incubate at 37℃for 5min.
And (3) carrying out connection transformation according to the connection system after enzyme digestion, and obtaining a pseudo-transformant and carrying out enzyme digestion verification.
2.3 pCambia0390-blpR-1-9P trpc -gfp-T nos Electrotransformation into Agrobacterium tumefaciens AGL-1
1) Cooling the sterile electric shock cup (Biored Electroporation Cuvette Flier) on ice for more than 5 min;
2) The frozen Agrobacterium tumefaciens AGL-1 competent cells at the temperature of minus 80 ℃ are inserted into ice, stand for 5min for thawing, 1-5 mug of plasmid DNA is added immediately, and the mixture is transferred into a freezing electric shock cup after being gently blown and evenly mixed.
3) Starting a Biored electroconverter, placing a electric shock cup into an electroconverter tank, and using a preset electric shock program (Ec 1.8kV,1 Pulse) according to Pulse (the Pulse time is about 5 ms);
4) After the electric shock is finished, 1mL of the antibiotic-free LB liquid medium is quickly added and transferred into a sterile centrifuge tube, and the culture is carried out for 2-3 hours at the temperature of 30 ℃ in a shaking way.
5) Centrifuging at 6000rpm for 2min, and discarding most of the supernatant to obtain about 100 μl of bacterial liquid. After being evenly mixed by blowing by a liquid-transfering gun, the mixture is evenly coated on LB solid medium containing 50 mug/mL Kan and 50 mug/mL Carb, and colony PCR identification is carried out after 2-3 days of culture at 30 ℃ until colonies are grown.
2.4 Agrobacterium tumefaciens infects Cordyceps militaris spores
Acquisition of Agrobacterium
1) Single colonies of Agrobacterium AGL-1 transformants carrying the shuttle vector were inoculated into 10mL of LB (containing Kan 50mg/L and Carb 50 mg/L) and cultured with shaking at 30℃for 2-3 days to obtain seed solutions.
2) Inoculating fresh seed solution into IM culture medium (containing 200 μM AS) to initiate bacterial cell OD 600 The value is 0.15, and then the culture is carried out at 30 ℃ under shaking until the OD 600 The value was 0.8.
(II) obtaining cordyceps militaris conidium
1) Inoculating Cordyceps militaris strain CM-10 on PDA culture medium, culturing at 25deg.C in dark for 14-21 days, and illuminating for 5-7 days.
2) After washing the plates with 3-5mL of sterile 0.05% Tween 80 (filter sterilization) solution in an ultra clean bench, the wash solution was collected to the next plate for further washing. 3-5 plates were collected and approximately 1-2mL spore suspension was obtained.
3) After six layers of lens wiping paper are clamped by a filter head for sterilization and drying, 2mL of 0.05% Tween 80 is added into a super clean bench for vertically moistening the lens wiping paper, then spore suspension is injected for filtering to remove large particles, and finally 1mL of 0.05% Tween 80 is added for washing the residual spores of the filter.
4) The collected suspension was counted for conidia using a hemocytometer, and the suspension was diluted to a spore concentration of 1×10 4 -10 6 And each mL.
(III) Co-culture of Agrobacterium cells and fungal conidia
1) OD preheated at 25 ℃ 600 =0.80 agrobacterium cells and Cordyceps militaris spore suspension (1×10 4 -10 6 spore/mL) in a certain proportion (volume ratio 1:100,1:1,100: 1) Mixing.
2) The mixed bacterial solution was spread on IMA+200. Mu.M AS medium (pH=5.5) coated with cellophane sheet (diameter=90 mm) and incubated at 25℃for 2-3d in the absence of light.
(IV) screening of the pseudo-transformants
1) When co-cultivation at 25℃until spores began to germinate to white punctate mycelium pellet, the cellophane sheet was transferred to a selective PDA plate containing cephalosporin (300. Mu.g/mL) and glufosinate (400. Mu.g/mL) and incubated for 5-7d.
2) When the single mycelium pellet is obvious, the single transformant is picked up by the toothpick after sterilization treatment, and transferred to PDA culture medium containing glufosinate (400 mug/mL) for continuous culture.
3) When the single hypha grows to the size of 2cm in diameter, hypha blocks with the diameter of 0.5cm are cut for direct PCR verification.
4) The correct transformants were verified to continue subculture expansion. At the third generation, genomic DNA was extracted and PCR verified and sequenced using primer Tu 3-F/GFP-R.
2.5 Quantitative Real-Time PCR (qPCR) verifies the expression levels of multiple promoter-initiated gfp genes
The corresponding transformant mycelium pellet was inoculated into PDB liquid medium and cultured at 25℃and 150rpm for about 7 days. After filtering off the medium, the mycelia were washed 2-3 times with sterile water, and after grinding the mycelia into powder with liquid nitrogen, 100mg of the powder was taken and total RNA was extracted using E.Z.N.A.Fungal RNA Miniprep kit (OMEGA Bio-Tek). After gel electrophoresis test determines that total RNA extraction was successful, RNA concentration was determined using nanodrop. RNA reverse transcription was performed on 1. Mu.g of RNA, and RNA was reverse transcribed into cDNA using HiScript III RT SuperMix for qPCR (Vazyme). The reaction system for fluorescent quantitative PCR was 20. Mu.L, containing 50ng RNA, 0.2. Mu.M forward primer, 0.2. Mu.M reverse primer and SYBR qPCR Master Mix (Vazyme). For detection and analysis of fluorescent quantitative PCR, ABI 7500Real-Time PCR System was used. The internal reference gene is 18S rRNA of Cordyceps militaris and relative table of mRNAThe amount of arrival is 2 -ΔΔ CT(Livak) [18] Calculated by a method.
2.6 shake flask fermentation determination of Cordyceps militaris biomass
2 mycelia of the corresponding transformant were inoculated into 100mL of PDB liquid medium by punching, cultured at 25℃and 150rpm for 8 days, collected after growing to maturity, lyophilized and weighed.
3 results and analysis
3.1 recombinant vector pMD19T (simple) -1-9P trpc -gfp-T nos Construction and transformation of vectors
Recombinant plasmid pMD19T (simple) -1-9P trpc -gfp-T nos The vector frame with the size of 2705bp and fragments with the sizes of 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987 and 4362bp are obtained through double enzyme digestion detection of EcoRI and BglII respectively. As determined by agarose gel electrophoresis (FIG. 1), the recombinant plasmid pMD19T (simple) -1-9P was demonstrated as expected trpc -gfp-T nos The construction was successful.
3.2 pCambia0390-blpR-1-9P trpc Construction and transformation of gfp vector
The pCambia0390-blpR plasmid was subjected to double digestion, and 8109bp linear vector was recovered by gel cutting. For pMD19T (simple) -1-9P trpc -gfp-T nos The plasmid is subjected to double enzyme digestion or three enzyme digestion treatment, and 1-9P with sizes of 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987 and 4362bp is recovered by gel cutting trpc Promoter modules, and were transformed in connection with pCambia0390-blpR linear vector, respectively. After colony PCR identification, a quasi-transformant was obtained. Extraction of recombinant plasmid pCambia0390-blpR-1-9P trpc -gfp-T nos The double enzyme digestion test shows that the size of the vector is 8109bp, and the sizes of the vector are 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987 and 4362bp respectively. As determined by agarose gel electrophoresis (FIG. 2), the recombinant plasmid pCambia0390-blpR-1-9P was demonstrated as expected trpc -gfp-T nos The construction was successful, and the plasmid maps are shown in figures 3 and 4. Transferring the vector into the agrobacterium tumefaciens AGL-1 by using an electrotransformation mode, identifying a quasi-transformant by colony PCR, and indicating that the agrobacterium tumefaciens AGL-pCambia0390-blpR-1-9P trpc -gfp-T nos Is successfully constructed.
3.3 examination of recombinant transformants of Cordyceps militaris
Agrobacterium tumefaciens AGL_pCambia0390-blpR-1-9P, respectively trpc -gfp-T nos And (5) infecting the cordyceps militaris CM-10 spores. After 3d of cultivation of the infected cordyceps militaris spores on the non-resistant plates, the cordyceps militaris spores are transferred to the medium plates containing the corresponding antibiotics together with the lower cellophane, and dark cultivation is continued. When hyphae start to germinate and form white spots, the quasi-transformants are picked up on plates containing Basta antibiotics and cultured. After colony formation (FIG. 5), the hyphae of the pseudotransformants were scraped for PCR identification. The obtained resistant transformed strain was serially passaged and PCR identified (FIG. 6), and the targeted bands at 1325, 1700, 2075, 2450, 2825, 3200, 3575, 3950, 4325bp sizes were stable strains, respectively. And selecting a strain with stable passage of 3 generations for subsequent experiments, and naming the correct cordyceps militaris transformant as CmNtrpc.
3.4qRT-PCR detection of Gene relative expression
The cDNA of CM-10 and Cm1-9trpc is used as a template, and 18s rRNA-F/R, qPCR-GFP-F/R is used as a primer for qRT-PCR amplification. The relative expression levels of gfp genes in the other 8 strains were calculated using the wild type Cordyceps militaris CM-10 as a negative control and the gfp gene expression level of Cordyceps militaris Cm1trpc as a control (FIG. 7). Analysis of real-time fluorescent quantitative PCR results shows that gfp gene expression quantity gradually increases along with the increase of the number of promoters; when the number of promoters reaches 7, the expression intensity of gfp gene reaches the highest; then, as the number of promoters increases, the expression level gradually decreases. The above results indicate that the establishment of the cordyceps militaris promoter library with the linear change of the starting intensity with the increase of the copy number is completed.
3.5 shake flask fermentation determination of Cordyceps militaris biomass
Because of the poor robustness of Cordyceps militaris, we worry that transferring into multiple promoters will burden Cordyceps militaris growth metabolism, so to verify this problem we performed biomass determination on the correct transformants. The biomass results showed (FIG. 8) that the biomass of the transformed strain was not reduced compared to the wild-type strain CM-10, indicating that the transfer of multiple overlapping promoters did not burden the growth of Cordyceps militaris.
Reference is made to:
[1]Bentley HR,Cunningham KG,Spring FS.509.Cordycepin,a metabolic product from cultures of Cordyceps militaris(linn.)link.Part ii.The structure of cordycepin[J].Journal of the Chemical Society,1951:2301-2305.
[2]Huang Zf,Zhang ML,Zhang S et al.Structural characterization of polysaccharides from Cordyceps militaris and their hypolipidemic effects in high fat diet fed mice[J].RSC Advances,2018,8(71):41012-41022.
[3]Dong J，Li Y，Xiao H et al.Cordycepin sensitizes breast cancer cells toward irradiation through elevating ros production involving nrf2[J].Toxicol Appl Pharmacol,2018,364:12-21.
[4]Das SK，Masuda M，Hatashita M，et al.A new approach for improving cordycepin productivity in surface liquid culture of Cordyceps militaris using high-energy ion beam irradiation[J].Letters in Applied Microbiology,2008,47(6):534-538.
[5]Jin ML,Park SY,Kim YH，et al.Suppression ofα-msh and ibmx-induced melanogenesis by cordycepin via inhibition of creb and mitf,and activation of pi3k/akt and erk-dependent mechanisms[J].International Journal of Molecular Medicine,2012,29(1):119-24.
[6] yang Jie, chen Shunzhi, cordycepin research Ind. J. Chinese journal of Biochemical medicines, 2008,29 (06): 414-417.
[7] Shang Jiapeng two-step fermentation culture research [ J ] light industrial science and technology, 2020,36 (10): 9-11+20 for increasing cordycepin content in fruiting body of edible Cordyceps militaris.
[8] Wang Jufeng Cordyceps militaris culturing and study of physiological active substances [ D ]. Changsha: university of forestry science and technology, 2006.
[9] Liu Ran, qu Liang, wang Xianghe, etc. Cordyceps militaris mycelium liquid fermentation conditions optimization study [ J ]. Food engineering, 2019, (03) 31-34+42.
[10] Zhu Lina, gaoxinhua, liu Yanfang, etc. comparison of active ingredients in liquid fermented mycelia and solid cultivated fruiting bodies of Cordyceps militaris [ J ]. Shanghai agricultural journal, 2019, 35 (04): 57-62.
[11] Bao Dapeng, liu Minxiang, wang, etc. the mating gene molecular markers are used to assist the affinity pair [ J ] of Cordyceps militaris, the journal of Nuclear agrology, 2017, 31 (11): 2113-2120.
[12]Chen BX，Tao W，Ye ZW et al.Efficient crispr-cas9 gene disruption system in edible-medicinal mushroom cordyceps militaris[J].Frontiers in Microbiology，2018，9:1157-.
[13]PN B，Science C N J.The cauliflower mosaic virus 35s promoter:Combinatorial regulation of transcription in plants[J].Science，1990，250(4983):959-966.
[14]Zhang H，Wang Y，Tong X et al.Overexpression of ribonucleotide reductase small subunit,rnrm,increases cordycepin biosynthesis in transformed cordyceps militaris[J].Chinese Journal of Natural Medicines，2020，18(5):393-400.
[15]Gong Z，Ying S，Lei H et al.Cloning and analysis of glyceraldehyde-3-phosphate dehydrogenase gene from cordyceps militaris[J].African Journal of Agricultural Research，2009，4(4):402-408.
[16]Zheng Z，Huang C，Li C et al.Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus cordyceps militaris[J].Fungal Biology，2011，115(3):0-274.
[17]Li M，Wang J，Geng Y et al.A strategy of gene overexpression based on tandem repetitive promoters in escherichia coli[J].Microbial Cell Factories,，2012，11:19.
[18]Livak KJ，Schmittgen TD.Analysis of relative gene expression data using real-time quantitative pcr and the 2-δδct method[J].Methods，2001，25(4):402-408.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
<110> agricultural university of south China
Guangzhou Jun research Biotechnology Co., ltd
<120> Cordyceps militaris Ptrpc overlapping promoter library and application thereof
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 369
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 1 copy nucleotide sequence of Ptrpc promoter
<400> 1
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgat 369
<210> 2
<211> 744
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 2 copies of nucleotide sequence of Ptrpc promoter
<400> 2
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgat 744
<210> 3
<211> 1119
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 3 copies of nucleotide sequence of Ptrpc promoter
<400> 3
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgat 1119
<210> 4
<211> 1494
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 4 copies of nucleotide sequence of Ptrpc promoter
<400> 4
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgat 1494
<210> 5
<211> 1869
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 5 copies of nucleotide sequence of Ptrpc promoter
<400> 5
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860
agcatcgat 1869
<210> 6
<211> 2244
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 6 copies of nucleotide sequence of Ptrpc promoter
<400> 6
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220
tacctattct acccaagcat cgat 2244
<210> 7
<211> 2619
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
Nucleotide sequence of Ptrpc promoter of <223> 7 copies
<400> 7
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580
agattcaatc tgacttacct attctaccca agcatcgat 2619
<210> 8
<211> 2994
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 8 copies of nucleotide sequence of Ptrpc promoter
<400> 8
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 2640
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 2700
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 2760
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 2820
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 2880
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 2940
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgat 2994
<210> 9
<211> 3369
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
Nucleotide sequence of Ptrpc promoter of <223> 9 copies
<400> 9
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860
agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920
agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980
aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040
tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100
ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160
gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220
tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280
tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340
caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400
gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460
ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520
gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580
agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 2640
attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 2700
tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 2760
ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 2820
tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 2880
tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 2940
tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 3000
tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 3060
acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 3120
gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 3180
cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 3240
tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 3300
tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 3360
agcatcgat 3369
<210> 10
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> Tnos-F
<400> 10
ccgaattctt ggatccgatc gttcaaacat ttggca 36
<210> 11
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> Tnos-R
<400> 11
cccagatctg atctagtaac atagatgac 29
<210> 12
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> GFP-F
<400> 12
ccgaattctt ggatccagta aaggagaaga actttt 36
<210> 13
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> GFP-R
<400> 13
cccagatctc tatttgtata gttcatcc 28
<210> 14
<211> 37
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> trpc-F
<400> 14
ccgaattctt ggatcctcga cagaagatga tattgaa 37
<210> 15
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> trpc-R
<400> 15
cccagatcta tcgatgcttg ggtagaata 29
<210> 16
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> Tu3-F
<400> 16
cattcgcatc gtcattgttg gctc 24
<210> 17
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 18S rRNA-F
<400> 17
gagcccaagc actttgattt ct 22
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> 18S rRNA-R
<400> 18
gcatttgcca aggatgtttt c 21
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> qPCR-GFP-F
<400> 19
agttgtccca attcttgttg 20
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<223> qPCR-GFP-R
<400> 20
tgtcttgtag ttcccgtca 19

Claims (10)

1. Cordyceps militaris P trpc An overlapping promoter library, characterized by: the promoter library consists of 1 copy of P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoter and 9 copies of P trpc A promoter.
2. Cordyceps militaris P according to claim 1 trpc An overlapping promoter library, characterized by:
the 1 copy P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc The promoter has the sequentially enhanced strength for promoting the expression of the target gene;
the 7 copies of P trpc Promoter, 8 copies of P trpc Promoter, 9 copies of P trpc The promoter has a sequentially weakened strength to promote expression of the target gene.
3. Cordyceps militaris P according to claim 1 trpc An overlapping promoter library, characterized by:
the promoter library consists of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 and SEQ ID NO:9, and a promoter composition of the nucleotide sequence shown in seq id no.
4. A carrier, characterized in that: the vector contains 1 copy of P trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoters or 9 copies of P trpc A promoter as a promoter element.
5. The carrier of claim 4, wherein:
the vector contains SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 or SEQ ID NO:9 as a promoter element.
6. A genetically engineered recombinant strain, characterized in that: the recombinant strain:
comprising the vector of claim 4 or 5; or P with 1 copy integrated in its genome trpc Promoter, 2 copies of P trpc Promoter, 3 copies of P trpc Promoter, 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoter, 7 copies of P trpc Promoter, 8 copies of P trpc Promoters or 9 copies of P trpc Nucleic acid of the promoter.
7. The genetically engineered recombinant strain of claim 6, wherein:
or has integrated in its genome the sequence of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO:8 or SEQ ID NO: 9.
8. Cordyceps militaris P as claimed in any one of claims 1-3 trpc Use of a library of overlapping promoters characterized by: for providing P trpc Overlapping promoters, the P trpc The overlapping promoters are operably linked to a gene of interest and regulate expression of the gene of interest.
9. A strong promoter, characterized in that: the strong promoter is 4 copies of P trpc Promoter, 5 copies of P trpc Promoter, 6 copies of P trpc Promoters or 7 copies of P trpc A promoter;
further, the strong promoter is SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO:6 or SEQ ID NO: 7.
10. Use of the strong promoter of claim 9, the vector of any one of claims 4 to 5 or the recombinant strain of any one of claims 6 to 7 for expressing a protein in cordyceps militaris.
CN202111408176.7A 2021-11-19 2021-11-19 Cordyceps militaris P trpc Overlapping promoter library and application thereof Pending CN116145266A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111408176.7A CN116145266A (en) 2021-11-19 2021-11-19 Cordyceps militaris P trpc Overlapping promoter library and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111408176.7A CN116145266A (en) 2021-11-19 2021-11-19 Cordyceps militaris P trpc Overlapping promoter library and application thereof

Publications (1)

Publication Number Publication Date
CN116145266A true CN116145266A (en) 2023-05-23

Family

ID=86349366

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111408176.7A Pending CN116145266A (en) 2021-11-19 2021-11-19 Cordyceps militaris P trpc Overlapping promoter library and application thereof

Country Status (1)

Country Link
CN (1) CN116145266A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114621881A (en) * 2021-12-30 2022-06-14 广州君研生物科技有限公司 Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114621881A (en) * 2021-12-30 2022-06-14 广州君研生物科技有限公司 Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor

Similar Documents

Publication Publication Date Title
Frandsen A guide to binary vectors and strategies for targeted genome modification in fungi using Agrobacterium tumefaciens-mediated transformation
Shi et al. Development of a simple and efficient transformation system for the basidiomycetous medicinal fungus Ganoderma lucidum
EP2718442B1 (en) Genetic manipulation and expression systems for pucciniomycotina and ustilaginomycotina subphyla
CN106939310B (en) Promoter optimization method based on ribosome binding site modification
WO2016029802A1 (en) Identification and use of synthetic gene cluster of cordycepin
JP2022110110A (en) Recombinant oxalate decarboxylase expressed in filamentous fungal host cell
CN105647822B (en) Recombinant mortierella alpina for overexpression of omega-3 desaturase from phytophthora parasitica as well as construction method and application thereof
WO2021143696A1 (en) Factor regulating protein expression efficiency of trichoderma reesei, and regulation method and use thereof
CN116145266A (en) Cordyceps militaris P trpc Overlapping promoter library and application thereof
CN109666690B (en) Method for over-expressing non-trace trichoderma fungus gene
Shi et al. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes
Chen et al. An efficient genetic transformation system for Chinese medicine fungus Tolypocladium ophioglossoides
CN116515649B (en) Transgenic method for improving heat stress resistance of beauveria bassiana
CN114196682B (en) Method for improving activity of stropharia rugoso-annulata lignocellulose
CN112553090B (en) Trichoderma reesei engineering bacterium capable of highly yielding sorbiciliniids as well as construction method and application thereof
CN110564718A (en) Method and strain for screening high-yield amphotericin B-tubercle streptomycete by high-throughput mutagenesis
CN106119137B (en) Method for improving protein secretion capacity of filamentous fungi
CN107815459A (en) A kind of oyster cap fungus manganese peroxidase enzyme gene and its application
CN107177622A (en) A kind of Agrobacterium tumefaciens mediated Italian mould genetic transforming method
CN114907998A (en) Saccharomyces cerevisiae, method for improving genome mutation rate of saccharomyces cerevisiae, method for domesticating saccharomyces cerevisiae and application of saccharomyces cerevisiae and method
CN111394350B (en) Rhodosporidium toruloides RNA polymerase III type promoter and application thereof
CN111394349B (en) Rhodosporidium toruloides RNA polymerase III type promoter and application thereof
CN112779174B (en) Saccharomyces cerevisiae genetically engineered bacterium for knocking out Cln3 gene, construction method and application thereof
CN114875046B (en) Filamentous fungus replicon
CN114561419B (en) Agrobacterium tumefaciens mediated Phellinus igniarius genetic transformation method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination