CN116103163A

CN116103163A - Fusarium and application thereof

Info

Publication number: CN116103163A
Application number: CN202211733997.2A
Authority: CN
Inventors: 罗梃楷; 孙超; 刘会川; 孙浩; 丁波; 曾春玲; 刘喜荣
Original assignee: Hunan Chengda Biotechnology Co ltd
Current assignee: Hunan Chengda Biotechnology Co ltd
Priority date: 2022-12-30
Filing date: 2022-12-30
Publication date: 2023-05-12

Abstract

The application provides Fusarium and application thereof, wherein Fusarium (Fusarium sp.) is preserved in the China center for type culture Collection (China center for type culture Collection) at the 12 th month of 2022, and the preservation address is China university of Wuhan and Wuhan, and the preservation number is CCTCC NO: M20222093. The fusarium can produce cholesterol esterase under the condition of only olive oil induction, does not need to add an organic solvent or a surfactant, and has the characteristics of simple process, high enzyme production efficiency, safety, environmental protection, no toxic or harmful effect on human bodies and the like.

Description

Fusarium and application thereof

Technical Field

The application relates to the technical field of microorganisms, in particular to fusarium and application thereof.

Background

Cholesterol esterase (Cholesterol esterase) is an important steroid esterase and has wide application in the industries of food, medicine, paper making and the like. Steroids or steroid compounds are widely distributed in the biological kingdom, are present in a wide variety of animal tissues and microbial cells, and serve a wide variety of functions, and are involved in the formation of organisms or as important active substances in the living body. Sterols (sterols), also known as sterols, are a broad class of steroids that are not normally cholesterol-free in plants but contain stigmasterol (stigmasterol) and sitosterol (sitosterol) that are not absorbed by animals; cholesterol is only present in animals, and is an important component of vertebrate cells, and is also an important active substance or precursor thereof in animals.

Cholesterol esterases are an enzyme that catalyzes the hydrolysis of cholesterol esters to cholesterol and fatty acids. In recent years, research shows that many human complications, such as cardiovascular and cerebrovascular diseases, liver and gall diseases, kidney diseases, diabetes and the like, are related to abnormal cholesterol metabolism of human bodies, and measuring the content of total cholesterol in blood plasma has become an important reference index in clinical diagnosis.

Traditional cholesterol esterase preparation processes are for example:

chinese patent application CN109456953a describes a cholesterol esterase prepared by fermentation of fusarium, the enzyme thus prepared has good function of hydrolyzing cholesterol ester; the use of Fusarium to prepare cholesterol esterase was shown to be viable.

Chinese patent application CN109971735a describes a method for preparing cholesterol esterase which is resistant to high temperature and organic solvents by adding organic solvents and surfactants; wherein the surfactant is Triton X-100 (Triton X-100) with hydrophilic end and hydrophobic end, which is not easily affected by strong electrolyte inorganic salt, and can combine with lipid such as phospholipid in biological membrane to form soluble complex; however, the traditional Chinese medicine composition has micro toxicity, causes a certain damage to human body, and has complex and complicated process by removing residual triton X-100 in the subsequent steps.

Thus, the preparation of cholesterol esterases using microorganisms is feasible and the discovery of new microbial resources is of paramount importance.

Disclosure of Invention

Based on this, the main object of the embodiments of the present application consists in providing a strain of fusarium capable of producing cholesterol esterases under conditions induced by olive oil only.

According to one aspect of the present application there is provided a Fusarium sp., deposited with the China center for type culture Collection at a accession number CCTCC NO: M20222093 at 12.28 of 2022.

According to another aspect of the present application, there is provided a method for preparing cholesterol esterase, comprising the step of preparing cholesterol esterase using fusarium described above.

In one embodiment, the step of preparing cholesterol esterase using the fusarium described above comprises:

inoculating the fusarium into a fermentation medium for fermentation culture; and

adding olive oil into the fermentation culture product for induction culture to prepare cholesterol esterase.

In one embodiment, the olive oil is at a concentration of 0.5% (v/v) to 1.5% (v/v).

In one embodiment, the fermentation medium comprises water and yeast powder, peptone, glycerol, potassium dihydrogen phosphate and dipotassium hydrogen phosphate.

In one embodiment, the mass concentration of the yeast powder is 2.2% (w/v) to 2.6% (w/v); the mass concentration of the peptone is 1.0% (w/v) to 1.4% (w/v); the mass concentration of the glycerol is 0.4% (w/v) to 0.6% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.18% (w/v) to 0.22% (w/v); and the mass concentration of the dipotassium hydrogen phosphate is 1.6% (w/v) to 2.0% (w/v).

In one embodiment, the conditions of the fermentation culture include: the temperature is 29-31 ℃, the culture time is 8-12 h, and the rotating speed is 380-420 rpm.

In one embodiment, the fusarium is inoculated in the fermentation medium in the form of a seed solution, and the seed solution is prepared by the steps of:

inoculating the fusarium onto a flat culture medium or a slant culture medium for culture; and

and selecting single colonies from the obtained colonies, and inoculating the single colonies into a seed culture medium for culture to prepare seed liquid.

In one embodiment, the plating or slant medium comprises water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder, 0.8% (v/v) to 1.2% (v/v) potato starch, and 0.8% (v/v) to 1.2% (v/v) agar powder.

In one embodiment, the seed medium comprises water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder, and 0.8% (v/v) to 1.2% (v/v) potato starch.

Compared with the prior art, the method has the following advantages:

the application provides a fusarium, which can produce cholesterol esterase under the condition of only olive oil induction without adding an organic solvent and a surfactant, and has the characteristics of simple process, high enzyme production efficiency, safety, environmental protection, no toxic or harmful effect on human body and the like.

In addition, the preparation method of the cholesterol esterase has simple and convenient process, is safe and has no toxic or harmful effect, and is suitable for popularization and application in industry.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present application, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is an electrophoresis detection chart of strain identification in example 1 of the present application;

FIG. 2 is a graph of thin layer chromatography after cholesterol esterase production by 4 strains of example 2 of the present application, followed from left to right by Rhizobium, pseudomonas fluorescens, burkholderia and Fusarium of the present application.

Fusarium DL provided by the application is preserved in China center for type culture Collection (China center for type culture Collection) in 12 months and 28 days in 2022, and the preservation address is China university of Wuhan and Wuhan, and the preservation number is CCTCC NO: M20222093.

Detailed Description

The detailed description of the embodiments of the present application will be presented in order to make the above objects, features and advantages of the present application more obvious and understandable. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. This application is, however, susceptible of embodiment in many other forms than those described herein and similar modifications can be made by those skilled in the art without departing from the spirit of the application, and therefore the application is not to be limited to the specific embodiments disclosed below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, and the like used in the present application are commercially available or may be prepared by existing methods.

Terminology

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

the term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).

The terms "plurality", "plural", "multiple", and the like are used herein, and refer to a number of 2 or more, unless otherwise specified. For example, "one or more" means one kind or two or more kinds.

In this application, "further," "still further," "particularly," and the like are used for descriptive purposes and are not to be construed as limiting the scope of the present application.

In this application, "optional," "optional," and "optional" refer to the presence or absence of, that is, either one of the two parallel schemes is selected from "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present application, the technical features described in an open manner include a closed technical scheme composed of the listed features, and also include an open technical scheme including the listed features.

In this application, reference is made to a numerical interval (i.e., a numerical range), where the optional numerical distribution is considered continuous, and includes two numerical endpoints (i.e., a minimum value and a maximum value) of the numerical range, and each numerical value between the two numerical endpoints, unless otherwise indicated. Where a numerical range merely refers to integers within the numerical range, including both end integers of the numerical range, and each integer between the two ends, unless otherwise indicated, each integer is recited herein as directly, such as where t is an integer selected from 1-10, and where t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Further, when a plurality of range description features or characteristics are provided, these ranges may be combined. In other words, unless otherwise indicated, the ranges disclosed herein are to be understood to include any and all subranges subsumed therein.

The temperature parameter in the present application is not particularly limited, and may be a constant temperature treatment or may vary within a predetermined temperature range. It should be appreciated that the constant temperature process described allows the temperature to fluctuate within the accuracy of the instrument control. Allows for fluctuations within a range such as + -5 ℃, + -4 ℃, + -3 ℃, + -2 ℃, + -1 ℃.

In the present application,% (w/w) and wt% each represent weight percent,% (v/v) means volume percent,% (w/v) means mass volume percent.

Some embodiments of the present application provide a Fusarium sp DL deposited with the chinese collection at 2022, 12 months and 28 days, with the deposit number cctccc No. M20222093 at university of wuhan, chinese.

The Chinese patent application CN109456953A provides a cholesterol esterase prepared by fermentation of fusarium, and the prepared enzyme has a good function of hydrolyzing cholesterol ester; the use of Fusarium to prepare cholesterol esterase was shown to be viable. It will be appreciated by those skilled in the art that the fermentation production of microbial enzymes is accomplished by the interaction of the biochemical activities of the microorganisms with environmental conditions, the medium composition, the culture conditions (i.e., temperature, humidity, pH, etc.), and the growth rate of the microorganisms and the ability of the enzymes to form.

Based thereon, some embodiments of the present application also provide a method for preparing cholesterol esterase.

In some of these embodiments, the method of preparation comprises the step of preparing cholesterol esterase using fusarium as described above.

In some embodiments, the step of preparing a cholesterol esterase described above comprises:

inoculating fusarium into a fermentation culture medium for fermentation culture; and

In some embodiments, the concentration of the olive oil is 0.5% (v/v) to 1.5% (v/v).

It is understood that the above mentioned concentration of olive oil refers to the volume percentage of olive oil added to the fermentation medium.

Further, the concentration of the olive oil is 0.8% (v/v) to 1.2% (v/v).

Further, the concentration of the olive oil is 1.0% (v/v).

It is understood that olive oil can effectively induce microbial enzyme production, but the formation of the enzyme can be inhibited when the concentration of olive oil is too high, and the induction effect is not obvious when the concentration is too low; thus, the concentration of the inducer in the method for producing cholesterol esterase of the present application is 0.5% (v/v) to 1.5% (v/v).

In some embodiments, the fermentation medium comprises water and one or more of yeast powder, peptone, glycerol, potassium dihydrogen phosphate, and dipotassium hydrogen phosphate.

It will be appreciated that yeast powder is capable of providing high quality proteins, intact amino acids and essential precursor substances for the growth of the strain; peptone contains abundant amino acids, vitamins and other growth factors required by microorganism growth; glycerol can be used as a carbon source for metabolism and growth of microorganisms; the monopotassium phosphate and dipotassium phosphate can be used as inorganic salts to promote basic metabolism of microorganisms and influence synthesis of metabolites, and meanwhile, the pH value of a culture medium is buffered, so that the pH value required by growth of the microorganisms can be maintained;

in some specific examples, the mass concentration of the yeast powder in the fermentation medium is 2.2% (w/v) to 2.6% (w/v); the mass concentration of the peptone is 1.0% (w/v) to 1.4% (w/v); the mass concentration of the glycerol is 0.4% (w/v) to 0.6% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.18% (w/v) to 0.22% (w/v); the mass concentration of the dipotassium hydrogen phosphate is 1.6% (w/v) to 2.0% (w/v).

Further, the mass concentration of the yeast powder is 2.2% (w/v) to 2.5% (w/v); the mass concentration of the peptone is 1.0% (w/v) to 1.2% (w/v); the mass concentration of the glycerol is 0.4% (w/v) to 0.5% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.18% (w/v) to 0.20% (w/v); the mass concentration of the dipotassium hydrogen phosphate is 1.8% (w/v) to 2.0% (w/v).

Further, the mass concentration of the yeast powder is 2.4% (w/v) to 2.5% (w/v); the mass concentration of the peptone is 1.1% (w/v) to 1.2% (w/v); the mass concentration of the glycerol is 0.4% (w/v) to 0.5% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.19% (w/v) to 0.20% (w/v); the mass concentration of the dipotassium hydrogen phosphate is 1.8% (w/v) to 1.9% (w/v).

In one specific example, the mass concentration of yeast powder is 2.4% (w/v); the mass concentration of peptone is 1.2% (w/v); the mass concentration of the glycerol is 0.5% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.20% (w/v); the mass concentration of dipotassium hydrogen phosphate was 1.8% (w/v).

In some embodiments, the fermentation medium consists of water and yeast powder, peptone, glycerol, potassium dihydrogen phosphate and dipotassium hydrogen phosphate.

In some embodiments, in the above method for producing a cholesterol esterase, the conditions for fermentation culture include: the temperature is 29-31 ℃, the culture time is 8-12 h, and the rotating speed is 380-420 rpm.

Further, in the above-mentioned cholesterol esterase preparation method, the conditions for fermentation culture include: the temperature is 30 ℃, the culture time is 8-12 h, and the rotating speed is 400rpm.

In a specific example, the conditions of the fermentation culture include: the temperature was 30℃and the incubation time was 8 hours at 400rpm.

In some embodiments, the method for preparing cholesterol esterase, wherein the conditions for induction culture by adding olive oil include: the temperature is 29-31 ℃ and the pH value is 4.5-5.5.

In a specific example, in the above method for preparing cholesterol esterase, the conditions for induction culture by adding olive oil include: the temperature was 30℃and the pH was 5.0.

In some embodiments, the above cholesterol esterase preparation method, the fusarium is inoculated in the fermentation medium in the form of a seed solution, and the seed solution preparation step comprises S10 and S20.

Step S10: fusarium is inoculated on a flat culture medium or a slant culture medium for culture;

step S20: and selecting single colonies from the obtained colonies, and inoculating the single colonies into a seed culture medium for culture to prepare seed liquid.

In some embodiments, the plating or slant medium comprises water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder, 0.8% (v/v) to 1.2% (v/v) potato starch, and 0.8% (v/v) to 1.2% (v/v) agar powder.

Further, the plate culture medium or the inclined culture medium comprises water, 0.8% (v/v) to 1.0% (v/v) glucose, 0.8% (v/v) to 1.0% (v/v) peptone, 0.4% (v/v) to 0.5% (v/v) yeast powder, 0.8% (v/v) to 1.0% (v/v) potato starch and 0.8% (v/v) to 1.0% (v/v) agar powder.

In one specific example, the plate medium or slant medium contains water and 1.0% (v/v) glucose, 1.0% (v/v) peptone, 0.5% (v/v) yeast powder, 1.0% (v/v) potato starch, and 1.0% (v/v) agar powder.

In some of these embodiments, the seed medium comprises water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder, and 0.8% (v/v) to 1.2% (v/v) potato starch.

Further, the seed culture medium comprises water, 0.8% (v/v) to 1.0% (v/v) glucose, 0.8% (v/v) to 1.0% (v/v) peptone, 0.4% (v/v) to 0.5% (v/v) yeast powder and 0.8% (v/v) to 1.0% (v/v) potato starch.

In one specific example, the seed medium comprises water and 1.0% (v/v) glucose, 1.0% (v/v) peptone, 0.5% (v/v) yeast powder, and 1.0% (v/v) potato starch.

The preparation method of the cholesterol esterase has at least the following advantages:

(1) The steps are simple: no organic solvent or surfactant is required to be added, and no wastewater treatment is required in the subsequent work; the components of the used culture medium are simple and easy to obtain;

(2) Safe and nontoxic: the olive oil is used as an inducer to produce enzyme, so that the method has no toxic or harmful effect on human bodies; is suitable for popularization and application in actual production.

The present application will be further described with reference to specific examples and comparative examples, which should not be construed as limiting the scope of the present application.

Example 1, identification of Strain

The identification was performed by Hunan division of Biotechnology Co.Ltd. Detection of a wild-type strain of DL Fusarium was performed using the primers shown in Table 1 (SEQ ID NO.1 and SEQ ID NO. 2), FIG. 1 is an electrophoretically detected image of the PCR amplified product; further, the sequence alignment shows that: the sequence similarity of the sequencing sequence of the strain to the sequence of known Fusarium sp. Is up to 99% (537 bp/540 bp), so the strain is identified as Fusarium. Fusarium is preserved in China center for type culture Collection (China, university of Wuhan, china, with a preservation number of CCTCC NO: M20222093) at 12 months and 28 days 2022.

TABLE 1 primer information for strain identification

Primer name	Sequence information (5'-3’)
		SEQ ID NO.1	TCCGTAGGTGAACCTGCGG
SEQ ID NO.2	TCCTCCGCTTATTGATATGC

Example 2 comparison of enzyme production efficiency and enzyme Activity of different strains

(1) Preparation of culture medium

Plate medium: 1% (v/v) glucose, 1% (v/v) peptone, 0.5% (v/v) yeast powder, 1% (v/v) potato starch, 1% (v/v) agar powder and the balance water are added according to the volume percentage; adjusting pH to about 5.0, and sterilizing at 121deg.C under high temperature and high pressure for 20min.

Seed culture medium: 1% (v/v) glucose, 1% (v/v) peptone, 0.5% (v/v) yeast powder, 1% (v/v) potato starch, and the balance water are added in percentage by volume; adjusting pH to about 5.0, and sterilizing at 121deg.C under high temperature and high pressure for 20min.

Fermentation medium: 2.4% (w/v) yeast powder, 1.2% (w/v) peptone, 0.5% (w/v) glycerol, 1.8% (w/v) dipotassium hydrogen phosphate, 0.2% (w/v) potassium dihydrogen phosphate and the balance of water are added according to the mass percentage; adjusting pH to about 5.0, and sterilizing at 121deg.C under high temperature and high pressure for 20min.

(2) Strain culture

Rhizobium soyabean with the commodity model number ACCC15067, pseudomonas fluorescens with the commodity model number ATCC13525 and Burkholderia are purchased from Shanghai Jiachu bioengineering Co.

Respectively streaking and inoculating rhizobia, pseudomonas fluorescens, burkholderia and fusarium isolated by the method to a flat-plate culture medium, placing the flat-plate culture medium into an incubator with the temperature of 30 ℃ and the humidity of more than 50%, culturing for 48 hours, observing colony morphology, selecting single colony in a sterile environment, adding the single colony into a seed culture medium, culturing for 48 hours in a constant-temperature shaking table with the temperature of 30 ℃ and the speed of 200rpm, and observing colony morphology of the strain in a liquid culture medium; inoculating the seed solution activated in the seed culture medium into a fermentation culture medium, and culturing in a constant temperature shaking table at 30 ℃ and 400rpm for 8 hours.

(3) Adding olive oil with the volume ratio of 1% (v/v) into the cultured bacterial liquid to induce enzyme production; to verify the enzyme production effect, the ingredients of the transformation system shown in Table 2 (cholesterol acetate at a concentration of 1% as a substrate) were added to 100mL of the fermented strain culture, and the pH was adjusted to about 5.0, and cultured in a constant temperature shaker at 30℃and 200 rpm.

TABLE 2 conversion System

Composition of the components	Content of
		Defoaming agent	0.1g
Tween 80	0.1g
		Cholesterol acetate	1.0g

(4) Thin layer chromatography (Thin-Layer Chromatography, TLC)

In order to rapidly detect whether cholesterol esterase is produced, 100 mu L of the conversion reaction liquid in the step (3) is extracted to 0.5mL by using dichloromethane, the extraction liquid is sampled and spotted into a silica gel plate, a developing agent (dichloromethane and ethyl acetate are mixed in a ratio of 1:1) is used for running the plate, and finally color development observation is carried out by ultraviolet; the staining results are shown in FIG. 2 (1. Rhizobia; 2. Pseudomonas fluorescens; 3. Burkholderia; 4. Fusarium; in order from left to right).

The TLC chromogenic results show that compared with rhizobia, pseudomonas fluorescens and Burkholderia, the fusarium used in the method has the advantages of more enzyme yield, higher enzyme yield and higher enzyme activity.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples merely represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. Accordingly, the scope of protection of the present application is to be determined by the claims appended hereto.

Claims

1. Fusarium sp.) which has been deposited at the China center for type culture Collection at a accession number of CCTCC NO: M20222093 at the university of Wuhan, china, 12 months and 28.

2. A process for the preparation of a cholesterol esterase, characterized in that it comprises the step of preparing a cholesterol esterase using the fusarium of claim 1.

3. The method for producing cholesterol esterase according to claim 2, wherein the step of producing cholesterol esterase using the fusarium according to claim 1 comprises:

4. A method of preparing a cholesterol esterase according to claim 3, wherein the concentration of olive oil is 0.5% (v/v) to 1.5% (v/v).

5. The method for producing cholesterol esterase according to claim 3 or 4, wherein the fermentation medium contains water and yeast powder, peptone, glycerol, potassium dihydrogen phosphate and dipotassium hydrogen phosphate.

6. The method for producing cholesterol esterase according to claim 5, wherein the mass concentration of the yeast powder is 2.2% (w/v) to 2.6% (w/v); the mass concentration of the peptone is 1.0% (w/v) to 1.4% (w/v); the mass concentration of the glycerol is 0.4% (w/v) to 0.6% (w/v); the mass concentration of the potassium dihydrogen phosphate is 0.18% (w/v) to 0.22% (w/v); and the mass concentration of the dipotassium hydrogen phosphate is 1.6% (w/v) to 2.0% (w/v).

7. The method for producing cholesterol esterase according to claim 3, 4 or 6, wherein the conditions for fermentation culture include: the temperature is 29-31 ℃, the culture time is 8-12 h, and the rotating speed is 380-420 rpm.

8. The method of claim 3, 4 or 6, wherein the fusarium is inoculated in the fermentation medium in the form of a seed solution, and the seed solution is prepared by:

9. The method for preparing cholesterol esterase according to claim 8, wherein the plate medium or the slant medium contains water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder, 0.8% (v/v) to 1.2% (v/v) potato starch and 0.8% (v/v) to 1.2% (v/v) agar powder.

10. The method for producing cholesterol esterase according to claim 8, wherein the seed medium contains water and 0.8% (v/v) to 1.2% (v/v) glucose, 0.8% (v/v) to 1.2% (v/v) peptone, 0.4% (v/v) to 0.6% (v/v) yeast powder and 0.8% (v/v) to 1.2% (v/v) potato starch.