CN116144566A

CN116144566A - Method for knocking down transpeptidase gene and improving glutamine transaminase yield

Info

Publication number: CN116144566A
Application number: CN202310012023.3A
Authority: CN
Inventors: 白林泉; 吴邦昊; 步国建
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2023-01-05
Filing date: 2023-01-05
Publication date: 2023-05-23

Abstract

The invention discloses a method for knocking down a transpeptidase gene to improve the yield of glutamine transaminase (TG enzyme), which is to weaken the transcription level of a transpeptidase coding gene of Streptomyces mobaraensis IPIO by using CRISPRi/dCAs9 technology in the Streptomyces mobaraensis IPIO to obtain a mutant strain WBH21 of high-yield TG enzyme. The invention can inhibit the synthesis of cell walls to promote the transportation of substances and improve the secretion efficiency of TG enzyme by reducing the transcription level of a transpeptidase coding gene SMDS_318, thereby improving the yield of the TG enzyme. The TG enzyme fermentation yield of the engineering strain WBH21 obtained by the invention is improved by 54% compared with that of a control strain at the shake flask level of a laboratory. The invention can obviously improve the fermentation yield of TG enzyme and greatly reduce the fermentation cost.

Description

Method for knocking down transpeptidase gene and improving glutamine transaminase yield

Technical Field

The invention belongs to the technical field of bioengineering, relates to a method for knocking down a transpeptidase gene to improve the yield of glutamine transaminase, and in particular relates to a method for reducing the transcription level of SMDS_318 by using CRISPRi/dCAS9 technology and inhibiting the expression of the transpeptidase protein to improve the fermentation level of TG enzyme.

Background

TG enzyme is a single subunit protein produced by streptomyces mobaraensis (Streptomyces mobaraensis), which can catalyze the transamidation reaction between the gamma-amido of glutamine residue and epsilon-amino of lysine in the protein to form a heterotypic peptide bond of epsilon- (gamma-glutamine) -lysine, thereby changing the functional property of the protein, being widely applied to protein product eating additives, crosslinking antibodies and drug molecules in the food industry to produce antibody coupling drugs, improving the strength of wool textiles and the like, and increasing the market demand year by year, however, the yield of the enzyme is still lower at present and needs to be further improved. The invention discovers that in the process of producing TG enzyme by using streptomyces from metallocene source, the cell wall of the thallus is thickened due to the crosslinking action of the TG enzyme, and the substance transportation processes such as zymogen outward transportation and the like are hindered. Furthermore, the important transpeptidase coding gene SMDS_318 in the cell wall forming process is discovered through genome and transcriptome, the transcription level of the gene is reduced by using CRISPRi technology, the cell wall forming process is weakened, the material transporting process is strengthened, and finally the yield of TG enzyme is improved.

Disclosure of Invention

The invention aims at knocking down a transpeptidase gene to improve the yield of glutamine transaminase, in particular to a method for inhibiting the expression of transpeptidase SMDS_318; by reducing the transcript level of SMDS_318 in Streptomyces mobaraensis IPIO using CRISPRi/dCAS9 technology, SMDS_318 expression is inhibited, and finally, the yield of glutamine transaminase (TG enzyme) can be significantly improved.

In order to achieve the above purpose, the present invention provides the following technical solutions:

in a first aspect, the present invention provides a strain (WBH 21) of high TG enzyme production, the strain having suppressed transcription of the transpeptidase gene.

As one embodiment of the invention, the strain is Streptomyces mobaraensis.

As one embodiment of the invention, the strain inhibits the expression of a transpeptidase.

As one embodiment of the invention, the transcription level of the transpeptidase coding gene SMDS_318 is reduced in the streptomyces mobaraensis IPIO, the expression of the transpeptidase is inhibited, and finally, the TG enzyme yield can be obviously improved.

In a second aspect, the invention relates to an integrative plasmid vector for knocking down the transcription level of a gene encoding a transpeptidase gene, said vector decreasing the transcription level of the transpeptidase-encoding gene smds_318, comprising a gRNA targeting the promoter region of said gene, inhibiting protein expression by decreasing the transcription level of the gene.

As one embodiment of the invention, the transpeptidase encoding gene SMDS_318 source Yu Maoyuan Streptomyces IPIO.

As one embodiment of the invention, the sequence of the transpeptidase encoding gene SMDS_318 is shown in SEQ ID NO.1, and the corresponding gRNA _{SMDS_318} The sequence of (2) is shown as SEQ ID NO. 2.

As one embodiment of the invention, the inhibition of the expression of the transpeptidase is CRISPRi interfering with the level of gene transcription.

In a third aspect, the invention relates to a method for constructing an integrative plasmid vector for knocking down the transcription level of a transpeptidase-encoding gene, comprising the steps of:

specifically designing and targeting gRNA of SMDS_318 on CRISPy-web site, and amplifying to obtain the target containing gRNA through PCR _{SMDS_318} The PCR fragment of the gene sequence was ligated into the SpeI/EcoRI site in the integrative plasmid pSET-dCAs9-actII4-NT-S1 by Gibson ligation to obtain integrative plasmid vector pLQ2125;

as one embodiment of the invention, the primer used for amplification is a primer SMDS_318gRNAp-F/gRNA-R with a sequence shown as SEQ ID NO. 3/4.

In a fourth aspect, the present invention relates to a Streptomyces mobaraensis strain with high TG enzyme yield, wherein the integrated plasmid vector described above, or the integrated plasmid vector constructed by the method described above, is introduced into a recipient strain Streptomyces mobaraensis, respectively, by conjugation transfer, and recombined to obtain the strain.

As one embodiment of the invention, the recombination is site-specific recombination.

As one embodiment of the present invention, the step of obtaining a recombinant mutant strain in which the gene is overexpressed by resistance and PCR verification screening is further included after the recombination.

In a fifth aspect, the present invention relates to a method for increasing the yield of TG enzymes by knocking down the transcription level of the transpeptidase-encoding gene, and inhibiting the expression of the corresponding protein to increase the yield of TG enzymes produced by IPIO fermentation of streptomyces mobaraensis.

As one embodiment of the invention, the transpeptidase encoding gene and the gRNA are SMDS_318 and gRNA with the sequences shown in SEQ ID NO.1-NO.2 _{SMDS_318} 。

As one embodiment of the invention, a transpeptidase attenuation expression mutant strain is obtained at the transcription level of a gene encoding the low transpeptidase of streptomyces mobaraensis IPIO, and the TG enzyme is obtained by fermentation. As a specific example, the transcription level of the transpeptidase-encoding gene SMDS_318 was reduced in Streptomyces mobaraensis IPIO to obtain the expression-suppressing mutant WBH21, and fermentation was performed to obtain the TG enzyme. The CRISPRi/dCAS9 technology is utilized in the IPIO of the streptomyces mobaraensis to reduce the transcription level of the transpeptidase coding gene, inhibit the expression of the corresponding protein, strengthen the protein exogenesis process and further improve the TG enzyme yield.

As an embodiment of the invention, the fermentation comprises the steps of: inoculating the activated weakened mutant spores into a seed culture medium, culturing for 24-26h at 25-30deg.C and 200-220rpm, transferring into a fermentation culture medium according to 6-10% inoculum size, and fermenting for 28-32h at 25-30deg.C and 200-220 rpm. And collecting fermentation liquor and carrying out TG enzyme activity detection.

As a specific example, the fermentation comprises the steps of: inoculating the activated weakened mutant spores into a seed culture medium, culturing at 30deg.C and 200rpm for 24-26 hr, transferring into a fermentation culture medium according to 10% inoculum size, and fermenting at 30deg.C and 200rpm for 28-32 hr.

As one embodiment of the present invention, the seed medium comprises glycerol 1-3w/v%, yeast extract 0.4-0.8w/v%, fish meal peptone 1-3w/v%, mgSO ₄ ·7H ₂ O 0.1-0.3w/v％、K ₂ HPO ₄ ·3H ₂ O0.1-0.3 w/v%. As a specific example, the seed medium includes glycerol 2w/v%, yeast extract 0.6w/v%, fish meal peptone 2.5w/v%, mgSO ₄ ·7H ₂ O 0.2w/v％、K ₂ HPO ₄ ·3H ₂ O 0.2w/v％。

As one embodiment of the present invention, the fermentation medium comprises glycerol 1-3w/v%, yeast extract 0.4-0.8w/v%, fish meal peptone 1-3w/v%, mgSO ₄ ·7H ₂ O 0.1-0.3w/v％、K ₂ HPO ₄ ·3H ₂ 0.1-0.3w/v% of O and 0.1-0.4w/v% of fermentation promoter. As a specific example, the fermentation medium comprises glycerol 2w/v%, yeast extract 0.6w/v%, fish meal peptone 2.5w/v%, mgSO ₄ ·7H ₂ O 0.2w/v％、K ₂ HPO ₄ ·3H ₂ O0.2 w/v% and fermentation promoter 0.1w/v%.

The plasmid pSET-dCAs9-actII4-NT-S1 according to the invention is already described in the SCI database literature Zhao Y, li L, zheng G, jiang W, deng Z, wang Z, lu Y. CRISPR/dCAs9-Mediated Multiplex Gene Repression in Streptomyces. Biotechnol J.2018Sep;13 (9) e1800121.

The strain Streptomyces mobaraensis IPIO (Streptomyces mobaraensis IPIO) related by the invention is obtained by strain mutagenesis of Taixing east Sheng biotechnology limited company, and is preserved in China Center for Type Culture Collection (CCTCC), and the preservation address is: chinese university of Wuhan; the preservation number is M2020196, and the preservation date is 2020.6.25.

Compared with the prior art, the invention has the following beneficial effects:

1) The invention discovers that in the process of producing TG enzyme by using Streptomyces mobaraensis IPIO in the fermentation process, the cell wall of the thallus is thickened due to the crosslinking action of the TG enzyme, and the transportation process of substances such as zymogen is hindered, which may be a factor for limiting the improvement of the yield of the TG enzyme; by inhibiting the expression of the transpeptidase, the formation of the cell wall is weakened to enhance the substance transport process, and finally the yield of the TG enzyme is improved.

2) In the invention, the integrated vector pSET-dCAS9-actII4-NT-S1 is utilized in the Streptomyces mobaraensis IPIO, the CRISPRi/dCAS9 technology is utilized in the IPIO to weaken the transcription level of transpeptidase SMDS_318 from the Streptomyces mobaraensis IPIO, the expression of corresponding protein is inhibited, and the enzyme activity of TG enzyme of a laboratory shake flask level is improved by 54% compared with that of a control strain (blank vector integrated strain); the invention can obviously improve the fermentation yield of TG enzyme and greatly reduce the fermentation cost.

Drawings

Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:

FIG. 1 is a schematic diagram of construction of a SMDS_318 gene-attenuated plasmid;

FIG. 2 is a schematic diagram of the fermentation yields of the knockdown transpeptidase mutant and control strain TG enzymes.

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will assist those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any way. It should be noted that several modifications and improvements can be made by those skilled in the art without departing from the inventive concept. These are all within the scope of the present invention.

The invention relates to an integrated plasmid vector for knocking down the transcription level of a transpeptidase gene coding gene, which reduces the transcription level of the transpeptidase coding gene SMDS_318, contains gRNA targeted to a promoter region of the gene and inhibits protein expression by reducing the transcription level of the gene.

The transpeptidase coding gene SMDS_318 source Yu Maoyuan streptomycete IPIO.

The sequence of the transpeptidase coding gene SMDS_318 is shown as SEQ ID NO.1, and the corresponding gRNA thereof _{SMDS_318} The sequence of (2) is shown as SEQ ID NO. 2.

The first step of the invention: construction of plasmid pLQ2125: the integrated plasmid pSET-dCAS9-actII4-NT-S1 is used as a template, and a primer SMDS_318gRNAp-F/gRNA-R with a Gibson repeated sequence introduced at two ends is used for PCR amplification to obtain the gRNA _{SMDS_318} Is a PCR fragment of (C).The amplified fragment was inserted into the SpeI/EcoRI site of plasmid pSET-dCAS9-actII4-NT-S1 to give plasmid pLQ2125 as shown in FIG. 1.

* The recognition sites (cleavage sites) of the endonucleases involved in the first to fourth steps are as follows:

EcoRI recognition site: speI recognition site:

5'...G^AATTC...3' 5'...A^CTAGT...3'

3'...CTTAA^G...5' 3'...TGATC^A...5

* The primer sequences used in the first to fourth steps are as follows:

* PCR system and conditions used for preparing gene fragments in the first to fourth steps:

PCR reaction system: 30ng of DNA template, 20pmol of primer, 5 mu L of 50% DMSO, 10nmol of dNTP, 25 mu L of buffer solution, 1 unit of Taq DNA polymerase, and adding pure water for filling to 50 mu L;

PCR conditions: 95 ℃ for 5min;95 ℃ for 15s; 15s at 55 ℃; 25s at 72 ℃; cycling for 32 times; and at 72℃for 10min.

Fifth step: the plasmid vector pLQ2125 obtained by the first to fourth steps is respectively transferred into the streptomyces mobaraensis IPIO of the receptor fungus through conjugation transfer for site-specific recombination, and correct zygotes are screened through resistance and PCR verification, so that the SMDS_318 gene attenuation mutant strain is obtained. The method specifically comprises the following steps:

plasmid pLQ2125 was transformed into host ET12567 (pUZ 8002). Corresponding ET12567 (pUZ 8002) was inoculated into LB containing three antibiotics of Apr (final concentration 50. Mu.g/mL), kan (final concentration 50. Mu.g/mL) and Chl (final concentration 25. Mu.g/mL), cultured at 37℃for 20 hours, and then the cells were rinsed with fresh LB solution to remove the antibiotics in the culture. At the same time, fresh spores of Streptomyces mobaraensis IPIO (activated on solid medium for about 7-10 d)Collecting in TES solution, heat-shocking at 50deg.C for 10min, rinsing with LB solution for 2-3 times, mixing with host bacteria ET12567 (pUZ 8002) prepared previously (ratio of recipient bacteria cells to donor bacteria is about 10) ⁸ :10 ⁹ ) After homogenization, the mixture was spread on ISP4MYM solid medium containing 20mM magnesium ions, and the culture was inverted in an incubator at 37 ℃. Taking out the flat plate after 14-16h, respectively adding two antibiotics of apramycin (final concentration 50 mug/mL) and trimethoprim (final concentration 50 mug/mL) into 1mL sterile water, uniformly mixing, covering the mixture on ISP4MYM solid medium, airing the solid medium, and transferring the solid medium into a 30 ℃ incubator for inversion culture. The zygote was grown on a common plate after 3-5 d, and the resultant was transferred to ISP4MYM solid medium containing two antibiotics, namely apramycin (final concentration: 50. Mu.g/mL) and trimethoprim (final concentration: 50. Mu.g/mL), and amplified and cultured, and the strain was screened by mycelium PCR to obtain a SMDS_318 gene-attenuated mutant, which was designated WBH21.

* The primer sequences used in the fifth step are as follows:

primer name	Base sequence
		dCas9-YZ-F	AAGGGTACCGGATCCTTGACA(SEQ ID NO.5)
dCas9-YZ-R	AGCGAGTCAGTGAGCGAGGAA(SEQ ID NO.6)

* And fifthly, verifying a PCR system and conditions adopted in screening mutant strains through PCR:

PCR system: 10-100 ng of DNA template, 10pmol of primer, 2 mu L of 50% DMSO, 10 mu L of 2 Xmix buffer solution, and adding pure water to fill to 20 mu L;

PCR conditions: 95 ℃ for 10min;95 ℃ for 30s;58 ℃ for 30s; 30s at 72 ℃; cycling for 30 times; and at 72℃for 10min.

Example 2

This example shows the fermentation of a weakened mutant WBH21 to produce a TG enzyme using the transpeptidase-encoding gene. The method comprises the following specific steps: the mutant strain WBH21 is coated on a solid Gaoshi No.1 culture medium for activation, after culturing for 7-10d at 30 ℃, a flat spore is scraped and inoculated into a seed culture medium for culturing for 24-26h at 30 ℃ and 200rpm, the strain WBH21 is transferred to a fermentation culture medium according to 10% of inoculation amount, and fermentation is carried out for 28-32h at 30 ℃ and 220rpm, and the fermentation broth is collected for TG enzyme activity detection.

TABLE 1 composition of seed Medium and fermentation Medium

Example 3

This example shows a method for detecting the enzymatic activity of TG enzyme by colorimetry. The method comprises the following steps: 200. Mu.L of the supernatant of the fermentation broth diluted 10 to 20 times was taken in a test tube, 200. Mu.L of water was added as a control to one tube, 2mL of preheated A solution at 37℃was added, and after 10min of reaction at 37℃the reaction was terminated by adding 2mL of B solution. The absorbance of the fermentation broth was measured at 525nm using a quartz cuvette. Will eventually OD _525nm And carrying out a formula obtained by conversion of a standard curve, and calculating the enzyme activity of the TG enzyme.

The preparation method of the solution comprises the following steps:

and (3) solution A: 9.688g of tris (hydroxymethyl) aminomethane, 2.780g of hydroxylamine hydrochloride, 1.229g of reduced glutathione, 4.048g of the substrate N-benzyloxycarbonyl-L-glutamyl glycine (N-alpha-CBZ-GLN-GLY) were weighed into a beaker, 350mL of water was added, the pH was adjusted to 6.0, and water was added to a constant volume of 400mL.

And (2) liquid B: 3mol/L hydrochloric acid, 12% trichloroacetic acid, 3% FeCl ₃ Dissolving in 0.1mol/L HCl, and uniformly mixing the three solutions in equal amounts.

FIG. 2 is a diagram showing the fermentation yield of the attenuated mutant strain of the transpeptidase-encoding gene and the TG enzyme of the control strain. The results showed a 54% improvement in the yield of mutant WBH21 over the wild-type strain at the laboratory shake flask level.

The foregoing describes specific embodiments of the present invention. It is to be understood that the invention is not limited to the particular embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the claims without affecting the spirit of the invention.

Claims

1. A high-producing strain of glutamine transaminase, wherein the strain has repressed transcription of a transpeptidase gene.

2. The high glutamine transaminase producing strain of claim 1, wherein the transcription level of the gene smds_318 is reduced in streptomyces mobaraensis IPIO.

3. An integrative plasmid vector for reducing the transcription level of a transpeptidase-encoding gene, characterized in that the vector inhibits the transcription level of the transpeptidase-encoding gene smds_318 of streptomyces mobaraensis IPIO, contains a gRNA targeting the promoter region of the transpeptidase-encoding gene smds_318, and inhibits protein expression by reducing the gene transcription level.

4. An integrative plasmid vector according to claim 3, wherein the sequence of the transpeptidase-encoding gene smds_318 is shown in SEQ ID No.1, corresponding gRNA _{SMDS_318} The sequence of (2) is shown as SEQ ID NO. 2.

5. A method for constructing an integrative plasmid vector according to claim 3 or 4, wherein the construction steps are as follows:

designing gRNA of specific targeting SMDS_318 promoter region on CRISPy-web site, and obtaining the gRNA through PCR amplification _{SMDS_318} The PCR fragment of the gene sequence was ligated into the SpeI/EcoRI site of the integrative plasmid pSET-dCAs9-actII4-NT-S1 by Gibson ligation to obtain integrative plasmid vector pLQ2125.

6. A Streptomyces mobaraensis strain with high glutamine transaminase yield is characterized in that the integrated plasmid vector as defined in claim 3 or 4 or the integrated plasmid vector constructed by the method as defined in claim 5 is respectively introduced into a recipient strain Streptomyces mobaraensis IPIO through conjugal transfer, and site-specific recombination is carried out to obtain the strain.

7. A method for increasing the production of glutamine transaminase, characterized in that the level of transcription of smds_318 is reduced by the CRISPRi technique.

8. The method according to claim 7, wherein the level of transcription of the transpeptidase-encoding gene smds_318 is reduced in streptomyces mobaraensis IPIO to obtain a genetically attenuated mutant, and fermenting to obtain glutamine transaminase.

9. The method according to claim 8, wherein the fermentation comprises the steps of: inoculating the activated weakened mutant spores into a seed culture medium, culturing for 24-26h at 25-30 ℃ and 200-220rpm, transferring into a fermentation culture medium according to 6% -10% of inoculum size, and fermenting for 28-32h at 25-30 ℃ and 200-220 rpm.

10. The method of claim 8, wherein the seed medium comprises glycerol 1-3w/v%, yeast extract 0.4-0.8w/v%, fish meal peptone 1-3w/v%, mgSO ₄ ·7H ₂ O 0.1-0.3w/v％、K ₂ HPO ₄ ·3H ₂ O 0.1-0.3w/v％；

The fermentation medium comprises glycerol 1-3w/v%, yeast extract 0.4-0.8w/v%, fish meal peptone 1-3w/v%, and MgSO ₄ ·7H ₂ O 0.1-0.3w/v％，K ₂ HPO ₄ ·3H ₂ 0.1-0.3w/v% of O and 0.1-0.4w/v% of fermentation promoter.