CN116103299A - Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof - Google Patents
Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof Download PDFInfo
- Publication number
- CN116103299A CN116103299A CN202211031385.9A CN202211031385A CN116103299A CN 116103299 A CN116103299 A CN 116103299A CN 202211031385 A CN202211031385 A CN 202211031385A CN 116103299 A CN116103299 A CN 116103299A
- Authority
- CN
- China
- Prior art keywords
- ror alpha
- bovine
- alpha gene
- cloning
- construction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- High Energy & Nuclear Physics (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof, which belong to the technical field of cloning of genes and construction of eukaryotic expression vector.
Description
Technical Field
The invention relates to cloning and construction of eukaryotic expression vectors, in particular to cloning and construction of bovine ROR alpha genes, and also relates to application of cloning and construction of eukaryotic expression vectors, in particular to application of cloning and construction of bovine ROR alpha genes and eukaryotic expression vectors, belonging to the technical field of cloning and construction of eukaryotic expression vectors.
Background
Retinoic acid related orphan receptor alpha belongs to orphan Nuclear Receptor (NR) superfamily, is an important component of biological clock system, and is also a transcriptional activator responding to circadian rhythm change, and plays an important role in regulating in vivo and in vitro biological rhythm process.
In the transcriptional feedback loop, rorα binds in monomeric form to a specific DNA sequence recognized by it, called ROR response element, consisting of AGGTCA consensus motif and a/T enrichment region, mediating the transcription level of the target gene by recruiting coactivators. In addition, ROR alpha and REV-ERB alpha compete for RORE binding sites in their promoters in order to activate or inhibit transcription of Bmal 1. Meanwhile, RORα and REV-ERBα regulate the rhythmic expression of downstream Pers and Crys target genes by regulating the transcription of biological Clock genes such as Bmal1 and Clock, thereby maintaining the circadian oscillation of the biological Clock system.
In addition, rorα is expressed in a variety of tissues and organs, including liver, skin, adipose tissue, cerebellum, and kidneys, and plays an extremely important role in various pathophysiological processes.
For example, studies have shown that rorα is a transcription factor for Th17 cell differentiation and inflammatory function, with the potential to be developed as a novel therapeutic agent for the treatment of various inflammatory diseases.
Recent literature suggests that rorα also plays an important role in glucose metabolism, immune response, reproductive development and in the evolution of cancer.
Cows serve as ruminants with important economic value, and play a role in the development of animal husbandry in China, and the cow breeding industry becomes the prop industry of animal husbandry in China.
Therefore, regulating the growth and development and reproductive process of cows has been a research hotspot in the field of livestock and veterinary.
Studies have shown that biological clocks affect milk yield in the lactation period of cows, but the specific mechanisms of the effects are not clear.
At present, a bovine ROR alpha gene CDS region is not successfully cloned and a eukaryotic expression vector is constructed;
at present, the research on the ROR alpha gene function mainly takes the genes and cells of mice and human beings as models, and does not relate to biological clock research materials and model models related to bovine ROR alpha genes.
Therefore, the cloning of the bovine ROR alpha gene and the construction and application of a eukaryotic expression vector are designed to solve the problems.
Disclosure of Invention
The invention mainly aims to provide cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof, and the cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof successfully construct eukaryotic expression vector of bovine ROR alpha gene and supplement blank of bovine ROR alpha gene molecular level research;
at present, the research on the ROR alpha gene function mainly takes the genes and cells of mice and human beings as models, and successfully constructs a research model of the bovine ROR alpha gene;
confirming the correctness of the bovine ROR alpha gene predicted sequence (XM_ 024997674) in the NCBI database;
the ROR alpha eukaryotic expression vector is subjected to dual identification of enzyme digestion and sequencing, and the quality is reliable.
The aim of the invention can be achieved by adopting the following technical scheme:
cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof, comprising the following steps:
step one: selecting fresh liver tissue of Holstein cows in slaughter houses, weighing 20mg of liver tissue, extracting total RNA, reversely transcribing into cDNA, and storing at-20 ℃ for later use;
step two: selecting pcDNA3.1-Puro-N-3HA vector, designing primer, and obtaining CDS region of cow ROR alpha gene predicted sequence from NCBI database;
step three: PCR primers with EcoRI cut linearized homology arms of the pcDNA3.1-Puro-N-3HA vector were designed using Primer Premier 5.0 software.
Preferably, in the second step, the accession number of the CDS region of the predicted sequence of the dairy cow ROR alpha gene is XM_024997674 obtained from NCBI database.
Preferably, the primer sequence designed in the second step is:
F:5-agcaagctttctagagaattcATGATGTATTTTGTGATCGCAG-3；
R:5-accggat-ccgatatcgaattcTTACCCATCAATCTGCATGGCT-3。
preferably, agcaagctttctagagaattc and accggat-ccgatatcgaattc are homology arms of EcoRI digestion linearized pcDNA-3.1-Puro-N-3HA vector;
wherein gaattc is EcoRI cleavage site.
Preferably, in the first step, cDNA is prepared by using TOYOBO reverse transcription reaction kit operation steps;
genomic DNA removal reaction system 8 μl:4 XDN Master mix 2.0. Mu.L, RNA template 4. Mu. L, ddH2O 2. Mu.L;
the reaction procedure: 5min at 37 ℃, 10 mu L of reverse transcription reaction system, 8 mu L of genomic DNA removal reaction solution, 2 mu L of 5 xRT Master Mix II;
degree of reaction: 15min at 37 ℃;50 ℃ for 5min;98 ℃ for 5min; preserving at 4 ℃.
Preferably, the cDNA is obtained through the first step as a template, and CDS region fragments with homology arms of the ROR alpha genes of the cows are amplified;
PCR reaction 50. Mu.L: cDNA 4. Mu.L (50 ng/. Mu.L), 1.5. Mu.L each of the upstream and downstream primers (10. Mu.M), 2X PrimeSTAR Max Premix. Mu. L, ddH 2.2O18. Mu.L each;
PCR reaction procedure: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 55℃for 15s, elongation at 72℃for 85s, and circulation 40 times (step 2-4); extending at 72deg.C for 5min;16 ℃ infinity;
after the PCR reaction is finished, the PCR product is identified by agarose gel electrophoresis, and the target gene DNA fragment is purified and recovered according to the specification of a general DNA purification and recovery kit.
Preferably, the empty vector pcDNA3.1-Puro-N-3HA vector is linearized with the restriction enzyme EcoRI and the cleavage products are detected by agarose gel electrophoresis experiments, reaction system 50. Mu.L: 10X QuickCut Green Buffer. Mu.L, restriction enzyme EcoRI 5.5. Mu.L, pcDNA3.1 vector 9.7. Mu. L, ddH2O 29.8. Mu.L, 37℃for 1h 30min, then the target strip was gel recovered using a universal DNA purification recovery kit to give a linearized vector ready for use.
Preferably, the desired fragment is recombinantly ligated with linearized pcDNA3.1 vector, reaction system 20. Mu.L: linearization of 0.869. Mu.L vector, 5.6. Mu.L insert, 5 XCE II Buffer 4. Mu. L, exnase II 2. Mu. L, ddH2O 7.531. Mu.L, 37℃reaction for 30min, cooling to 4℃or immediately cooling on ice to obtain recombinant plasmid product.
Preferably, the recombinant product is transferred to DH 5. Alpha. E.coli competent cells according to the instructions of the transformation reaction and plated on solid medium containing ampicillin (30. Mu.g/mL);
culturing for 12-16 h in a 37 ℃ incubator, and then picking up monoclonal colonies, shaking the colonies for 12h in a shaking table at 37 ℃;
and (3) carrying out PCR amplification by taking the bacterial liquid as a DNA template to detect whether the bacterial liquid contains positive clones, wherein the reaction system is as follows: 2X Quick Taq HS DyeMix 7.5.5. Mu.L of each of the upstream and downstream primers, 0.5. Mu.L of the bacterial liquid 2. Mu. L, ddH2O, and 15. Mu.L of the bacterial liquid were added, followed by the following reaction procedures: pre-denaturation at 94℃for 10min; denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 68℃for 85s, and cycling for 35 times; extending at 68deg.C for 5min;16 ℃ infinity;
extracting positive plasmids according to the specification of the endotoxin-free plasmid small-extraction medium-amount kit and detecting the concentration of the positive plasmids;
this was then identified by single cleavage using the restriction enzyme EcoRI. The positive plasmid with the enzyme digestion identification result meeting the expectations is sent to the Seanqing biological limited company for sequencing identification; the returned sequence was aligned with the CDS region sequence of the dairy cow ROR alpha gene in the NCBI database, and the correctly aligned plasmid sample was named pcDNA3.1-3HA-ROR alpha.
The beneficial technical effects of the invention are as follows:
the cloning of the bovine ROR alpha gene and the construction and application of the eukaryotic expression vector successfully construct the eukaryotic expression vector of the bovine ROR alpha gene and supplement the blank of bovine ROR alpha gene molecular level research;
at present, the research on the ROR alpha gene function mainly takes the genes and cells of mice and human beings as models, and successfully constructs a research model of the bovine ROR alpha gene;
confirming the correctness of the bovine ROR alpha gene predicted sequence (XM_ 024997674) in the NCBI database;
the ROR alpha eukaryotic expression vector is subjected to dual identification of enzyme digestion and sequencing, and the quality is reliable.
Drawings
FIG. 1 is a schematic diagram showing agarose gel electrophoresis identification of PCR products of CDS region of bovine ROR alpha gene in accordance with a preferred embodiment of cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof;
FIG. 2 is a schematic diagram showing the cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and the identification of bacterial liquid and enzyme digestion of pcDNA3.1-3HA-ROR alpha eukaryotic expression vector according to a preferred embodiment of the present invention;
FIG. 3 is a schematic diagram showing the relative expression levels of mRNA levels of the bovine ROR alpha gene in accordance with a preferred embodiment of cloning of the bovine ROR alpha gene, construction of eukaryotic expression vectors and applications thereof according to the present invention;
FIG. 4 is a schematic diagram showing the results of the identification of cow ROR alpha protein WB according to a preferred embodiment of cloning of cow ROR alpha gene, construction of eukaryotic expression vector and application thereof according to the present invention.
Detailed Description
In order to make the technical solution of the present invention more clear and obvious to those skilled in the art, the present invention will be described in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.
As shown in fig. 1 to 4, cloning of bovine ROR alpha gene and construction of eukaryotic expression vector provided in this embodiment include the following steps:
step one: selecting fresh liver tissue of Holstein cows in slaughter houses, weighing 20mg of liver tissue, extracting total RNA, reversely transcribing into cDNA, and storing at-20 ℃ for later use;
step two: selecting pcDNA3.1-Puro-N-3HA vector, designing primer, and obtaining CDS region of cow ROR alpha gene predicted sequence from NCBI database;
step three: PCR primers with EcoRI cut linearized homology arms of the pcDNA3.1-Puro-N-3HA vector were designed using Primer Premier 5.0 software.
In this example, the accession number of the CDS region of the predicted sequence of the rorα gene of dairy cows obtained from NCBI database in step two is xm_024997674.
In this embodiment, the primer sequence designed in step two is:
F:5-agcaagctttctagagaattcATGATGTATTTTGTGATCGCAG-3；
R:5-accggat-ccgatatcgaattcTTACCCATCAATCTGCATGGCT-3。
in this example, agcaagctttctagagaattc and accggat-ccgatatcgaattc are homology arms of EcoRI digestion linearized pcDNA-3.1-Puro-N-3HA vector;
wherein gaattc is EcoRI cleavage site.
In this example, the cDNA was prepared in step one using the TOYOBO reverse transcription reaction kit procedure to obtain cDNA;
genomic DNA removal reaction system 8 μl:4 XDN Master mix 2.0. Mu.L, RNA template 4. Mu. L, ddH2O 2. Mu.L;
the reaction procedure: 5min at 37 ℃, 10 mu L of reverse transcription reaction system, 8 mu L of genomic DNA removal reaction solution, 2 mu L of 5 xRT Master Mix II;
degree of reaction: 15min at 37 ℃;50 ℃ for 5min;98 ℃ for 5min; preserving at 4 ℃.
In the embodiment, cDNA is obtained through the first step as a template, and CDS region fragments with homology arms of the ROR alpha genes of the cows are amplified;
PCR reaction 50. Mu.L: cDNA 4. Mu.L (50 ng/. Mu.L), 1.5. Mu.L each of the upstream and downstream primers (10. Mu.M), 2X PrimeSTAR Max Premix. Mu. L, ddH 2.2O18. Mu.L each;
PCR reaction procedure: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 55℃for 15s, elongation at 72℃for 85s, and circulation 40 times (step 2-4); extending at 72deg.C for 5min;16 ℃ infinity;
after the PCR reaction is finished, the PCR product is identified by agarose gel electrophoresis, and the target gene DNA fragment is purified and recovered according to the specification of a general DNA purification and recovery kit.
In this example, the empty vector pcDNA3.1-Puro-N-3HA vector was linearized with the restriction enzyme EcoRI and the cleavage products were detected by agarose gel electrophoresis experiments, 50. Mu.L of the reaction system: 10X QuickCut Green Buffer. Mu.L, restriction enzyme EcoRI 5.5. Mu.L, pcDNA3.1 vector 9.7. Mu. L, ddH2O 29.8. Mu.L, 37℃for 1h 30min, then the target strip was gel recovered using a universal DNA purification recovery kit to give a linearized vector ready for use.
In this example, the fragment of interest was recombinantly ligated to a linearized pcDNA3.1 vector, 20. Mu.L of reaction system: linearization of 0.869. Mu.L vector, 5.6. Mu.L insert, 5 XCE II Buffer 4. Mu. L, exnase II 2. Mu. L, ddH2O 7.531. Mu.L, 37℃reaction for 30min, cooling to 4℃or immediately cooling on ice to obtain recombinant plasmid product.
In this example, the recombinant product was transferred to DH 5. Alpha. E.coli competent cells according to the instructions of the transformation reaction, and plated onto solid medium containing ampicillin (30. Mu.g/mL);
culturing for 12-16 h in a 37 ℃ incubator, and then picking up monoclonal colonies, shaking the colonies for 12h in a shaking table at 37 ℃;
and (3) carrying out PCR amplification by taking the bacterial liquid as a DNA template to detect whether the bacterial liquid contains positive clones, wherein the reaction system is as follows: 2X Quick Taq HS DyeMix 7.5.5. Mu.L of each of the upstream and downstream primers, 0.5. Mu.L of the bacterial liquid 2. Mu. L, ddH2O, and 15. Mu.L of the bacterial liquid were added, followed by the following reaction procedures: pre-denaturation at 94℃for 10min; denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 68℃for 85s, and cycling for 35 times; extending at 68deg.C for 5min;16 ℃ infinity;
extracting positive plasmids according to the specification of the endotoxin-free plasmid small-extraction medium-amount kit and detecting the concentration of the positive plasmids;
this was then identified by single cleavage using the restriction enzyme EcoRI. The positive plasmid with the enzyme digestion identification result meeting the expectations is sent to the Seanqing biological limited company for sequencing identification; the returned sequence was aligned with the CDS region sequence of the dairy cow ROR alpha gene in the NCBI database, and the correctly aligned plasmid sample was named pcDNA3.1-3HA-ROR alpha.
HEK293T cell transfected by recombinant plasmid
Preparing a DMEM high-sugar culture medium containing 10% of fetal bovine serum and 1% of penicillin-streptomycin-amphotericin B, resuscitating HEK293T cells by adopting a rapid thawing method, culturing in a 60mm culture dish added with 3mL of complete culture medium, culturing in a 37 ℃ incubator for 24 hours, passaging, and inoculating cells with good density and state in 2 6 pore plates;
when HEK293T cell density in the 6-hole plate reaches 50% -60%, the 6-hole plates are respectively divided into 2 groups for transfection, one group is an experimental group for transfection of pcDNA-3.1-3HA-ROR alpha recombinant plasmid, the other group is a control group for transfection of empty plasmid pcDNA3.1-Puro-N-3HA, the two 6-hole plates are respectively used for detecting the expression of the ROR alpha genes of the dairy cows at mRNA level and protein level, and the two 6-hole plates are cultured in a 37 ℃ incubator after transfection;
the transfection volumes were calculated based on plasmid concentration, and specific calculations of the transfection plasmid volumes are shown in Table 1:
table 1 transfection plasmid volume calculation
Real-time fluorescent quantitative PCR (RT-qPCR) for detecting expression of dairy cow ROR alpha gene at mRNA level
After 24h of cell transfection, total RNA of HEK293T cells of an experimental group and a control group for detecting the expression of the ROR alpha gene of the dairy cows at the mRNA level is extracted by adopting a TRIzol method, cDNA is synthesized by reverse transcription, and qPCR is performed after the cDNA is diluted to 2.5 ng/. Mu.L. The Primer Premier 5.0 is used to design ROR alpha Primer sequence for human and cow and human GAPDH is used as reference baseThe primer was diluted to 10. Mu.M for use due to the primer sequence (see Table 2). Using ToYoBo THUNDERBIRD
qPCR Mix kit and real-time fluorescent quantitative PCR reaction according to the operation steps of the specification. The reaction system: 2X ChamQ SYBR qPCR Master Mix. Mu.L, 0.4. Mu. L, cDNA 5. Mu.L (12.5 ng) of each of the upstream and downstream primers (10. Mu.M), and ddH2O 4.2. Mu.L. The reaction procedure: stage 1 is pre-denatured for 3min at 95 ℃; stage 2 circularly reacts for 40 cycles at 95 ℃ for 10s and 60 ℃ for 30 s; stage 3 melting curve was 95℃15s,60℃15s,95.5℃5s. The detection is carried out by using a Berle CFX Connect fluorescent quantitative PCR instrument, and the Ct value of the sample is quantitatively analyzed by adopting a relative quantification method of 2-delta Ct.
TABLE 2 quantitative primer information
Western Blotting (WB) method for detecting expression of ROR alpha gene of dairy cows at protein level
After 48h of cell transfection, another set of samples for detecting the expression of the ROR alpha gene of cows at the protein level were extracted for western blotting. The operation steps are as follows: the monolayer adherent cells were collected into a centrifuge tube, centrifuged at 12000rpm for 10min, the supernatant was discarded, and the cells of the experimental and control groups were treated according to RIPA lysate instructions to obtain protein samples. And (3) after the cells are treated, measuring the total protein concentration by using a Kaiyi biological BCA protein content detection kit and an enzyme-labeled instrument, diluting protein samples of an experimental group and a control group to the same concentration, adding a proper amount of Loading Buffer, uniformly mixing, putting into a water bath kettle at 100 ℃, boiling for 10min, and performing SDS-PAGE gel electrophoresis. Transferring the protein to a PVDF film after electrophoresis; 10% skim milk powder was prepared and blocked on a shaker for 2h. After the end of the blocking, the membranes were washed 3 times, 10min each time, in TBST solution. Placing the PVDF film which is transferred successfully into rabbit anti-HA primary antibody working solution (1:2000 dilution), slowly shaking and incubating on a shaking table for 2 hours at room temperature, and then standing overnight at 4 ℃; after the primary antibody incubation is finished, the membrane is washed 3 times by TBST for 10min each time. Then placing the PVDF membrane into goat anti-rabbit secondary antibody working solution marked by HRP (1:5000 dilution), and incubating for 2h at room temperature by a shaking table; after finishing, the TBST is washed for 3 times, each time for 10min. PVDF membrane was placed in 2mL ECL luminescence solution for 2min, and the target protein results were exposed in a dark room and stored. The exposed film was taken out, and the TBST film was washed 3 times for 10min each. Adding proper amount of antibody eluent, eluting on a shaker at room temperature for 15min, discarding the eluent, and washing the membrane with TBST for 3 times each for 10min. Then, the blocking was performed again, and after the blocking was completed, the PVDF membrane was placed in HRP-labeled GAPDH antibody working solution (1:5000 dilution), followed by the same procedure as described above. And finally, placing the PVDF film which is well incubated with the internal reference into ECL luminous solution for 2min, exposing in a darkroom and preserving a target protein result graph.
Statistical analysis
Statistical analysis was performed on experimental data using GraphPad Prism 9.0 statistical software. The expression level of ROR alpha mRNA in HEK293T cells in experimental group and control group accords with normal distribution so as to x ± s The mean value comparison of samples between 2 groups is shown by taking two independent sample t-tests. P (P)<0.01 shows that the difference is very significant, and has statistical significance.
Cloning of CDS region fragment of ROR alpha gene of dairy cows
And (3) using ROR alpha cDNA as a template, amplifying the CDS region fragment of the ROR alpha gene of the dairy cow by using a PCR technology, and detecting an amplified product by agarose gel electrophoresis. As a result, as shown in FIG. 1, a single band was observed below 1000bp-1500bp, consistent with the expected result (1407 bp). The amplified target fragment is single, bright and free of non-specific amplification. From this, it was confirmed that the CDS region fragment of the dairy cow ROR alpha gene was successfully cloned.
M.dl 5000Marker in fig. 1; PCR amplified product of ROR alpha gene CDS region (BOS liver).
Construction and identification of eukaryotic expression vector of ROR alpha gene of dairy cow
Purifying and recovering the target gene fragment amplified by PCR, and carrying out homologous recombination connection with a skeleton vector pcDNA3.1-Puro-N-3HA tangential to EcoRI enzyme to construct a eukaryotic expression vector pcDNA3.1-3HA-ROR alpha. Firstly, carrying out preliminary identification of positive clone by bacterial liquid PCR, wherein the result is shown as A in figure 2, and a single and obvious band is amplified below 1500bp and is consistent with the expected result (1407 bp); and secondly, identifying the recombinant vector by enzyme digestion, and simultaneously, performing single enzyme digestion on the empty vector by EcoRI for comparison. The detection result of gel electrophoresis is shown in the diagram B of FIG. 2, the recombinant vector is cut by EcoRI to obtain two bands, the size of the band above 5000bp is consistent with the size of the band cut by no-load single enzyme (5211 bp), and the band below 1500bp is consistent with the size of the band of the target gene amplified by PCR (1407 bp). And finally, carrying out sequencing on the recombinant plasmid with the identified correct identification, wherein the obtained sequencing result shows that the comparison result of the sequence of the insert fragment in pcDNA3.1-3HA-ROR alpha and the known sequence of the dairy cow ROR alpha gene in NCBI database is 100%. The result shows that the eukaryotic expression vector pcDNA3.1-3HA-ROR alpha is successfully constructed.
In fig. 2 a. Bacterial liquid PCR identification results: dl 5000Marker; PCR amplified product bacterial liquid of ROR alpha gene CDS region; ROR alpha gene CDS region PCR amplification product bacterial liquid
And B, pcDNA3.1-3HA-ROR alpha recombinant vector enzyme digestion identification result: dl 10000Marker;1. single enzyme cutting product of empty carrier; 2. recombinant vector pcDNA3.1-HA-ROR alpha single enzyme cutting product (CDS region); PCR amplified product of ROR alpha gene CDS region.
Total RNA of HEK293T cells of the experimental group and the control group is extracted, cDNA is synthesized by reverse transcription, and qPCR reaction is carried out by taking the cDNA as a template. As shown in FIG. 3, the mRNA expression level of pcDNA3.1-3 HA-ROR. Alpha. In the experimental group was significantly increased by about 500-fold (P < 0.01) as compared with that in the control group pcDNA3.1-Puro-N-3 HA. Thus, the above results indicate that pcDNA3.1-3HA-ROR alpha transfection experimental group successfully realizes the overexpression of the ROR alpha gene of dairy cows at the mRNA level.
P <0.01 in fig. 3 indicates that the difference is extremely significant;
WB detection of expression of the cow ROR alpha Gene at the protein level
Total proteins of HEK293T cells of the experimental group and the control group are extracted, and after WB detection, the result is shown in figure 4, after incubation with rabbit anti-HA primary antibody, the experimental group transfected by pcDNA3.1-3HA-ROR alpha presents a distinct and single band at 56kDa, which is consistent with the expected target protein size, while the control group transfected with empty plasmid HAs no band at the target protein position. Thus, the above results indicate that the pcDNA3.1-3HA-ROR alpha protein of the experimental group ROR alpha was successfully overexpressed in HEK293T cells.
The above is merely a further embodiment of the present invention, but the protection scope of the present invention is not limited thereto, and any person skilled in the art will be able to apply equivalents and modifications according to the technical solution and the concept of the present invention within the scope of the present invention disclosed in the present invention.
Claims (9)
1. Cloning of bovine ROR alpha gene and construction of eukaryotic expression vector, which is characterized in that: the method comprises the following steps:
step one: selecting fresh liver tissue of Holstein cows in slaughter houses, weighing 20mg of liver tissue, extracting total RNA, reversely transcribing into cDNA, and storing at-20 ℃ for later use;
step two: selecting pcDNA3.1-Puro-N-3HA vector, designing primer, and obtaining CDS region of cow ROR alpha gene predicted sequence from NCBI database;
step three: PCR primers with EcoRI cut linearized homology arms of the pcDNA3.1-Puro-N-3HA vector were designed using Primer Premier 5.0 software.
2. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 1, wherein: in the second step, the accession number of the CDS region of the predicted sequence of the dairy cow ROR alpha gene is XM_024997674 from the NCBI database.
3. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 2, wherein: the primer sequence designed in the second step is as follows:
F:5-agcaagctttctagagaattcATGATGTATTTTGTGATCGCAG-3；
R:5-accggat-ccgatatcgaattcTTACCCATCAATCTGCATGGCT-3。
4. the cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 3, wherein: agcaagctttctagagaattc and accggat-ccgatatcgaattc are homologous arms of EcoRI digestion linearization pcDNA-3.1-Puro-N-3HA vector;
wherein gaattc is EcoRI cleavage site.
5. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 4, wherein: in the first step, cDNA is prepared by adopting the TOYOBO reverse transcription reaction kit operation steps;
genomic DNA removal reaction system 8 μl:4 XDN Master mix 2.0. Mu.L, RNA template 4. Mu. L, ddH2O 2. Mu.L;
the reaction procedure: 5min at 37 ℃, 10 mu L of reverse transcription reaction system, 8 mu L of genomic DNA removal reaction solution, 2 mu L of 5 xRT Master Mix II;
degree of reaction: 15min at 37 ℃;50 ℃ for 5min;98 ℃ for 5min; preserving at 4 ℃.
6. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 5, wherein: the cDNA is obtained as a template, and CDS region fragments with homology arms of the ROR alpha genes of the cows are amplified;
PCR reaction 50. Mu.L: cDNA 4. Mu.L (50 ng/. Mu.L), 1.5. Mu.L each of the upstream and downstream primers (10. Mu.M), 2X PrimeSTAR Max Premix. Mu. L, ddH 2.2O18. Mu.L each;
PCR reaction procedure: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 55℃for 15s, elongation at 72℃for 85s, and circulation 40 times (step 2-4); extending at 72deg.C for 5min;16 ℃ infinity;
after the PCR reaction is finished, the PCR product is identified by agarose gel electrophoresis, and the target gene DNA fragment is purified and recovered according to the specification of a general DNA purification and recovery kit.
7. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 6, wherein: the empty vector pcDNA3.1-Puro-N-3HA vector was linearized with the restriction enzyme EcoRI and the cleavage products were detected by agarose gel electrophoresis experiments, 50. Mu.L of the reaction system: 10X QuickCut Green Buffer. Mu.L, restriction enzyme EcoRI 5.5. Mu.L, pcDNA3.1 vector 9.7. Mu. L, ddH2O 29.8. Mu.L, 37℃for 1h 30min, then the target strip was gel recovered using a universal DNA purification recovery kit to give a linearized vector ready for use.
8. The cloning of bovine ROR alpha gene and construction of eukaryotic expression vector according to claim 7, wherein: the target fragment was recombinantly ligated with linearized pcDNA3.1 vector, reaction system 20. Mu.L: linearization of 0.869. Mu.L vector, 5.6. Mu.L insert, 5 XCE II Buffer 4. Mu. L, exnase II 2. Mu. L, ddH2O 7.531. Mu.L, 37℃reaction for 30min, cooling to 4℃or immediately cooling on ice to obtain recombinant plasmid product.
9. The cloning and eukaryotic expression vector construction of bovine ROR alpha gene of claim 8, wherein: transferring the recombinant product into DH5 alpha escherichia coli competent cells according to the operation instructions of a transformation reaction, and coating the cells in a solid culture medium containing ampicillin (30 mug/mL);
culturing for 12-16 h in a 37 ℃ incubator, and then picking up monoclonal colonies, shaking the colonies for 12h in a shaking table at 37 ℃;
and (3) carrying out PCR amplification by taking the bacterial liquid as a DNA template to detect whether the bacterial liquid contains positive clones, wherein the reaction system is as follows: 2X Quick Taq HSDyeMix 7.5.5. Mu.L of each of the upstream and downstream primers, 0.5. Mu.L of the bacterial liquid 2. Mu. L, ddH2O, and 15. Mu.L of the bacterial liquid were added, followed by the following reaction procedures: pre-denaturation at 94℃for 10min; denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 68℃for 85s, and cycling for 35 times; extending at 68deg.C for 5min;16 ℃ infinity;
extracting positive plasmids according to the specification of the endotoxin-free plasmid small-extraction medium-amount kit and detecting the concentration of the positive plasmids;
then, single restriction enzyme EcoRI is used for single restriction enzyme identification, and positive plasmids with the restriction enzyme identification result meeting the expectations are sent to Seamantadine biological limited company for sequencing identification; the returned sequence was aligned with the CDS region sequence of the dairy cow ROR alpha gene in the NCBI database, and the correctly aligned plasmid sample was named pcDNA3.1-3HA-ROR alpha.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211031385.9A CN116103299A (en) | 2022-08-26 | 2022-08-26 | Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211031385.9A CN116103299A (en) | 2022-08-26 | 2022-08-26 | Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116103299A true CN116103299A (en) | 2023-05-12 |
Family
ID=86260380
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211031385.9A Pending CN116103299A (en) | 2022-08-26 | 2022-08-26 | Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116103299A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110236933A1 (en) * | 2010-03-24 | 2011-09-29 | Soochow University | RECOMBINANT EUKARYOTIC EXPRESSION PLASMID ENCODING pprI GENE OF DEINOCOCCUS RADIODURANS R1 AND ITS FUNCTIONS |
| CN105296519A (en) * | 2015-09-17 | 2016-02-03 | 长江大学 | Construction and application of mouse CRABP2 gene eukaryotic expression vector |
| CN107236750A (en) * | 2017-05-05 | 2017-10-10 | 西北农林科技大学 | Ox PDHB gene overexpressions recombinant adenoviral vector is built and packing method |
-
2022
- 2022-08-26 CN CN202211031385.9A patent/CN116103299A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110236933A1 (en) * | 2010-03-24 | 2011-09-29 | Soochow University | RECOMBINANT EUKARYOTIC EXPRESSION PLASMID ENCODING pprI GENE OF DEINOCOCCUS RADIODURANS R1 AND ITS FUNCTIONS |
| CN105296519A (en) * | 2015-09-17 | 2016-02-03 | 长江大学 | Construction and application of mouse CRABP2 gene eukaryotic expression vector |
| CN107236750A (en) * | 2017-05-05 | 2017-10-10 | 西北农林科技大学 | Ox PDHB gene overexpressions recombinant adenoviral vector is built and packing method |
Non-Patent Citations (4)
| Title |
|---|
| JING ZHANG等: "Circadian clock regulates granulosa cell autophagy through NR1D1-mediated inhibition of ATG5", 《AMERICAN JOURNAL OF PHYSIOLOGY》, vol. 322, no. 2, pages 231 * |
| NCBI: "PREDICTED: Bos taurus RAR related orphan receptor A (RORA), transcript variant X2, mRNA，登录号：XM_024997674", 《NCBI GENBANK》, pages 1 - 2 * |
| 刘薇等: "奶牛 RORα基因的生物信息学分析与组织表达谱", 《基因组学与应用生物学》, pages 1 - 18 * |
| 高登科等: "山羊RORα基因的克隆、表达载体构建及功能分析", 《畜牧兽医学报》, vol. 53, no. 6, pages 1782 - 1783 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111154763B (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN110628766B (en) | LncRNA coding gene related to sheep skeletal muscle development and application thereof | |
| CN112680424A (en) | Preparation method of recombinant baculovirus expressing human transferrin receptor | |
| CN116103299A (en) | Cloning of bovine ROR alpha gene, construction of eukaryotic expression vector and application thereof | |
| CN106831975B (en) | Application of heat shock transcription factor 1 in regulation and control of expression of 15kDa selenoprotein | |
| CN110747230A (en) | Method for promoting bovine skeletal muscle satellite cell myogenic differentiation | |
| CN106086073A (en) | A kind of expression of cytokine IL 7 | |
| Müllenbach et al. | A novel discoidin domain receptor 1 (Ddr1) transcript is expressed in postmeiotic germ cells of the rat testis depending on the major histocompatibility complex haplotype | |
| CN103255168B (en) | Construct and application thereof | |
| CN103421793B (en) | Cloning and application of swine liver specificity expression gene TTR promoter | |
| CN110511933B (en) | Rat long-chain non-coding lncRNA-lncMSTRG10078 and application thereof in resisting cell injury | |
| CN114107176A (en) | CHO cell line for stably expressing African swine fever CD2v protein and construction method and application thereof | |
| CN103014049A (en) | Method for bovine interferon-t prokaryotic expression, product purification and biological activity identification | |
| CN106701764B (en) | Promoter of 15kDa selenoprotein gene, core region and application thereof | |
| CN113403318B (en) | Method for cloning full-length segment of pig BRS3 gene CDs sequence | |
| CN104761630A (en) | Milk cow early pregnancy factor protein, expression vector and application of milk cow early pregnancy factor protein in milk cow early pregnancy judgment | |
| CN107090451A (en) | A kind of long-chain non-coding RNA uc.77 and its application | |
| Ren et al. | A 304 bp insertion/deletion mutation in promoter region induces the increase of porcine IDH3β gene expression | |
| CN111944846B (en) | Application of pig Crabp2 gene in regulation and control of apoptosis of pig follicular granular cells | |
| Qin et al. | Cloning of Xuhuai goat lipoprotein lipase gene and the preparation of transgenic sheep | |
| CN110777166B (en) | Construction and application of bovine KLF3 gene eukaryotic overexpression vector | |
| CN115927402A (en) | FTO gene of milk goat and application thereof in adjusting accumulation of mammary gland cell lipid of milk goat | |
| CN114350633B (en) | Antigen peptide of DNA methyltransferase 1 and polyclonal antibody thereof | |
| CN113388639B (en) | Method for breeding zebra fish vmhcEGFP-KI strain by gene knock-in | |
| CN116218908A (en) | Construction method of mammary epithelial cells stably expressing bovine prolactin protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |