CN116121414A - Multiple qPCR kit for simultaneously detecting six respiratory pathogens - Google Patents

Multiple qPCR kit for simultaneously detecting six respiratory pathogens Download PDF

Info

Publication number
CN116121414A
CN116121414A CN202211573467.6A CN202211573467A CN116121414A CN 116121414 A CN116121414 A CN 116121414A CN 202211573467 A CN202211573467 A CN 202211573467A CN 116121414 A CN116121414 A CN 116121414A
Authority
CN
China
Prior art keywords
detecting
qpcr
probes
probe
marked
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211573467.6A
Other languages
Chinese (zh)
Inventor
蒋析文
范建
彭荣俞
苏文
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Da'an Gene Co ltd
Original Assignee
Guangzhou Da'an Gene Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Da'an Gene Co ltd filed Critical Guangzhou Da'an Gene Co ltd
Priority to CN202211573467.6A priority Critical patent/CN116121414A/en
Publication of CN116121414A publication Critical patent/CN116121414A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/35—Mycoplasma
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a multiplex qPCR kit for simultaneously detecting six respiratory pathogens. The multiplex qPCR kit can detect six common respiratory tract infection pathogens, namely adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae, and has the advantages of good detection specificity, high sensitivity, good repeatability and no interference by interfering substances. In addition, the kit is simple to operate when being used for detecting adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus or chlamydia pneumoniae, consumes short time, can detect the six different common pathogens of respiratory tract infection at one time through a two-tube reaction system, has accurate detection results, is suitable for clinical rapid detection of respiratory tract pathogens, and is beneficial to timely and correctly treating the infected pathogens.

Description

Multiple qPCR kit for simultaneously detecting six respiratory pathogens
Technical Field
The invention belongs to the technical field of pathogen detection. More particularly, to a multiplex qPCR kit for simultaneous detection of six respiratory pathogens.
Background
Respiratory tract infections are a common clinical condition caused by invasion and proliferation of pathogenic pathogens, such as fungi, bacteria, viruses or atypical pathogens. Respiratory tract infections are classified into upper respiratory tract infections and lower respiratory tract infections according to the location of the infection. If the upper respiratory tract infection is not treated in time, or the patient has poor immunity and mixed infection, the upper respiratory tract infection can progress to lower respiratory tract infection, which causes diseases such as tracheitis, bronchitis, pneumonia and the like, and seriously affects the health of the body.
Common pathogens that cause respiratory tract infections are Adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (Respiratory syncytial virus, RSV), mycoplasma pneumoniae (Mycoplasma pneumonia, MP), rhinovirus (HRV), and chlamydia pneumoniae (Chlamydia pneumonia, CP), among others, which are susceptible to other organs if not found to be treated in time. Although the pathogen types are different, the symptoms caused by respiratory pathogens are similar and mixed infection is multiple, and the sensibilities of different pathogens to the same medicine are greatly different. Therefore, detection of the type of respiratory pathogen, targeted administration of drugs against the pathogen being infected, is critical for timely and accurate treatment of respiratory infections.
Currently, laboratory detection of respiratory pathogens includes virus isolation and identification, immunofluorescence, serological detection, multiplex fluorescence PCR, and the like. Wherein, the virus culture process is complex, and the positive rate is low; the immunological method has poor sensitivity and specificity; the serological identification is single in type, long in identification time and high in false positive rate, and is not suitable for detecting multiple pathogens in a large range rapidly and accurately. The multiplex fluorescence PCR method can detect multiple pathogens simultaneously in a tube reaction system and react with the change of the multiple pathogens, but because different primers or probes contained in the multiplex fluorescence PCR reaction system can interfere with each other, the existing products for simultaneously detecting multiple respiratory tract infection pathogens have the defects of low detection specificity, low detection sensitivity, poor repeatability and the like.
Disclosure of Invention
The invention aims to overcome the defects and the shortcomings of the prior art and provide a multiplex qPCR kit for simultaneously detecting six common respiratory pathogens, namely Adenovirus (ADV), human bocavirus (HBoV), respiratory Syncytial Virus (RSV), mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP).
The above object of the present invention is achieved by the following technical scheme:
the invention designs a plurality of groups of different qPCR primers and probes by analyzing genome sequences of Adenovirus (ADV), human bocavirus (HBoV), respiratory Syncytial Virus (RSV), mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP) and designing a plurality of groups of different qPCR primers and probes, thereby constructing a multiple qPCR kit for simultaneously detecting the pathogens. However, in the detection effect of the set primers and probes, the primers or the probes, the primer, the dimer among the probes, the cross interference and other factors can influence the accuracy and the sensitivity of the multiple qPCR detection system. For example, the detection specificity of individual primers and probes is poor; when the different primers and probes are combined together, the detection effect is obviously reduced compared with that of the single primer and the probe. In addition, pathogens such as adenovirus and the like have multiple serotypes, and the detection effect is also affected by introducing degenerate bases when designing corresponding multiplex qPCR primers and probes. After continuous design and adjustment, the invention successfully constructs a multiple qPCR kit which has good detection specificity, high sensitivity, good repeatability and high detection accuracy and can be used for simultaneously detecting Adenovirus (ADV), human bocavirus (HBoV), respiratory Syncytial Virus (RSV), mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP).
The invention provides a multiple qPCR kit for simultaneously detecting six respiratory pathogens, which comprises qPCR reaction liquid A1 and qPCR reaction liquid A2; wherein the qPCR reaction solution A1 contains multiple qPCR primers and probes for detecting adenovirus, human bocavirus and respiratory syncytial virus; the qPCR reaction solution A2 contains multiple qPCR primers and probes for detecting mycoplasma pneumoniae, rhinoviruses and chlamydia pneumoniae.
The sequences of the multiple qPCR primers and probes for detecting adenovirus in the qPCR reaction liquid A1 are sequentially shown in SEQ ID NO. 1-3, the sequences of the multiple qPCR primers and probes for detecting human bocavirus are sequentially shown in SEQ ID NO. 4-6, and the sequences of the multiple qPCR primers and probes for detecting respiratory syncytial virus are sequentially shown in SEQ ID NO. 7-10; the sequences of the multiple qPCR primers and probes for detecting the mycoplasma pneumoniae in the qPCR reaction liquid A2 are sequentially shown in SEQ ID NO. 11-13, the sequences of the multiple qPCR primers and probes for detecting the rhinoviruses are sequentially shown in SEQ ID NO. 14-16, and the sequences of the multiple qPCR primers and probes for detecting the chlamydia pneumoniae are sequentially shown in SEQ ID NO. 17-19; different fluorescent emission groups are marked at the 5' ends of different probes in the same qPCR reaction liquid.
Specifically, the 5 'end of the probe for detecting adenovirus is marked with a fluorescent group FAM, and the 3' end is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the human bocavirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the respiratory syncytial virus is marked with a fluorescent group Texas red, and the 3' end is marked with a quenching group BHQ2; the 5 'end of the probe for detecting mycoplasma pneumoniae is marked with a fluorescent group FAM, and the 3' end of the probe is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the rhinovirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the probe for detecting the chlamydia pneumoniae is marked with a fluorescent group Texas red at the 5 'end and a quenching group BHQ2 at the 3' end.
Besides qPCR primers and probes for detecting respiratory pathogens, the qPCR reaction liquid A1 and the qPCR reaction liquid A2 also contain internal standard primers and internal standard probes for detecting internal standard RNase P, and the sequences of the internal standard primers and the internal standard probes are shown as SEQ ID NO. 20-22 in sequence; the 5' end of the internal standard probe is marked with a fluorescent group different from other probes.
Specifically, the 5 'end of the internal standard probe is marked with a fluorescent group Cy5, and the 3' end is marked with a quenching group BHQ2.
As an alternative embodiment, the invention obtains the corresponding qPCR reaction solution by adding qPCR primers and probes for detecting respiratory pathogens into the qPCR reaction buffer solution.
Specifically, mgCl in the qPCR reaction buffer 2 The concentration of (2-5 mM), the concentration of KCL (20-50 mM) and the concentration of Tris-HCL (20-50 mM). Namely MgCl in the qPCR reaction solution A1 and the qPCR reaction solution A2 2 The concentration of (2-5 mM), the concentration of KCL (20-50 mM) and the concentration of Tris-HCL (20-50 mM).
Specifically, the concentrations of the primer and the probe contained in the qPCR reaction liquid A1 and the qPCR reaction liquid A2 are each 0.1 to 1. Mu.M.
Besides qPCR reaction liquid, the kit also contains an enzyme system mixture, wherein the enzyme system mixture contains dNTPs, taq enzyme and MMLV enzyme.
Specifically, the concentration of dNTPs is 0.2-0.4 mM; the concentration of Taq enzyme is 2.5-10U, and the concentration of MMLV enzyme is 2.5-10U.
Specifically, dATP in dNTPs: dUTP: dCTP: dGTP: the concentration ratio of dTTP is 2:3:2:2:1.
in addition, the kit also comprises a positive quality control product and a negative quality control product; the positive quality control product is a pseudovirus containing target gene amplified fragments and internal standard amplified fragments of the adenovirus, the human bocavirus, the respiratory syncytial virus, the chlamydia pneumoniae, the rhinovirus and the mycoplasma pneumoniae; the negative quality control product is a pseudovirus containing internal standard amplified fragments.
When the kit is used for detection, the reaction system is as follows: qPCR reaction solution A1 or A2 17. Mu.L, enzyme mixture 3. Mu.L, and nucleic acid of sample to be tested 10. Mu.L.
The reaction conditions are as follows: 50 ℃,2min,95 ℃,5min,1 cycle; 95 ℃,5sec,60 ℃,35sec,45 cycles.
The invention has the following beneficial effects:
the invention provides a multiplex qPCR kit capable of simultaneously detecting adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae, and has the advantages of good detection specificity, high sensitivity, good repeatability and no interference by interfering substances. The kit is simple to operate when being used for detecting adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus or chlamydia pneumoniae, consumes short time, can detect the six different common pathogens of respiratory tract infection at one time through a two-tube reaction system, has accurate detection results, is suitable for clinical rapid detection of respiratory tract pathogens, and is beneficial to timely and correctly treating the infected pathogens.
Drawings
FIG. 1 shows the results of a specific test of the kit of the present invention.
FIG. 2 shows the detection results of internal standards in the specific test process of the kit of the present invention.
FIG. 3 shows the detection results of adenovirus in actual clinical samples by the kit of the invention.
FIG. 4 shows the detection result of human bocavirus in actual clinical samples by the kit of the present invention.
FIG. 5 shows the results of the kit of the present invention for detecting respiratory syncytial virus in an actual clinical sample.
FIG. 6 shows the results of the detection of Chlamydia pneumoniae in an actual clinical sample using the kit of the present invention.
FIG. 7 shows the results of rhinovirus detection in actual clinical samples using the kit of the present invention.
FIG. 8 shows the results of the detection of Mycoplasma pneumoniae in an actual clinical sample by the kit of the present invention.
FIG. 9 shows the results of detection of the primer MP-F2/MP-R2 and the probe MP-P2 with respect to physiological saline.
FIG. 10 shows the results of single and multiplex qPCR detection of Mycoplasma pneumoniae by primer MP-F3/MP-R3 and probe MP-P3.
FIG. 11 shows the comparison of the detection of Chlamydia pneumoniae by the multiplex qPCR reaction system (comparative multiplex detection system) used in comparative example 2 and the multiplex qPCR reaction system (joint detection system) described in example 2.
FIG. 12 shows the comparison of the detection of rhinoviruses by the multiplex qPCR reaction system (comparative multiplex detection system) used in comparative example 2 and the multiplex qPCR reaction system (joint detection system) described in example 2.
Detailed Description
The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.
Reagents and materials used in the following examples are commercially available unless otherwise specified.
Example 1 design of multiplex qPCR primers and probes and establishment of detection method
1. Design and determination of multiplex qPCR primers and probes
The invention obtains a group of multiplex qPCR primers and probes for simultaneously detecting adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae by comparing sequences of Adenovirus (ADV), human bocavirus (HBoV), respiratory Syncytial Virus (RSV), mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP) through the processes of designing primers, experimental verification screening, adjusting re-verification and the like, the sequences of the primers and the probes are shown in table 1, and a corresponding detection method is established. In addition, the invention selects a human gene RNase P (ribonuclease P; genebank number: AK 296196.1) as an internal standard, and designs a corresponding qPCR primer and a corresponding probe based on the gene for monitoring the collection and extraction processes of the sample, thereby preventing false negative caused by failure in extracting the nucleic acid of the sample.
TABLE 1 multiplex qPCR primer and probe sequences
Figure BDA0003989035350000051
Figure BDA0003989035350000061
The primer and probe sequences for detecting adenovirus, respiratory syncytial virus and rhinovirus contain degenerate bases; wherein S represents a base G or C, R represents a base A or G, K represents a base G or T, V represents a base G, A or C, M represents a base A or C, and Y represents a base C or T.
According to the invention, degenerate bases are introduced into specific positions of the primers and the probes, or one more primer is designed while degenerate bases are introduced, so that detection of adenovirus (adenovirus type 1, adenovirus type 2, adenovirus type 3, adenovirus type 4, adenovirus type 5, adenovirus type 7 and adenovirus type 55) of different types, respiratory syncytial virus (respiratory syncytial virus type A and respiratory syncytial virus type B) and rhinovirus (rhinovirus type A, respiratory syncytial virus type B and respiratory syncytial virus type C) is realized, detection specificity and sensitivity of the primers and the probes are ensured, and detection accuracy is ensured.
In this embodiment, the 5 'end of the probe for detecting adenovirus is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ1; the 5 'end of the probe for detecting the human bocavirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the respiratory syncytial virus is marked with a fluorescent group Texas red, and the 3' end is marked with a quenching group BHQ2; the 5 'end of the probe for detecting mycoplasma pneumoniae is marked with a fluorescent group FAM, and the 3' end of the probe is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the rhinovirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the chlamydia pneumoniae is marked with a fluorescent group Texas red, and the 3' end of the probe is marked with a quenching group BHQ2; the 5 'end of the internal standard probe is marked with a fluorescent group Cy5, and the 3' end is marked with a quenching group BHQ2.
2. Establishment of detection method
Based on the multiplex qPCR primers and probes shown in Table 1, the invention constructs a corresponding detection method by using pseudoviruses containing the target genes and internal standard fragments of the adenovirus, the human bocavirus, the respiratory syncytial virus, the chlamydia pneumoniae, the rhinovirus and the mycoplasma pneumoniae to detect the adenovirus, the human bocavirus, the respiratory syncytial virus, the mycoplasma pneumoniae, the rhinovirus and the chlamydia pneumoniae simultaneously; primers and probes shown in Table 1 were divided into 2 groups, and the six different common pathogens of respiratory tract infection were detected at one time by a two-tube reaction system.
The reaction system is as follows: qPCR reaction solution A1 or qPCR reaction solution A2. Mu.L, enzyme system mixture 3. Mu.L, and nucleic acid of sample to be tested 10. Mu.L. Wherein the qPCR reaction solution A1 contains multiple qPCR primers and probes for detecting adenovirus, human bocavirus and respiratory syncytial virus and qPCR reaction buffer solution; the qPCR reaction solution A2 contains multiple qPCR primers and probes for detecting mycoplasma pneumoniae, rhinoviruses and chlamydia pneumoniae and qPCR reaction buffer solution; the qPCR reaction liquids A1 and A2 also contain internal standard primers and internal standard probes; the enzyme system mixture contains dNTPs, taq enzyme and MMLV enzyme.
The qPCR reaction buffer solution contains MgCl 2 KCL and Tris-HCl.
The reaction procedure is as follows: 50 ℃,2min,95 ℃,5min,1 cycle; 95 ℃,5sec,60 ℃,35sec (collecting fluorescence), 45 cycles.
The invention also optimizes the concentration of each component in the qPCR reaction liquid A1, the qPCR reaction liquid A2 and the enzyme system mixture. Under the condition that the concentration of other components is unchanged, qPCR detection is carried out by respectively diluting the concentrations of qPCR primers and probes in the qPCR reaction liquid A1 and the qPCR reaction liquid A2 to 0.1 mu M, 0.5 mu M and 1 mu M; mgCl in qPCR reaction buffer 2 qPCR detection was performed at a concentration of 2mM, 3.5mM, 5 mM; qPCR detection is carried out by diluting KCL concentration in qPCR reaction buffer solution to 20mM, 35mM and 50mM; qPCR detection is carried out by diluting the concentration of Tris-HCL in qPCR reaction buffer solution to 20mM, 35mM and 50mM; qPCR detection is carried out by diluting the concentration of dNTPs in the enzyme system mixture (dATP: dUTP: dCTP: dGTP: dTTP concentration ratio is 2:3:2:2:1) to 0.2mM, 0.3mM and 0.4mM; diluting the concentration of Taq enzyme to 2.5U, 6U and 10U for qPCR detection; the MMLV enzyme is diluted to 2.5U, 6U and 10U for qPCR detection, so as to find that each component is suitable for qPCR detectionIs a concentration of (3).
The result shows that in the constructed reaction system, the applicable concentration range of the multiplex qPCR primer and the probe is 0.1-1 mu M, mgCl 2 The applicable concentration range of (1) is 2-5 mM, the applicable concentration range of KCL and Tris-HCL is 20-50 mM, the applicable concentration range of dNTPs is 0.2-0.4 mM, the applicable concentration range of Taq enzyme is 2.5U-10U, and the applicable concentration range of MMLV enzyme is 2.5U-10U; each component is applicable in the above concentration range and the difference in detection efficiency is not large.
Example 2 multiplex qPCR kit for detection of six respiratory pathogens
Based on the multiplex qPCR primers, probes and detection methods described in example 1, the present invention also provides a multiplex qPCR kit useful for simultaneous detection of Adenovirus (ADV), human bocavirus (HBoV), respiratory Syncytial Virus (RSV), mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP).
1. Composition of the kit
The multiplex qPCR kit for detecting various respiratory pathogens comprises qPCR reaction liquid A1, qPCR reaction liquid A2, an enzyme system mixture, a positive quality control product and a negative quality control product.
The qPCR reaction solution A1 contains multiple qPCR primers and probes (shown in table 1) for detecting adenovirus, human bocavirus and respiratory syncytial virus and qPCR reaction buffer solution, the concentration of the multiple qPCR primers and probes in the reaction solution A1 is 0.1-1 mu M, and the concentration of MgCl is 0.1-1 mu M 2 The concentration of (2) to (5) mM, the concentration of KCL to (20) to (50) mM and the concentration of Tris-HCL to (20) to (50) mM;
the qPCR reaction solution A2 contains a multiplex qPCR primer and a probe (shown in table 1) for detecting mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae and a qPCR reaction buffer solution, wherein the concentrations of the multiplex qPCR primer and the probe are 0.1-1 mu M and MgCl 2 The concentration of (2) to (5) mM, the concentration of KCL to (20) to (50) mM and the concentration of Tris-HCL to (20) to (50) mM;
the qPCR reaction solutions A1 and A2 also contain internal standard primers and probes (shown in table 1), and the concentration of the internal standard primers and the probes is 0.1-1 mu M;
the enzyme system mixture contains dNTPs, taq enzyme and MMLV enzyme, wherein the concentration of the dNTPs is 0.2-0.4 mM, and dATP in the dNTPs is as follows: dUTP: dCTP: dGTP: the concentration ratio of dTTP is 2:3:2:2:1, the concentration of Taq enzyme is 2.5-10U, and the concentration of MMLV enzyme is 2.5-10U;
the positive quality control product is a pseudo virus containing the target genes and internal standard fragments of the adenovirus, the human bocavirus, the respiratory syncytial virus, the chlamydia pneumoniae, the rhinovirus and the mycoplasma pneumoniae;
the negative quality control product is a pseudovirus containing internal standard fragments.
2. Method for using kit
The invention also provides a using method of the kit, which comprises the following steps:
s1, extracting nucleic acid of a sample to be detected; the reagent used for extracting the sample nucleic acid in the embodiment of the invention is a nucleic acid extraction or purification reagent (Guangzhou Dan gene stock, guangzhou Ke mechanical equipment 20170583), and positive quality control products and negative quality control products synchronously participate in extraction;
s2, performing qPCR reaction; taking 10 mu L of extracted sample nucleic acid, adding qPCR reaction liquid A1 or qPCR reaction liquid A2 (17 mu L) and enzyme system mixture (3 mu L), and performing amplification reaction in a real-time fluorescence PCR instrument; the reaction procedure is: 50 ℃,2min,95 ℃,5min,1 cycle; 95 ℃,5sec,60 ℃,35sec (collecting fluorescence), 45 cycles;
s3, judging a result; the fluorescence channel sequentially selects FAM, VIC, texas red and Cy5, and after qPCR is finished, the negative and positive of the corresponding pathogen nucleic acid are judged through different fluorescence channel curves and Ct values;
when the Ct value corresponding to each channel is less than or equal to the positive judgment value 40 and the amplification curve has obvious exponential growth, the detection result of the corresponding channel is judged to be positive; when the Ct value is larger than the positive judgment value 40 or no Ct value, the corresponding channel is judged to be negative; the method comprises the following steps:
Figure BDA0003989035350000091
note that:
1. RP6 PCR reaction tube 1 is a reaction tube for detecting Adenovirus (ADV), human bocavirus (HBoV) and Respiratory Syncytial Virus (RSV); RP6 PCR reaction tube 2 is a reaction tube for detecting Mycoplasma Pneumoniae (MP), rhinovirus (HRV) and Chlamydia Pneumoniae (CP).
2. When FAM, VIC and TEXAS RED detection channels are positive, cy5 channel (internal standard channel) results may be negative due to the competing relationship of the system.
3. If the internal standard result is negative, if the FAM, VIC and TEXAS RED detection channels of the detection tube are also negative, the test is invalid, and the sample needs to be rechecked.
Example 3 sensitivity test
This example tested the detection sensitivity of the kit described in example 2. Taking inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae with defined values as initial samples, and respectively diluting to a concentration of 10 5 、10 4 、10 3 Respectively adding 10 final concentrations into samples with different concentrations obtained by dilution, 200, 100copies/mL 4 The samples/mL of plasmid bacteria containing internal standard amplified fragments are taken as samples to be detected, sample nucleic acids are respectively extracted, the extracted sample nucleic acids are taken as templates, 3 different batches of kits are used for detection, each batch is repeated 20 times, sensitivity detection is carried out, a reaction system and a reaction program are carried out according to the example 2, and the negative and positive of the corresponding pathogen nucleic acids are judged through different fluorescent channel curves and Ct values.
The test results of the sensitivity of the kit described in the embodiment 2 of the invention to adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae show that when the sample concentration is 200copies/mL or more, the Ct values of adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae samples are all less than or equal to 40, and the amplification curve is obviously exponentially increased; meanwhile, the detection results of the internal standard are positive, and the detection results are reliable, which shows that the detection sensitivity of the kit disclosed by the embodiment 2 of the invention is 200copies/mL (100 copies/mL can be detected, but the detection rate is slightly lower than 95%).
Example 3 specificity test
In order to detect the detection specificity of the kit described in example 2 of the present invention, the present invention selects other common pathogens and physiological saline for specificity testing. The detection specificity of the kit constructed in the embodiment 2 of the invention is tested by taking normal saline, influenza A virus, influenza B virus, cytomegalovirus, klebsiella pneumoniae, legionella pneumophila, streptococcus pneumoniae, pertussis bacillus, parainfluenza virus type I and EB virus as specific references.
The detection results of other common pathogens and physiological saline, namely the specific detection results of the kit disclosed by the invention are shown in figure 1, and in the specific test, the detection results of the internal standard are shown in figure 2. As can be seen from FIGS. 1 and 2, the kit provided by the invention has no amplification curve when detecting other common pathogens, and shows that the kit provided by the invention has good detection specificity and can specifically detect adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae.
EXAMPLE 4 precision test
In this example, the detection precision of the kit described in example 2 was measured. Mixing inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus, and mycoplasma pneumoniae with defined values, and using as precision reference, wherein the final concentration of each pathogen in the precision reference is 10 respectively 4 And 500copies/mL, the test was repeated 10 times each with reference to the method of using the kit described in example 2, and the coefficient of variation of each concentration precision reference was calculated.
The variation coefficients of the kit of the embodiment 2 of the invention on adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae precision reference products with different concentrations are shown in table 2.
TABLE 2 coefficient of variation for precision references at different concentrations
Figure BDA0003989035350000101
Figure BDA0003989035350000111
As shown in Table 2, the kit of the embodiment 2 of the invention has good detection precision, namely, the kit has good detection repeatability, and the variation coefficients of the kit on adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae precision reference products with different concentrations are all less than 2%.
Example 5 accuracy test
The invention respectively prepares 5 parts of medium-low concentration (the specific concentration is respectively 10 4 ，10 3 200 copies/mL) adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae inactivated cultures were used as positive references, and after extraction of sample nucleic acids, detection was performed as described in example 2.
The detection result shows that the detection results of the kit disclosed by the embodiment 2 of the invention on the positive reference products corresponding to all pathogens are positive, the detection result is accurate, and the primers and the probes in the reaction system do not have cross reaction with other pathogens. For example, when the sample is adenovirus, there is no amplification curve for the remaining primers and probes used to detect human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae.
Example 6 test of interfering substances
This example tests the ability of the kit of example 2 to resist interference. To adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae inactivated cultures having a concentration of 500copies/mL, 5% whole blood, 5% mucus, spectinomycin (100 mg/L), penicillin (0.5 mg/mL), tetracycline (5 mg/L), ofloxacin (3.06 mg/L) and azithromycin (0.45 mg/L) were added as interfering substance test samples, and the effect of the interfering substances on primer probe amplification was tested by using adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae inactivated cultures having a concentration of 500copies/mL, which did not contain the interfering substances, as a control.
The detection results of the kit in the embodiment 2 of the invention on adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae added with interfering substances show that the detection effects of the kit in the invention on human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae are not affected by the adding of the interfering substances.
Example 7 actual detection of clinical samples
The invention collects clinical samples of suspected cases of upper respiratory tract infection, and the actual detection of the clinical samples is carried out by using the kit described in the example 2.
1. Extraction of nucleic acid from clinical test sample
Collecting 30 oropharynx swab clinical samples of suspected cases of upper respiratory tract infection and 30 nasopharynx swab clinical samples of suspected cases of upper respiratory tract infection, wherein 60 clinical samples are taken, nucleic acid of the clinical samples to be detected is respectively extracted by using a nucleic acid extraction or purification reagent (Guangzhou Dansheng Jiechi 20170583) produced by Guangzhou Daan gene Co., ltd, and positive quality control products and negative quality control products in the kit participate in extraction synchronously; 10. Mu.L of the extracted nucleic acid sample was taken, and the amplification reaction was performed by referring to the method using the kit described in example 2, and after qPCR was completed, the negative and positive of the corresponding pathogen nucleic acid were judged by using different fluorescent channel curves and Ct values, and the judgment method was the same as in example 2.
Among the 60 clinical samples of the detected suspected respiratory tract infection, 11 adenovirus positive clinical samples (including 2 adenovirus and rhinovirus mixed infection clinical samples), 4 human bocavirus positive clinical samples, 10 respiratory syncytial virus positive clinical samples, 3 mycoplasma pneumoniae positive clinical samples, 6 rhinovirus positive clinical samples and 1 chlamydia pneumoniae positive clinical samples are detected in total. The detection results of the kit provided by the invention on adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae in actual clinical samples are shown in figures 3-8 in sequence. The invention also carries out sequencing on the amplification result of the positive clinical sample, and the sequencing comparison result is the same as the detection result of the kit, which shows that the detection accuracy of the kit reaches 100 percent, and further proves the clinical detection accuracy of the detection system and the detection method for simultaneously detecting six respiratory pathogens constructed by the invention.
Comparative example 1
According to the invention, tens of groups of qPCR primers and probes are designed for target nucleic acid sequences of adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae by using primer design software, but the specificity of individual primer pairs is found to be unsatisfied by single-channel test detection. For example, the primer MP-F2/MP-R2 and probe MP-P2 for detecting mycoplasma pneumoniae designed by the invention have the following sequences:
mycoplasma pneumoniae upstream primer MP-F2: CAACGCACCCTACTACTTCCAC
Mycoplasma pneumoniae downstream primer MP-R2: GTTCTTGTCCTCTCAGGGCTT
Mycoplasma pneumoniae detection probe MP-P2:5'-FAM-TCCAATCCAAAGTGTGGTTGATGC CT BHQ1-3'
The invention uses the primer MP-F2/MP-R2 and the probe MP-P2, takes physiological saline as a sample to carry out blank detection, the detection result is shown in figure 9, and the detection result shows that the non-specific amplification occurs in the detection of the primer MP-F2/MP-R2 and the probe MP-P2 as shown in figure 9.
In addition, the detection effect is good when some primers and probes (such as MP-F3/MP-R3 and MP-P3) are singly detected, but when the primers and probes are combined with detection primers and probes of other pathogens, the detection effect is reduced when the multiplex qPCR reaction is carried out, and the multiplex qPCR system is not suitable for a multiplex qPCR system.
The sequences of the primer MP-F3/MP-R3 and the probe MP-P3 for detecting mycoplasma pneumoniae designed by the invention are as follows:
mycoplasma pneumoniae upstream primer MP-F3: GTACAGACCATTCCACCCAGC
Mycoplasma pneumoniae downstream primer MP-R3: GTTACCACTACTCGTCCCAAATAC
Mycoplasma pneumoniae detection probe MP-P3:5'-FAM-CAGCCCCAATCGCTCAAAACAAC BHQ1-3'
Specifically, the primer MP-F3/MP-R3 and the probe MP-P3 for detecting mycoplasma pneumoniae replace the primer and the probe for detecting mycoplasma pneumoniae in the qPCR reaction solution A2, and nucleic acid of a positive mycoplasma pneumoniae sample is used as a sample for detection, and the reaction system and the conditions are the same as in example 2. As shown in FIG. 10, the detection results of MP-F3, MP-R3 and MP-P3 are shown in FIG. 10, and the specificity and sensitivity of the primer pair to the target nucleic acid of the mycoplasma pneumoniae target gene are better in a single detection system, but the amplification of the low-concentration nucleic acid of the mycoplasma pneumoniae target gene is obviously inhibited in a multiple detection system, and the primers MP-F3, MP-R3 and MP-P3 cannot be applied to the multiple detection system.
Comparative example 2
In addition, the invention discovers that even for the primers and probes with good detection specificity and high sensitivity obtained by screening, the detection effect is not necessarily good when the primers and probes of different pathogens are combined together to construct a multiplex qPCR system. For example, the present invention has been to combine the primers and probes for detection of adenovirus, chlamydia pneumoniae and respiratory syncytial virus in example 1 into a multiplex qPCR reaction system, and to combine the primers and probes for detection of Mycoplasma pneumoniae, human Bocha virus and rhinovirus in example 1 into a multiplex qPCR reaction system, and to detect inactivated cultures of adenovirus, human Bocha virus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and Mycoplasma pneumoniae using the detection method described in example 1. The comparative results of the detection of chlamydia pneumoniae by the multiplex qPCR reaction system (comparative multiplex detection system) used in this comparative example and the multiplex qPCR reaction system (joint detection system) described in example 2 of the present invention are shown in fig. 11, and the comparative results of the detection of rhinoviruses by the multiplex qPCR reaction system (comparative multiplex detection system) used in this comparative example and the multiplex qPCR reaction system (joint detection system) described in example 2 of the present invention are shown in fig. 12. As can be seen from fig. 11 and 12, in the present comparative example, the primer and probe combinations for detecting chlamydia pneumoniae were suppressed by the multiplex system, the peak fluorescence height was reduced and the CT value was back compared with the detection results of the multiplex qPCR detection system determined by the present invention (fig. 11); the primer and probe combinations for detecting rhinoviruses had poor amplification efficiency in multiplex systems and reduced low concentration peak curves (FIG. 12), indicating that the multiplex detection combination of this comparative example was not suitable for the combined detection of adenovirus, human bocavirus, respiratory syncytial virus, chlamydia pneumoniae, rhinovirus and mycoplasma pneumoniae.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. A multiple qPCR kit for simultaneously detecting six respiratory pathogens, which is characterized by comprising qPCR reaction liquid A1 and qPCR reaction liquid A2; wherein the qPCR reaction solution A1 contains multiple qPCR primers and probes for detecting adenovirus, human bocavirus and respiratory syncytial virus; the qPCR reaction solution A2 contains multiple qPCR primers and probes for detecting mycoplasma pneumoniae, rhinoviruses and chlamydia pneumoniae;
the sequences of the multiple qPCR primers and probes for detecting adenovirus in the qPCR reaction liquid A1 are sequentially shown in SEQ ID NO. 1-3, the sequences of the multiple qPCR primers and probes for detecting human bocavirus are sequentially shown in SEQ ID NO. 4-6, and the sequences of the multiple qPCR primers and probes for detecting respiratory syncytial virus are sequentially shown in SEQ ID NO. 7-10; the sequences of the multiple qPCR primers and probes for detecting the mycoplasma pneumoniae in the qPCR reaction liquid A2 are sequentially shown in SEQ ID NO. 11-13, the sequences of the multiple qPCR primers and probes for detecting the rhinoviruses are sequentially shown in SEQ ID NO. 14-16, and the sequences of the multiple qPCR primers and probes for detecting the chlamydia pneumoniae are sequentially shown in SEQ ID NO. 17-19; different fluorescent emission groups are marked at the 5' ends of different probes in the same qPCR reaction liquid.
2. The kit according to claim 1, wherein the probe for detecting adenovirus is labeled at the 5 'end with a fluorescent group FAM and at the 3' end with a quenching group BHQ1; the 5 'end of the probe for detecting the human bocavirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the respiratory syncytial virus is marked with a fluorescent group Texas red, and the 3' end is marked with a quenching group BHQ2; the 5 'end of the probe for detecting mycoplasma pneumoniae is marked with a fluorescent group FAM, and the 3' end of the probe is marked with a quenching group BHQ1; the 5 'end of the probe for detecting the rhinovirus is marked with a fluorescent group VIC, and the 3' end is marked with a quenching group BHQ1; the probe for detecting the chlamydia pneumoniae is marked with a fluorescent group Texas red at the 5 'end and a quenching group BHQ2 at the 3' end.
3. The kit according to claim 1, wherein the qPCR reaction liquid A1 and the qPCR reaction liquid A2 further comprise an internal standard primer and an internal standard probe for detecting internal standard RNase P, and the sequences of the internal standard primer and the internal standard probe are shown as SEQ ID NO. 20-22 in sequence; the 5' end of the internal standard probe is marked with a fluorescent group different from other probes.
4. The kit according to claim 3, wherein the internal standard probe is labeled with a fluorescent group Cy5 at the 5 'end and a quenching group BHQ2 at the 3' end.
5. The kit according to any one of claims 1 to 4, wherein the concentrations of the primer and the probe contained in the qPCR reaction solution A1 and the qPCR reaction solution A2 are each 0.1 to 1. Mu.M.
6. The kit according to any one of claims 1 to 4, wherein the qPCR reaction solution A1 and the qPCR reaction solution A2 further comprise a qPCR reaction buffer solution, mgCl in the qPCR reaction buffer solution 2 The concentration of (2-5 mM), the concentration of KCL (20-50 mM) and the concentration of Tris-HCL (20-50 mM).
7. The kit according to any one of claims 1 to 4, further comprising an enzyme-based mixture comprising dNTPs, taq enzyme and MMLV enzyme.
8. The kit according to claim 7, wherein the concentration of dNTPs is 0.2 to 0.4mM; the concentration of Taq enzyme is 2.5-10U, and the concentration of MMLV enzyme is 2.5-10U.
9. The kit of claim 7, wherein dATP among the dNTPs: dUTP: dCTP: dGTP: the concentration ratio of dTTP is 2:3:2:2:1.
10. the kit according to any one of claims 1 to 4, wherein the kit further comprises a positive quality control and a negative quality control; the positive quality control product is a pseudovirus containing target gene amplified fragments and internal standard amplified fragments of the adenovirus, the human bocavirus, the respiratory syncytial virus, the chlamydia pneumoniae, the rhinovirus and the mycoplasma pneumoniae; the negative quality control product is a pseudovirus containing internal standard amplified fragments.
CN202211573467.6A 2022-12-08 2022-12-08 Multiple qPCR kit for simultaneously detecting six respiratory pathogens Pending CN116121414A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211573467.6A CN116121414A (en) 2022-12-08 2022-12-08 Multiple qPCR kit for simultaneously detecting six respiratory pathogens

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211573467.6A CN116121414A (en) 2022-12-08 2022-12-08 Multiple qPCR kit for simultaneously detecting six respiratory pathogens

Publications (1)

Publication Number Publication Date
CN116121414A true CN116121414A (en) 2023-05-16

Family

ID=86298270

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211573467.6A Pending CN116121414A (en) 2022-12-08 2022-12-08 Multiple qPCR kit for simultaneously detecting six respiratory pathogens

Country Status (1)

Country Link
CN (1) CN116121414A (en)

Similar Documents

Publication Publication Date Title
CN111020064B (en) Novel coronavirus ORF1ab gene nucleic acid detection kit
EP3882364B1 (en) Dual detection kit for 2019 novel corona virus
WO2021174984A1 (en) Rt-pcr detection method and kit for novel coronavirus
EP4101935A1 (en) Nucleic acid detection kit for novel coronavirus 2019-ncov
CN112063756B (en) Method and kit for multiple detection of respiratory virus nucleic acid
CN108300808A (en) A kind of African hog cholera virus fluorescent PCR detection kit, preparation method and application method
CN110273027B (en) Nucleic acid typing detection kit and detection method for norovirus GII, GII and GIV
CN111304368A (en) Method, oligonucleotide and kit for detecting novel coronavirus
WO2022089550A1 (en) Novel compositions and methods for coronavirus detection
CN113005226A (en) Oligonucleotide and kit for detecting SARS-CoV-2
CN112553373A (en) Kit and detection method for quickly detecting novel coronavirus 2019-nCoV nucleic acid
CN111270017A (en) Primer probe combination for detecting novel coronavirus based on digital PCR and application thereof
CN111926111A (en) High-flux identification and detection method for fifty-five common respiratory pathogens
CN113652505A (en) Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof
CN113930529B (en) Nucleic acid fragment, primer probe set, kit and application thereof for detecting mycoplasma pneumoniae
CN111808995A (en) Respiratory tract pathogen nucleic acid detection kit
CN114262759A (en) PCR primer group and kit for combined detection of multiple respiratory viruses
CN112501358B (en) Primer probe combination and kit for detecting 9 children digestive tract pathogens
CN111378787A (en) Novel coronavirus detection method
CN116024386B (en) Primer probe combination and kit for detecting novel coronaviruses and distinguishing Omicron different mutant strains
CN114634996B (en) Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit
CN114058742B (en) Primer probe composition, kit containing same and detection method thereof
CN116121414A (en) Multiple qPCR kit for simultaneously detecting six respiratory pathogens
CN112029901A (en) Reagent for improving specificity of nucleic acid amplification reaction, nucleic acid amplification reaction solution and kit
CN112126713A (en) Coronavirus and influenza virus combined detection product and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination