CN116103342A - Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system - Google Patents

Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system Download PDF

Info

Publication number
CN116103342A
CN116103342A CN202211612527.0A CN202211612527A CN116103342A CN 116103342 A CN116103342 A CN 116103342A CN 202211612527 A CN202211612527 A CN 202211612527A CN 116103342 A CN116103342 A CN 116103342A
Authority
CN
China
Prior art keywords
vector
cas9
sheep
crispr
pedigree
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211612527.0A
Other languages
Chinese (zh)
Inventor
于坤
邓守龙
许雪玲
李岩
连正兴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN202211612527.0A priority Critical patent/CN116103342A/en
Publication of CN116103342A publication Critical patent/CN116103342A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
    • Y02P60/87—Re-use of by-products of food processing for fodder production

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a pedigree tracing method for early embryo development of sheep based on a CRISPR-Cas9 system and a PB transposon system, in particular to a CRISPR-Cas9 mediated method for knocking out sheep Rosa26 genes and inserting Cas9-T2A-EGFP genes at fixed points, which is used for editing synthetic target DNA. The invention also provides pedigree tracing vectors mediated by synthetic target DNA. The vector contains 40 integrated barcodes and synthetic target DNA and corresponding three independently transcribed sgrnas. The synthetic target DNA was embedded on a PB transposon vector expressing the red fluorescent protein tdhamto. The system is capable of producing a large number of heritable repair results and distinguishing between these sequences by integrating barcodes. The pedigree tracing carrier system can directly transfect target cells, trace the target cells along with development, provide comprehensive molecular cell patterns of ruminant development, and has wide application prospect.

Description

Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a pedigree tracing method for early embryo development of sheep based on a CRISPR-Cas9 system and a PB transposon system.
Background
Cells are the basic unit of all organisms, and animal cells continue to migrate and differentiate as embryonic development begins. The state of the tracer cell has important significance for understanding the cell origin and fate, and the development and regeneration processes of tissues and organs and the occurrence mechanism of physiological diseases of organisms. The cell lineage tracing technology can trace the differentiation and development activities of specific single cells and offspring cells, and is applied to the fields of stem cell treatment, gene function research, organ transplantation, new drug development and the like. The CRISPR-Cas9 system can achieve efficient gene editing, including site-directed insertion, knockout, and mutation. After the CRISPR-Cas9 system cuts DNA, indels can be generated, different indel mutant sequences can be transmitted to offspring along with cell division to form a lineage tagged bar code, and the cell lineage tagging can be performed efficiently by combining a single cell sequencing technology. In recent years, artificially synthesized exogenous DNA barcodes are transferred into cells, and after target cutting, genome repair results are different and marks are generated after the target is edited by using CRISPR-Cas 9. In theory, the same source cells will carry a common imprint of their progenitor cells, and the analysis of the barcodes will allow the construction of lineage developmental trees for different cells. Thus, the cell lineage tracing technology has great development potential and application value.
In tracking how cells and their progeny change over time, the correct inference of lineage links between cells is currently a major bottleneck in ruminant cell lineage tracking technology. It is well known that the advent of single cell sequencing technology has greatly facilitated the development of multiple areas of developmental biology, cancer biology, and the like. Combining single cell sequencing technology with genetic tracing technology, accessing natural genetic markers accumulated in offspring through multiple cell divisions, and then deducing their lineage relationships through shared markers can improve the accuracy of developmental trajectory deduction, providing a systematic approach to trace the origin of cells.
Early embryonic development in mammals is determined by multiple levels of cell fate and is the most important molecular event in life. The research of early embryo pedigree establishment process, fate decisions of different germ layers and tissue precursor cells and the generation and development regulation mechanism thereof can not only prevent early development related diseases, guide cell differentiation and transdifferentiation, but also provide references for applying large animals to human organ reconstruction and tissue regeneration. Lineage tracing techniques can provide comprehensive molecular cytograms of animal development. In particular, the development is rapid in the last five six years, and more pedigree tracing technology development and experimental research results are found in International journal, which becomes an important discussion of the International biology field. However, so far, cell lineage tracing is mainly carried out by model animals such as nematodes, zebra fish and mice, and higher mammals have not been reported. Large animals such as sheep are not only important economic animals, but also more similar to human in terms of certain organ structures, sizes and physiological metabolism, and are ideal organ reconstruction and biological medicine models. Therefore, there is a need to develop lineage tracing techniques for early embryonic development in ruminants, observing the fate map of organ tissue formation.
Disclosure of Invention
The invention aims to provide a pedigree tracing method for sheep early embryo development based on a CRISPR-Cas9 system and a PB transposon system.
The invention is characterized in that a CRISPR-Cas9 technology is utilized, sheep Rosa26 gene is taken as a target point, cas9-T2A-EGFP is inserted in a fixed point, and a promoter CMV is utilized to enable the gene to be over-expressed in an early embryo. Meanwhile, three Cas9 targets forming a tandem array in the 3' utr of the red fluorescent protein tdbitmap were introduced into the genome using the PB transposon. The edited target spots are accumulated through multiple rounds of cell division, and then the sequences are distinguished through 40 8 base pair integration barcodes among the 3' UTR of tdTomato and three Cas9 target spots, so that the method can be used for researching the pedigree of sheep embryo development and reconstructing the pedigree hierarchical structure of different cells.
To achieve the object of the present invention, in a first aspect, the present invention provides a vector system for ruminant lineage tracing, consisting of 40 vectors for ruminant lineage tracing, wherein each vector carries a different integrated barcode intBC;
the vector for ruminant pedigree tracing is constructed by inserting a pedigree tracing vector into a PB transposon vector expressing red fluorescent protein;
the lineage tagged vector includes an integration barcode intBC, a synthetic target DNA sequence, and three independently transcribed sgrnas targeting the synthetic target DNA sequence.
Primers used to amplify 40 integrated barcode intBC sequences are shown in table 1:
TABLE 1 40 intBC primers
Figure BDA0003999709520000021
/>
Figure BDA0003999709520000031
/>
Figure BDA0003999709520000041
Further, the lineage tracing carrier comprises the following structure: integration of the barcode intBC-synthetic target DNA sequence-bGH poly (A) -three independently transcribed sgRNAs.
The synthetic target DNA sequence comprises three sites ade2, bam3 and white B, which are respectively marked as sites 1-3, and the nucleotide sequence is shown as SEQ ID NO. 6;
the three independently transcribed sgrnas are respectively targeted to the sites 1 to 3, wherein the sgrnas of the targeted site 1 are controlled by the mU6 promoter, the sgrnas of the targeted site 2 are controlled by the mU6 promoter, and the sgrnas of the targeted site 3 are controlled by the bU6 promoter.
Further, in the structure of the pedigree tracing vector, the nucleotide sequence of the synthesized target DNA sequence-bGH poly (A) -three independently transcribed sgRNAs is shown as SEQ ID NO. 7.
Further, the vector for ruminant pedigree tracing includes the following structure: EF 1. Alpha. Promoter-tdTomato-integration barcode intBC-synthetic target DNA sequence-bGH poly (A) -three independently transcribed sgRNAs.
In a second aspect, the invention provides the use of the carrier system in ruminant pedigree tracking.
In a third aspect, the invention provides a set of sheep early embryo development lineage tracer systems, comprising a sheep Rosa26 gene editing vector based on CRISPR-Cas9 technology and the vector system for ruminant lineage tracing.
The gene editing vector comprises a CRISPR-Cas9 targeting vector and a gene homologous recombination vector.
Wherein the CRISPR-Cas9 targeting vector contains DNA fragments encoding sgRNA sequences (sgRNA 1, sgRNA 2).
Preferably, the backbone carrier is PX458.
Preferably, the nucleotide sequences of the sgRNA action sites are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
The gene homologous recombination vector comprises Donor DNA and an element sequence for inserting the Donor DNA into the sheep Rosa26 gene through homologous end repair site.
Preferably, the Donor DNA is Cas9-T2A-EGFP.
Further, the gene homologous recombination vector comprises the following structure: left homology arm-CMV promoter-Cas 9-T2A-EGFP-bGH poly (a) -right homology arm.
Preferably, the nucleotide sequences of the left homology arm and the right homology arm are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4.
In a fourth aspect, the invention provides the use of the system in the tracking of early embryonic developmental lineages in sheep.
In a fifth aspect, the present invention provides a lineage tracing method for sheep early embryo development based on a CRISPR-Cas9 system and a PB transposon system, the method comprising: microinjection of the sheep early embryo development lineage tracer system into sheep prokaryotic embryos produced a large number of heritable indexes, combining 40 integration barcodes with the index of inducible CRISPR-Cas9, using single cell transcriptional sequencing technology to trace the development process of different cells.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
the invention utilizes the combination of a CRISPR-Cas9 system and a PB transposon system to improve and construct a set of pedigree tracing carrier system for ruminants. The vector system comprises an 8 base pair static integrated barcode intBC and 260 base pair synthetic target DNA (3 CRISPR/Cas cleavage sites). The synthetic DNA sequence is embedded in a PB transposon vector expressing a red fluorescent protein. Another vector for efficiently expressing EGFP-Cas9 based on Rosa26 safe site homologous recombination is used for editing and synthesizing target DNA. The system can generate a large number of heritable repair results and target sites, can be applied to ruminant systems in large scale, records lineages and other information with high resolution, reveals cell populations with continuous phenotype lineages, and is helpful for understanding the molecular mechanism from early embryo to organ formation stage so as to provide references for human organ reconstruction and tissue regeneration by ruminants.
The invention co-injects the homologous recombination vector and the targeting vector into sheep prokaryotic embryo in a microinjection mode, and the CMV promoter in the donor vector constructed by the Gibson Assembly method can realize stable expression of Cas9-T2A-EGFP in sheep embryo, so as to continuously edit the synthetic target DNA and continuously generate diversity in the whole tracing process.
The pedigree expression vector system constructed by the invention can directly transfect target cells, can track the target cells along with development, can simultaneously track the pedigree and analyze single cell level transcriptome in thousands of single cells by integrating bar codes, provides a systematic method for tracking the origin of novel cells or identifying known cell types under different conditions, has minimal influence on cell phenotype, does not involve the transformation and optimization of a gene editing system, has the advantages of simple operation, low cost and the like, and has great application value and market space.
Drawings
FIG. 1 is a diagram of two targeting vectors at the Rosa26 locus of sheep in a preferred embodiment of the invention.
FIG. 2 is a schematic diagram of a CRISPR-Cas9 gene editing targeting and homologous repair template of a sheep Rosa26 gene in a preferred embodiment of the invention, wherein the sequence shown in the figure is a corresponding targeting site (two sgRNAs) of the sheep Rosa26 gene; LHA and RHA represent a left homology arm and a right homology arm respectively, the lengths are 1017bp and 1004bp respectively, and the Cas9 gene to be integrated and the exogenous green fluorescence marker gene EGFP are arranged in a box.
FIG. 3 is a PCR amplification electrophoretogram of LHA (1069 bp after amplification), RHA (1060 bp after amplification) and Cas9-T2A-EGFP (6128 bp) vector fragments in the homologous recombination vector according to the preferred embodiment of the present invention.
FIG. 4 is a schematic diagram of the structure of a ruminant pedigree tracer carrier in accordance with a preferred embodiment of the invention.
Fig. 5 is a schematic diagram of ruminant pedigree tracing in a preferred embodiment of the invention.
FIG. 6 shows the result of the enzyme digestion electrophoresis of the homologous recombination vector according to the preferred embodiment of the present invention, wherein the fragment size is 8153bp.
FIG. 7 shows the spectrum tracing carrier enzyme digestion electrophoresis chart of the preferred embodiment of the invention, and the fragment size is 6072bp.
FIG. 8 is an in vitro transcription electrophoresis of sgRNA1, sgRNA2, PB enzyme mRNA and Cas9 mRNA according to the preferred embodiment of the present invention.
Figure 9 is a vector microinjection diagram of the homologous recombination sequences, the vector of the CRISPR-Cas9 system, the lineage trace vector in the preferred embodiment of the present invention.
FIG. 10 is a fluorescence detection chart of the development of sheep embryo to the period of E18.5 and E19.5 in the preferred embodiment of the invention.
FIG. 11 is a statistical chart of the number of intBC in embryo sample detection in accordance with the preferred embodiment of the present invention.
Detailed Description
The invention aims to provide a set of vectors for efficiently expressing EGFP-Cas9 based on homologous recombination of a Rosa26 locus of ruminants, and a pedigree tracing microinjection system for editing synthetic target DNA is provided, so that early embryo which can be used for pedigree tracing ruminant organ development is obtained, green and red fluorescence is expressed by the embryo, and various indexes are generated.
The invention provides gRNA locus for effectively editing Rosa26 locus of sheep in future, the obtained expression index embryo can accurately track a large number of cell sources, the reliability reduction caused by instability of fluorescent genetic tracing technology is avoided, and important animal materials are provided for research of organ development and xenograft in future, so that the invention has clinical application value.
Preferably, the gene editing is CRISPR-Cas9 mediated gene editing by homologous repair.
The invention adopts the following technical scheme:
in a first aspect, the invention provides two sgrnas that specifically target the sheep Rosa26 gene based on CRISPR-Cas9 technology.
The nucleotide sequences of the acting sites of the sgRNA1 and the sgRNA2 of the specific targeting sheep Rosa26 gene based on the CRISPR-Cas9 technology are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2.
In a second aspect, the invention provides a CRISPR-Cas9 targeting vector comprising the sgRNA1 and the sgRNA 2.
Preferably, the backbone carrier is PX458.
In a third aspect, the invention provides a donor vector with higher biological safety, which does not contain any eukaryotic screening marker, wherein the vector contains a CMV promoter, a target gene Cas9-T2A-EGFP, a transcription termination signal is bGH poly (A) signal, and left and right homology arm sequences for homologous recombination of a Rosa26 targeting site.
The target gene expression cassette structure is as follows: CMV-Cas9-T2A-EGFP-bGH poly (A).
The element sequence comprises a left homologous arm and a right homologous arm which are used for homologous recombination of a target site of the sheep Rosa26 gene, and the nucleotide sequences of the element sequence are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4.
The gene homologous recombination vector comprises the following structure: left homology arm-CMV promoter-Cas 9-T2A-EGFP-bGH poly (a) -right homology arm.
Preferably, the donor vector can be constructed by a Gibson Assembly method, and the defect that a proper enzyme cutting site is not available by adopting a traditional enzyme cutting connection method under the conditions of large sequence length and more connecting fragments is overcome by seamless connection.
In a fourth aspect, the invention provides a sheep Rosa26 gene editing vector developed based on a CRISPR-Cas9 technology, which comprises the CRISPR-Cas9 targeting vector and a gene homologous recombination vector.
Wherein the gene homologous recombination vector comprises a target gene Cas9-T2A-EGFP and an element sequence (homologous recombination DNA fragment) for inserting the target gene into the sheep Rosa26 gene through homologous end repair site-specific.
It is another object of the present invention to provide a method of constructing such lineage tracking ruminant organ development modeling.
The present invention provides a set of pedigree tracing vectors for ruminants, said vector system comprising 8 base pair static integrated barcodes intBC and 260 base pair synthetic target DNA (3 CRISPR/Cas cleavage sites) and three independent sgrnas.
In the present invention, the integrated barcode intBC consists of 8 base pairs, totaling 40 types.
The pedigree tracing carrier comprises the following structure: intBC (1-40) -260 base pairs of synthetic target gene-bGH poly (A) -three independently transcribed sgRNAs.
The synthetic target gene of 260 base pairs is whistetB (site 3) -bri1-bam3 (site 2) -whistetL-ade 2 (site 1), and the nucleotide sequence is shown in SEQ ID NO. 6.
In the invention, the three independent transcribed sgrnas are all controlled by independent promoters, site 1 (ade 2) is controlled by the mU6 promoter, site 2 (bam 3) is controlled by the mU6 promoter, and site 3 (white B) is controlled by the bU6 promoter.
In the invention, the pedigree tracing carrier is inserted into a PB transposon carrier for expressing red fluorescent protein, and a CRISPR-Cas9 system knocks out a synthetic target gene.
The carrier structure comprises the following: EF1 alpha-tdTomato-intBC-white B (site 3) -bril-Bam3 (site 2) -white L-ade2 (site 1) -bGH poly (A) -mU6-ade2 sgRNA-hU6-Bam3 sgRNA-bU6-white B sgRNA.
In the present invention, the lineage tagged vector is delivered in multiple copies via a PB transposon.
The pedigree tracing vector constructed by the invention is used for editing the synthetic target gene by the constructed vector for efficiently expressing EGFP-Cas9 based on Rosa26 site homologous recombination.
The ruminant pedigree tracing carrier technology provided by the invention comprises the step of introducing the sheep Rosa26 gene editing carrier and the pedigree tracing carrier into sheep prokaryotic embryos.
The invention applies the sgRNA1 and the sgRNA2 of the targeted sheep Rosa26 gene, the CRISPR-Cas9 targeting vector, the sheep Rosa26 gene editing vector, the pedigree tracing vector system and the ruminant pedigree tracing vector technology to trace the development process from early embryo to organogenesis stage cells.
The invention provides a CRISPR-Cas9 mediated sheep Rosa26 gene knockout and site-directed integration Cas9-T2A-EGFP gene method, which is used for editing synthetic target gene DNA, carrying out microinjection on a CRISPR-Cas9 targeting vector, a gene homologous recombination vector and a pedigree tracing vector system into sheep prokaryotic embryos to generate a large number of heritable indexes, combining 40 integration barcodes with the index of the inducible CRISPR-Cas9, and utilizing single-cell transcriptional sequencing to trace different cell development processes.
In the present invention, the injection method comprises introducing the exogenous fragment into the early embryo of the animal by microinjection.
In the invention, the concentration of the homologous recombination DNA fragments in the microinjection solution is 10ng/ul; the concentration of the 40 pedigree tracer carrier fragments was 10ng/ul; the PB transposase mRNA concentration is 100ng/ul, and the Cas9 mRNA concentration is 100ng/ul; the concentration of sgRNA1 and sgRNA2 was 100ng/ul.
In particular, the pedigree tracing method for ruminant mammals according to the present invention comprises the steps of:
(1) Preparation of plasmids: preparing two Cas9/sgRNA plasmids to be introduced, a homologous recombination DNA fragment and 40 lineage tracer vectors;
(2) In vitro transcription of PB transposase, cas9 enzyme, sgRNA1, sgRNA 2;
(3) Carrying out synchronous estrus on donor sheep and recipient sheep, and carrying out superovulation and artificial insemination on the donor sheep;
(4) Flushing out the prokaryotic embryo from the oviduct of the donor sheep;
(5) Uniformly mixing the DNA template to be introduced and RNA according to a proportion, and microinjection of a prokaryotic embryo;
(6) The recipient sheep are treated by an operation method, and 2-4 embryo transfer tubes are transplanted to each recipient sheep.
As a preferred embodiment of the present invention, in the above step (5), 10ng/ul of the homologous recombination DNA fragments are homogeneously mixed with 100ng/ul of sgRNA1, 100ng/ul of sgRNA2 and 40 10ng/ul of the lineage tagged DNA templates and 100ng/ul of PB transposase mRNA,100ng/ul of Cas9 mRNA, and microinjection is performed.
In the present invention, the animal is a mammal.
As one embodiment of the invention, the animal embryo is a hu sheep early embryo.
In the invention, the constructed pedigree tracing carrier system can directly transfect target cells, and the target cells can be traced along with development.
Preferably, the animal cells are derived from mammalian sheep.
In the invention, a lineage tracing system based on the CRISPR bar code is constructed, and compared with the traditional lineage tracing method, the CRISPR bar code is combined with genetic operation, so that high-resolution lineage tracing can be realized.
The invention utilizes the CRISPR-Cas9 system and the PB transposon (PiggyBac transposon) system to combine, and constructs a set of pedigree tracing carrier system for ruminants. The invention provides a method for editing synthetic target DNA based on CRISPR-Cas9 editing technology mediated sheep Rosa26 gene knockout and site-directed insertion of Cas9-T2A-EGFP genes. The invention also provides pedigree tracing vectors mediated by synthetic target DNA. The vector contained 40 8 base pair static integrated barcodes (Integration Barcode, intBC) and 260 base pair synthetic target DNA (3 CRISPR-Cas9 cleavage sites) and corresponding three independently transcribed sgrnas. The synthetic target DNA sequence is embedded in PB transposon vector expressing red fluorescent protein tdTomato. By this system, a large number of heritable repair results can be produced and these sequences can be distinguished by integration of the barcode. Meanwhile, the constructed pedigree carrier system can directly transfect target cells, track the target cells along with development, provide comprehensive molecular cell patterns of ruminant development, and has wide application prospect.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions. Example 1 construction of CRISPR-Cas9 targeting vector
The target site is positioned in the sheep Rosa26 gene, wherein the nucleotide sequences for identifying the target point in the sgRNA1 and the sgRNA2 sequences are shown as SEQ ID NO. 1 and SEQ ID NO. 2. Based on the target sequences, corresponding primer sequences (Table 2) were designed, synthesized by Beijing qing biological company in HPLC purification mode.
Table 2 sheep Rosa26 gene targeting sequence primer
Nucleotide name Sequence (5 '-3')
Ovis aries-Rosa26-sgRNA1-F caccgGGTGGAGTGAAATGAAGTCC
Ovis aries-Rosa26-sgRNA1-R aaacGGACTTCATTTCACTCCACCc
Ovis aries-Rosa26-sgRNA2-F caccgTGTGGGAAGATAAAGAAATT
Ovis aries-Rosa26-sgRNA2-R aaacAATTTCTTTATCTTCCCACACc
Formation of Olio nucleic acid sequence: the primers were diluted to 100. Mu.M, phosphorylated annealed, system: ovis-ROSA 26-sgRNA1-F (100. Mu.M) 1. Mu.l, ovis-Rosa 26-sgRNA1-R (100. Mu.M) 1. Mu.l, 10×T4ligation buffer 1. Mu.l, T4PNK 1. Mu.l, ddH 2 O6. Mu.l, total volume 10. Mu.l; ovis-Rosa 26-sgRNA2-F (100. Mu.M) 1. Mu.l, ovis-Rosa 26-sgRNA2-R (100. Mu.M) 1. Mu.l, 10×T4ligation buffer 1. Mu.l, T4PNK 1. Mu.l, ddH 2 O6. Mu.l, total volume 10. Mu.l. The reaction procedure was as follows: 30min at 37 ℃; the temperature is reduced by 5-25 ℃ per minute in a PCR instrument at 95 ℃ for 5 min. After the reaction, the carrier PX458 is diluted 250 times and digested with BbsI endonuclease. The ligation was carried out overnight at 16 ℃. After the ligation reaction was completed, the linear DNA residues were removed using PlasmidSafe exonuclease. 30min at 37℃and 30min at 70 ℃. And then preserving at-20deg.C for at least one week.
The product obtained in this step can be used directly for transformation of E.coli, and DH 5. Alpha. Competent cells are recommended. The method adopts the heat shock method: mu.l plasmid safe was taken and added to 50. Mu.l competent cells, which were placed on ice for 10min, heat-shocked at 42℃for 30s, immediately placed on ice for 2min, 100. Mu.l LB medium was added, and incubated at 37℃for 1h. LB plates containing Amp were used. Overnight at 37 ℃. The next day, the control plate should be free of clones, while clones grow in plates containing sgRNA inserts. And (5) picking up monoclonal shaking bacteria for 12 hours, and sending bacterial liquid to Beijing qing biological company for sequencing. After verifying that the plasmid construction was correct, the plasmid was extracted and the subsequent experiments were performed. The map of the targeting vector is shown in figure 1.
EXAMPLE 2 construction of homologous recombinant vector
As shown in fig. 2, to insert Cas9-T2A-EGFP site-specifically into Rosa26 target, homologous end repair (Homology directed repair, HDR) is used to insert the homology-armed locus into the target site. Because the construction of the donor vector requires cloning three long fragments into a target vector, and the uncertainty of enzyme cutting sites is added, it is difficult to ensure that each fragment can be spliced properly, so that the Gibson Assembly based on homologous recombination is adopted, and more long fragments can be spliced together efficiently and seamlessly without being limited by the enzyme cutting sites.
The donor vector structure is shown in FIG. 2, the upstream homology arm 5-LHA, cas9-T2A-EGFP and downstream homology arm 3-RHA are required to be connected into a framework vector pUC57-Amp, wherein the upstream homology arm and the downstream homology arm are cloned from sheep genome, the Cas9-T2A-EGFP is cloned from a carrier PX458 stored in a laboratory, and each fragment is designed into a primer according to the Gibson Assembly primer design principle, and the primer sequences are shown in Table 3.
TABLE 3 primers for amplifying fragments of donor vector
Primer name Sequence (5 '-3')
LHA-F1 tcgagctcggtacctcgcgaatgcatGGACGGAGCCATTGCTCCTG
LHA-R1 aagttatgtaacgggtacctctagacttcgtcctctaaatcttata
Cas9-T2A-EGFP-F tctagaggtacccgttacataactta
Cas9-T2A-EGFP-R ttcctgcggccgctccccag
RHA-F3 gcatgctggggagcggccgcaggaaccaacacctgggactgatttt
RHA-R3 caagcttgcatgcaggcctctgcagTCGACctggaagggtaaggactatc
The LHA amplification system is as follows: high-fidelity DNA polymerase Phanta MAX Super-Fidelity DNA Polymerase (P505, vazyme) 1. Mu.l, 2X Phanta Max buffer. Mu.l, dNTP mix (10 mM each) 1. Mu.l, forward primer (10. Mu.M) 2. Mu.l, reverse primer (10. Mu.M) 2. Mu.l, sheep genome template 2. Mu.l, ddH added 2 O to 50. Mu.l. The amplification conditions were: pre-denaturation at 98℃for 3min;98℃10s,52℃15s,72℃15s,34 cycles; after the cycle was completed, the mixture was stored at 72℃for 5min and 4 ℃. The amplification system of the Cas9-T2A-EGFP is as follows: high-fidelity DNA polymerase Phanta MAX Super-Fidelity DNA Polymerase (P505, vazyme) 1. Mu.l, 2X Phanta Max buffer. Mu.l, dNTP mix (10 mM each) 1. Mu.l, forward primer (10. Mu.M) 2. Mu.l, reverse primer (10. Mu.M) 2. Mu.l, sheep genome template 2. Mu.l, ddH added 2 O to 50. Mu.l. The amplification conditions were: pre-denaturation at 98℃for 3min; at 98 deg.c for 10s,
15s at 60 ℃, 60s at 72 ℃ and 33 cycles; after the cycle was completed, the mixture was stored at 72℃for 5min and 4 ℃. The RHA amplification system is as follows: high-fidelity DNA polymerase Phanta MAX Super-Fidelity DNA Polymerase (P505, vazyme) 1. Mu.l, 2X Phanta Max buffer. Mu.l, dNTP mix (10 mM each) 1. Mu.l, forward primer (10. Mu.M) 2. Mu.l, reverse primer (10. Mu.M) 2. Mu.l, sheep genome template 2. Mu.l, ddH added 2 O to 50. Mu.l. The amplification conditions were: pre-denaturation at 98℃for 3min;98℃10s,56℃15s,72℃15s,34 cycles; after the cycle was completed, the mixture was stored at 72℃for 5min and 4 ℃. The amplification results are shown in FIG. 3.
And (3) purifying a PCR product: (1) Taking 100 μl of PCR product, adding 5 times volume of solution BB, mixing, adding into a centrifugal column, centrifuging for 1min with 10000g, and discarding effluent. (2) 650 μl of solution WB was added and 10000g centrifuged for 1min, and the effluent was discarded. (3) centrifugation at 10000g for 2min, and complete removal of residual WB. (4) The column was placed in a clean centrifuge tube and 50. Mu.l of ddH was added to the center of the column 2 O, standing for 1min at room temperature, centrifuging 10000g for 1min, eluting DNA, and preserving eluted DNA at-20deg.C.
The nucleotide sequences of the left homology arm and the right homology arm are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4, and the nucleotide sequence of the Cas9-T2A-EGFP is shown as SEQ ID NO. 5.
Each purified fragment was seamlessly spliced using full-size gold pEASY-Uni Seamless Cloning and Assembly Kit (CU 101-1) according to the instructions. The system of seamless cloning is: 2X Basic Assembli Mix. Mu.l, cas9-T2A-EGFP 0.25pmol,LHA 0.125pmol,RHA0.125pmol, cleaved PUC57 fragment 0.125pmol, supplemented with water to 10. Mu.l, reacted at 50℃for 30min.
EXAMPLE 3 construction of pedigree tracer vector
To record ruminant cell development trajectories and lineages, a set of PB transposon-based lineage tracing reporting systems (40 lineage tracing plasmids) was modified using CRISPR-Cas9 editing technology. When a pedigree tracer plasmid framed by a PB vector is microinjected into sheep prokaryotic embryos, the PB transposon is integrated into the genome, the embryo can detect distinct red fluorescence tdTomato (the structure of the pedigree tracer vector is shown in FIG. 4. The pedigree tracer vector consists of two parts, the target site of the first part consists of an integration barcode intBC and three cleavage sites for Cas9 knockout, this sequence is inserted into the 3' UTR of the red fluorescence tdTomato. The second part is an sgRNA encoding three independent transcripts, controlled by different promoters mU6, hU6 and bU6, respectively, to allow recording of a plurality of different signals), the specific construction method is as follows:
(1) The pedigree tracer sequence whisteB (site 3) -bri1-bam3 (site 2) -whisteL-ade 2 (site 1) -bGH poly (A) signal-mU6-ade2 sgRNA-hU6-bam3 sgRNA-bU 6-whisteB sgRNA is synthesized by general biological company, the synthetic sequence size 2132bp, the structure diagram is shown in figure 4, the DNA sequence for coding the sequence is shown in SEQ ID NO: 7.
(2) The original PB vector plasmid pPL149-PB-EF1a-tdTomato-Puro was digested with the restriction enzymes AscI and NotI, and 6316bp was recovered.
(3) Ligating the pPL149-PB-EF1a-tdTomato-Puro fragment recovered in the step (2) with the pedigree tracer sequence synthesized in the step (1), and ligating the ligation system: 2. Mu.l of T4 Buffer, 0.02pmol of the PB vector fragment obtained by digestion, 0.06pmol,T4 DNA Ligase 1. Mu.l of pedigree tracer sequence, water addition to 20. Mu.l, and overnight ligation at 16℃gave a pedigree tracer vector without integrated barcode.
(4) Ligating 40 integrated barcode fragments: the intBC primer is synthesized by Beijing Optimaceae, and the specific sequence is shown in Table 1. 40 intBC ligation systems: 1 μl of T4 Buffer, 1-40-F2.5 μl of IntbC, 1-40-R2.5 μl of IntbC, and water to 10 μl; and diluting for 50 times at 95 ℃ for 5 minutes after finishing, and reserving.
(5) Pedigree tracer vector cleavage without integrated barcode: 10 XNEBuffer 5ul, pedigree tracer plasmid 3ug,SpeI 2ul,NotI 2ul without integrated barcode, water was added to 50ul, and the digested fragment 8462bp was recovered.
(6) 40 pedigree tracer vectors with integrated barcodes were constructed: and (3) respectively connecting 8462bp of the pedigree tracing carrier fragment without the integrated bar code after enzyme digestion with 40 intBC fragments in the step (4) by using T4 DNA Ligase to obtain 40 pedigree tracing plasmids with the integrated bar code intBC.
Schematic of ruminant pedigree tracing is shown in fig. 5. Each cell contains multiple genomic, intBC distinguishable integration sites of interest. sgrnas guide Cas9 to cleavage sites to create insertion or deletion mutations, with Cas9 generating insertions or deletions in repairing double strand breaks, which are inherited in next generation cells, differentiated by tracking different intBC, and lineage information for ruminant early embryos is recorded.
EXAMPLE 4 homologous recombinant plasmids and 40 restriction enzyme cuts with Integrated barcode pedigree tracer vector
The sheep Rosa26 homologous recombinant plasmid of example 2 was digested with the following specific digestion systems: 10 XNEBuffer 10. Mu.l, plasmid 20ug, nsiI 5. Mu.l, salI 5. Mu.l, water was added to 100. Mu.l, and the fragment 8153bp after digestion, and the results of the digestion electrophoresis are shown in FIG. 6.
The 40 lineage tagged plasmids with integrated barcodes of example 3 were digested with the following specific digestion systems: 10 XNEBuffer 5. Mu.l, plasmid 3ug, pspXI 2. Mu.l, ecoRI 2. Mu.l, water was added to 50. Mu.l, and the fragment 6072bp after cleavage, and the result of the cleavage electrophoresis was shown in FIG. 7.
And (3) enzyme digestion product purification: compounding and compoundingAgarose gel of proper concentration and electrophoresis to separate DNA fragment. After the DNA fragments are separated, the gel is placed under an ultraviolet lamp, the gel containing the DNA fragments of interest is rapidly excised, and the purified DNA is recovered as follows: (1) The desired gel fragment was isolated under an ultraviolet lamp and placed in a clean EP tube, called its mass. Gel block volume conversion formula 100 μl=l00 mg. (2) Adding 3 times volume of Buffer GDP into the EP tube, shaking and mixing, and placing into a water bath kettle at 50deg.C to dissolve the gel block for 7-10min. (3) The balance column HiPure DNA Column and Collection Tube were removed and properly positioned as desired. The solution in (2) was transferred into HiPure DNA Column tube, and then centrifuged at 12000rpm for 1min, and the centrifugation was repeated once. (4) 150ul Buffer GDP was pipetted into HiPure DNA Column and allowed to stand for 1min under centrifugation conditions as above. (5) And 5, absorbing 2500 mu l of the added absolute ethyl alcohol Buffer DW, adding HiPure DNA Column, centrifuging under the same conditions, discarding the filtrate, and repeating the centrifugation once. And (6) continuing to centrifuge for 2min, wherein the conditions are unchanged. (7) Taking a new Collection Tube, placing HiPure DNA Column, and adding Rnase-free ddH to HiPure DNA Column 2 O25. Mu.l, and left standing at room temperature for 2min. (8) DNA was collected by centrifugation at 12000rpm for 1min and stored at-20 ℃.
Example 5 in vitro transcription of CRISPR-Cas9 targeting vector and lineage Trace Carrier System
The 2 targeting vectors and PB enzyme vectors obtained in example 1 were subjected to in vitro transcription by cas9 vector, and the in vitro transcription steps are shown in the specification of the kit, and the specific transcription conditions are shown in FIG. 8. The in vitro transcription primer sequences are shown in Table 4:
TABLE 4 in vitro transcription primer sequences
Figure BDA0003999709520000121
Figure BDA0003999709520000131
Example 6 ruminant microinjection of CRISPR-Cas9 vector systems and lineage tagging systems
The 2 sgrnas, PB enzyme mRNA, cas9 enzyme mRNA transcribed in example 5, sheep Rosa26 homologous recombination DNA fragments, 40 lineage tracer fragments were co-injected into a hu sheep prokaryotic embryo. The specific operation method is as follows:
(1) After insemination of the donor sheep uterus for 18 hours, the uterus was exposed to the window surface by surgical procedures, and the prokaryotic embryos were washed out from the oviducts and development of the corpus luteum on both sides was recorded.
(2) Clear zona pellucida, cytoplasmic uniformity and prokaryotic visible fertilized eggs were selected for prokaryotic microinjection, cas9 mRNA, PB mRNA, sgRNA1, sgRNA2 obtained by in vitro transcription of the injections were diluted to 100ng/μl, sheep Rosa26 homologous recombination DNA fragments were diluted to 10ng/μl,40 lineage tracer fragments were diluted to 10ng/μl, and microinjection was performed, as shown in fig. 9.
(3) 2-4 oviduct transplanted embryos are treated by adopting an operation method, and the oviduct transplanted embryos of each recipient need to be observed in a small circle for 1 day after the flock operation, so that the circle is kept clean to prevent incision infection, and the postoperative recovery is ensured.
Example 7 detection of pedigree Trace results at different embryo stages
After the embryo of example 6 developed to E18.5 and E19.5, the embryo was taken out, and photographed by a fluorescence microscope, the apparent fluorescence was observed, and the specific situation is shown in FIG. 10; the expression of sample intBC was examined, and up to 39 intBC could be detected in a single sample, and the specific results are shown in FIG. 11, and the examination results indicate successful introduction of CRISPR-Cas9 targeting system and lineage tracing carrier system into sheep prokaryotic embryos.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims (10)

1. A carrier system for ruminant pedigree tracing, characterized in that it consists of 40 carriers for ruminant pedigree tracing, wherein each carrier carries a different integrated barcode intBC;
the vector for ruminant pedigree tracing is constructed by inserting a pedigree tracing vector into a PB transposon vector expressing red fluorescent protein;
the lineage tagged vector includes an integration barcode intBC, a synthetic target DNA sequence, and three independently transcribed sgrnas targeting the synthetic target DNA sequence.
2. The carrier system of claim 1, wherein the lineage tracing carrier comprises the structure: integration of the barcode intBC-synthetic target DNA sequence-bGH poly (A) -three independently transcribed sgRNAs.
3. The vector system according to claim 2, wherein the synthetic target DNA sequence comprises three positions ade2, bam3 and white B, designated as positions 1 to 3, respectively, the nucleotide sequence of which is shown in SEQ ID No. 6;
the three independently transcribed sgrnas are respectively targeted to the sites 1 to 3, wherein the sgrnas of the targeted site 1 are controlled by the mU6 promoter, the sgrnas of the targeted site 2 are controlled by the mU6 promoter, and the sgrnas of the targeted site 3 are controlled by the bU6 promoter.
4. The vector system according to claim 2, wherein the pedigree tagged vector is constructed such that the nucleotide sequence of the synthetic target DNA sequence-bGH poly (a) -three independently transcribed sgrnas is shown in SEQ ID No. 7.
5. The carrier system according to claim 3 or 4, wherein the carrier for ruminant lineage tracing comprises the structure: EF 1. Alpha. Promoter-tdTomato-integration barcode intBC-synthetic target DNA sequence-bGH poly (A) -three independently transcribed sgRNAs.
6. Use of the vector system of any one of claims 1-5 for ruminant lineage tracing.
7. A sheep early embryo development lineage tracing system, comprising a sheep Rosa26 gene editing vector based on CRISPR-Cas9 technology and the vector system of any one of claims 1-5;
the gene editing vector comprises a CRISPR-Cas9 targeting vector and a gene homologous recombination vector;
wherein the CRISPR-Cas9 targeting vector contains a DNA fragment encoding an sgRNA sequence;
preferably, the nucleotide sequences of the sgRNA acting sites are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2;
the gene homologous recombination vector comprises a Donor DNA and an element sequence for inserting the Donor DNA into a sheep Rosa26 gene through homologous end repair sites;
preferably, the Donor DNA is Cas9-T2A-EGFP.
8. The system of claim 7, wherein the gene homologous recombination vector comprises the structure: left homology arm-CMV promoter-Cas 9-T2A-EGFP-bGH poly (a) -right homology arm;
preferably, the nucleotide sequences of the left homology arm and the right homology arm are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4.
9. Use of the system of claim 7 or 8 for the tracking of early embryonic developmental lineages in sheep.
10. A lineage tracing method for early sheep embryo development based on a CRISPR-Cas9 system and a PB transposon system, the method comprising: microinjection of the system of claim 7 or 8 into sheep prokaryotic embryos, combined with single cell transcriptional sequencing techniques, to trace the developmental processes of the different cells.
CN202211612527.0A 2022-12-14 2022-12-14 Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system Pending CN116103342A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211612527.0A CN116103342A (en) 2022-12-14 2022-12-14 Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211612527.0A CN116103342A (en) 2022-12-14 2022-12-14 Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system

Publications (1)

Publication Number Publication Date
CN116103342A true CN116103342A (en) 2023-05-12

Family

ID=86262123

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211612527.0A Pending CN116103342A (en) 2022-12-14 2022-12-14 Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system

Country Status (1)

Country Link
CN (1) CN116103342A (en)

Similar Documents

Publication Publication Date Title
CN108660161B (en) Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology
CN105950626B (en) The method of different hair color sheep is obtained based on CRISPR/Cas9 and targets the sgRNA of ASIP genes
CN110551759B (en) Composition and method for improving recombination efficiency of transgenic cells
CN105132427A (en) Method for acquiring gene editing sheep by RNA-mediated specific double-gene knockout and special sgRNA for method
CN109943564B (en) Construction method and application of hybrid mouse model with Amh gene fixed-point knock-in 2A-Cre
CN111718933B (en) Preparation method and application of rrbp1 gene knockout hot claw frog model
CN110184301A (en) Efficiently accurate targeted integration is realized by Tild-CRISPR
CN113234756A (en) Construction method of LAMA3 gene knockout animal model based on CRISPR/Cas9 technology
CN110684767B (en) Method for knocking out amh gene from double gRNA sites in pelteobagrus fulvidraco and application
CN111500589A (en) Pig SOX10 mutant gene causing inner ear hypoplasia and application thereof
CN109652459B (en) Bee gene editing method based on CRISPR/Cas9
CN114480497B (en) Construction and application method of ep400 gene knockout zebra fish heart failure model
CN116103342A (en) Pedigree tracing method for sheep early embryo development based on CRISPR-Cas9 system and PB transposon system
CN115720874A (en) Creating method and application of inonotus spiny germplasm for cultured economic fishes
CN111088253A (en) CRISPR (clustered regularly interspaced short palindromic repeats) single-base donor repair system for HBB-28 thalassemia gene
CN110923229B (en) CRISPR/Cas9 system for knocking out dmrt1 gene at double gRNA sites in pelteobagrus fulvidraco and application
CN105132426B (en) A kind of specific knockdown FGF5 genes with RNA mediations obtain the method for gene editing sheep and its special sgRNA
CN111893119B (en) Method for obtaining SCD1 gene editing goat embryo by using CRISPR/Cas9 system and microinjection
JP2009511010A (en) Methods for transferring episomal vectors to animal cells
CN114908097B (en) Pedigree tracing technology for recording pig tissue differentiation and organogenesis under Dox regulation
CN111549070A (en) Method for editing X chromosome multi-copy gene to realize animal sex control
CN109504707A (en) The restorative procedure in the iPSCs Mitochondrial DNA Mutation site based on mitoTALENs
CN114395556B (en) Method for rapidly obtaining non-chimeric double-allele knockout animal model
CN109652421B (en) sgRNA of targeted editing sheep reproduction negative control gene NPFFR1, and coding DNA and application thereof
CN115322993B (en) Safety site for site-directed integration of exogenous genes in pig genome and method for constructing pig breeding group by using safety site

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination