CN116083458A

CN116083458A - Mucopolysaccharide storage disease IIIC pathogenic mutant gene and application thereof

Info

Publication number: CN116083458A
Application number: CN202310135848.4A
Authority: CN
Inventors: 唐宇; 赵洪军; 吴俊娇; 王丽静
Original assignee: Xiangya Hospital of Central South University
Current assignee: Xiangya Hospital of Central South University
Priority date: 2023-02-20
Filing date: 2023-02-20
Publication date: 2023-05-09
Anticipated expiration: 2043-02-20
Also published as: CN116083458B

Abstract

The invention relates to a new mutation of a mucopolysaccharidosis IIIC (MPSIWC) pathogenic gene and application thereof, which discovers a new mutation site of the MPSIWC pathogenic gene HGSNAT for the first time, wherein: complex heterozygous mutations were detected on the pre-protector hgsnap gene: the missense mutation of the mutation located in exon 7 was newly found, which resulted in the mutation of glycine Gly at position 248 of HGSNAT protein to glutamic acid Glu. The invention further verifies that the two variants cause the loss of activity of HGSNAT and the failure of lysosome localization through bioinformatics and experimental means respectively, thereby proving that the two variants are both harmful pathogenic variants. Therefore, the novel pathogenic mutation expands the MPSIWC pathogenic gene mutation spectrum, and has important significance for elucidating the pathogenesis of MPSIWC and developing gene diagnosis.

Description

Mucopolysaccharide storage disease IIIC pathogenic mutant gene and application thereof

Technical Field

The invention relates to a pathogenic gene HGSNAT mutation site of rare genetic disease MPSIWC and application thereof in diagnosis, belonging to the field of biomedicine.

Background

Mucopolysaccharidoses (MPS) are a group of diseases in which the clinical symptoms caused by deposition in various tissues are not identical due to the lack of lysosomal hydrolases, which prevent the complete degradation of different acidic mucopolysaccharides (aminoglucans). Degradation of glycosaminoglycans must be carried out in lysosomes, and 10 enzymes are known to be involved in the degradation process, wherein defects in any one enzyme can cause degradation disorders of the aminodextran chains to accumulate in the body and be excreted from the urine, causing cellular structural and functional abnormalities, pathological changes in organs, and clinical symptoms. MPS can be classified into 7 large types, I-VII, etc., each type being subdivided into several subtypes, depending on clinical manifestations and enzyme defects.

Among these, mucopolysaccharidosis IIIC (Sanfilippo C, MPSIIIC, OMIM # 252930) is a multisystem MPS characterized by progressive central nervous system degeneration, manifesting as autosomal recessive inheritance, hgsnap monogenic inheritance disease, with clinical symptoms mainly severe intellectual impairment, developmental degeneration and other neurological manifestations including autism spectrum disorders, behavioral problems and sleep disorders. The disease usually develops before the age of ten, and other clinical manifestations of the patient include muscle/bone problems (including joint stiffness, contractures, scoliosis, hip dysplasia, etc.), hearing loss, respiratory and sinus lung infections, heart problems (valve thickening, heart conduction system defects), etc. The disease is highly heterogeneous clinically, with phenotypic severity varying even among members of the same family.

The deficiencies of various enzymes of MPSIII type (4 different enzyme deficiencies are possible) can cause degradation disorders of Heparan Sulfate (HS), wherein MPSILC consists essentially of acetyl CoA: pathogenic mutation of the alpha-aminoglycoside N-acetyltransferase (HGSNAT) gene results in loss of enzyme activity. CN110184337a discloses detection of 55 genes and gene positions related to genetic diseases, and specific examples related to mucopolysaccharidoses are:

disease subtype	Gene	Gene position
			Mucopolysaccharidosis 1s/Ih/s	IDUA	4P16.3
Mucopolysaccharidosis IIIA type	SGSH	17q25.3
			Mucopolysaccharidosis IIIB type	NAGLU	17q21.2
Mucopolysaccharidosis IIID	GNS	12q14.3
			Mucopolysaccharidosis type II	IDS	Xq28

In addition, corresponding probes and detection kits are also disclosed, and MPSILC type detection is not involved.

CN112813156a discloses a DNA library for detecting and diagnosing skeletal development disorder pathogenic genes and application thereof, the DNA library includes 507 pathogenic genes, but no specific pathogenic genes related to MPSIIIC are disclosed.

CN110423805a discloses a primer pool for detecting genotyping of neonatal mucopolysaccharidoses, said primer pool comprising several primer pairs for specific amplification of the targeting sequences of the GLB1, HYAL1, IDUA, ARSB, GUSB, HGSNAT, IDS, GNS, GALNS, NAGLU, SGSH genes, respectively. Wherein HGSNAT is taken as MPSIWC related detection gene, but the research of pathogenic mutation in the gene is not involved.

In conclusion, the HGSNAT gene mutation/mutation spectrum of MPSILC is not completely found at present, and the relation between genotype and phenotype is not completely clear yet; thus, the research on the MPSILC gene is still in progress.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention aims to determine the relevant new pathogenic mutation points of the MPSIWC pathogenic gene HGSNAT, and verify the enzyme activity defect of the HGSNAT and the influence on lysosome function caused by the mutation through bioinformatics and experimental means respectively, thereby confirming that the mutation points are harmful pathogenic mutation and providing guidance for the diagnosis and treatment related research of the MPSIWC.

For the above reasons, the present invention provides a nucleotide associated with MPSIWC, which has c.743G > A compared to the wild-type HGSNAT gene; in other words, or the nucleotide contains a missense mutation site c.743G > A in the 7 th exon of the mutant HGSNAT (NM-152419.3) compared to the wild-type HGSNAT gene.

Preferably, the nucleotide sequence differs from the wild-type HGSNAT nucleotide sequence at position 748, more particularly the mutation of nucleotide at position 743 from G to A.

Preferably, the nucleotide sequence is shown as SEQ ID NO. 7.

Preferably, the wild-type HGSNAT nucleotide sequence is shown in SEQ ID NO. 5.

As a preferred mode, the mutated HGSNAT nucleic acid sequence or the protein amino acid sequence according to the second aspect of the present invention is derived from a human or non-human mammal, preferably from a human.

In order to achieve the second object, the present invention provides a protein related to MPSILC, wherein the 248 th amino acid is glycine (Gly) to glutamic acid (Glu) compared with the wild-type HGSNAT protein.

Preferably, the amino acid sequence of the mutant protein is shown as SEQ ID NO. 11.

As a preferred embodiment, the mutated HGSNAT nucleotide sequence according to the first aspect of the present invention or the protein amino acid sequence according to the second aspect of the present invention is derived from a human or non-human mammal, preferably from a human.

In order to achieve the third object of the present invention, the present invention also provides the application of any one of the above-mentioned nucleotide or protein in preparing MPSILC detection reagent or detection device.

Preferably, the detection reagent is selected from: one or more of a primer or primer pair, a probe, an antibody, or a nucleic acid chip.

More preferably, the above primer or primer pair specifically amplifies an amplification product containing G at 743; preferably, the length of the amplified product is 100-1000bp.

More preferably, the probe described above can specifically bind to a nucleic acid fragment containing G at position 743.

More preferably, the antibody described above may specifically bind to a polypeptide comprising the 248 mutant glutamic acid.

More preferably, the reagent is a reagent for PCR detection of the 743 nucleotide site.

In order to achieve the fourth object of the present invention, the present invention provides a reagent for detecting MPSIWC, the reagent at least comprising a reagent for detecting nucleotide 743 of HGSNAT gene, the 7 th exon of the mutated HGSNAT gene (NM_ 152419.3) contains a missense mutation site c.743G > A, the 743 rd nucleotide of the mutated HGSNAT gene is mutated from G to A, and the other parts are the same as the wild type; or a reagent for detecting the 248 th amino acid site of HGSNAT protein.

Preferably, the reagent for detecting nucleotide 743 of HGSNAT gene is selected from the group consisting of: primer pairs, probes, nucleic acid chips.

Preferably, the reagent for detecting the 248 th amino acid site of HGSNAT protein is an antibody.

Preferably, in the primer pair sequence, the upstream primer is shown as SEQ ID NO. 1, the downstream primer is shown as a primer of SEQ ID NO. 2, and more preferably, the primer pair further comprises a second primer pair, the upstream primer is shown as SEQ ID NO. 3, and the downstream primer is shown as SEQ ID NO. 4.

As a fifth object of the present invention, there is provided a pathogenic mutant gene of MPSILC type, which is a mutant and wild type HGSNAT gene, and the 7 th exon of which contains a missense mutation site c.743G > A.

Preferably, the 743 nucleotide of the pathogenic mutation is mutated from G to A.

Preferably, the nucleotide sequence of the pathogenic mutation is shown in SEQ ID NO. 7.

Preferably, the 248 th amino acid of the protein of the pathogenic mutant gene is glutamic acid (Glu) from glycine (Gly).

Preferably, the amino acid sequence of the pathogenic mutant gene is shown in SEQ ID NO. 11.

Terminology

Exons: as used herein, the term "exon" refers to the portion that is retained in the mature messenger RNA (mRNA), i.e., the mature mRNA corresponds to the portion in the gene. Introns are portions that are sheared off during mRNA processing and are not present in the mature mRNA. Both exons and introns are for the gene, the encoded part being an exon and the non-encoded part being an intron.

Primer: as used herein, the term "primer" refers to the generic term for oligonucleotides that are capable of complementary pairing with a template, and that synthesize a DNA strand complementary to the template by the action of a DNA polymerase. The primer may be natural RNA, DNA, natural nucleotide in any form, or even non-natural nucleotide such as LNA or ZNA. The primer is "substantially" (or "essentially") complementary to a particular sequence on one strand of the template. The primer must be sufficiently complementary to one strand on the template to begin extension, but the sequence of the primer need not be perfectly complementary to the sequence of the template. For example, a primer that is complementary to the template at the 3 'end is added to the 5' end of a primer that is not complementary to the template, and such primer is still substantially complementary to the template. Primers that are not perfectly complementary may also form primer-template complexes with the template, so long as they are sufficiently long to bind to the template, thereby allowing amplification.

It will be appreciated by those skilled in the art that the information about the mutation site and the type of mutation has been clarified herein, and thus, nucleic acids suitable for use in the present application include, but are not limited to, genomic DNA (gDNA), mRNA, DNA complementary to mRNA (cDNA), and, at the same time, the nucleic acid sequence in the present application may be either or both of complementary double strands. Based on the complementarity of the nucleic acid sequences and the nucleic acid sequence information provided herein, one skilled in the art can arrive at one nucleic acid sequence that is complementary to another nucleic acid sequence if that other nucleic acid sequence is specified. The isolated nucleic acid may be obtained from a sample by extraction or purification, or may be obtained by artificial synthesis or artificial mutation, and is thus freely used in PID-related fields such as detection, treatment, drug development, and research. For example, one straightforward way of application is to obtain information on the presence or absence of a pathogenic mutation as provided herein in a sample by detecting the nucleic acid. It should be noted that specific information on the gDNA and cDNA sequences of the wild-type HGSNAT Gene can be obtained by searching for Gene ID 138050 and CCDS47852.1, respectively, on the NCBI website.

It should be noted that, regarding the method for detecting the pathogenic mutation in the sample to be detected, the method generally includes the following steps:

sample processing, detection and result judgment. The sample treatment refers to performing a related treatment on a sample to be detected, and the specific treatment mode is also referred to as a detection target according to an actually detected object, for example, if the detection target is a nucleic acid when the nucleic acid in the sample is detected, the sample is treated in such a way that the nucleic acid is extracted from the sample. The type of the sample itself is also selected according to the type of the detection target, for example, when the detection target is a nucleic acid, the sample includes, but is not limited to, blood, epithelial tissue, etc., and usually, the detection target is included in the relevant sample. The detection step is also dependent on the detection targets selected, and the specific mode of detection is different when the detection targets are different. For example, when the detection target is a nucleic acid, the sequence information of the sample nucleic acid may be determined by means of sequencing, and the particular method of sequencing is not limiting to the application, and a person skilled in the art may select an appropriate sequencing means based on the prompts of the application. In one embodiment of the present application, the detection of nucleic acids in a sample is performed by means of Sanger sequencing. Nucleic acid extracted from the sample was amplified by PCR using primers, and the amplified fragment was subjected to Sanger sequencing. The result judgment means that the detected result is compared with a certain standard to obtain a conclusion. The manner of result determination is also related to the selection of the detection target. In a specific embodiment of the present application, the sequencing result is compared with the standard sequence, if the nucleic acid sequence of the sample to be tested contains one of the two pathogenic mutations disclosed in the present application, the result is positive, otherwise the result is negative.

Compared with the prior art, the invention discovers a new pathogenic mutation in the pathogenic gene HGSNAT of the monogenic genetic disease MPSILC for the first time, the pathogenic mutation is also discovered for the first time in Chinese population, the detection reagent provided by the invention is also verified in a disease family, in addition, the invention also verifies the pathogenicity of the mutation through experiments, and the corresponding pathogenic mechanism is discussed. The pathogenic mutation expands MPSIWC pathogenic gene mutation spectrum, provides new data for developing gene diagnosis, and provides new molecular biology foundation for diagnosis of the disease. The discovery of the new pathogenic mutation site can conduct prenatal and postnatal care guidance on the offspring of the family, and can be used as a carrier screening for gene diagnosis and prenatal diagnosis screening site in the crowd range, thereby helping to understand pathogenesis, assisting clinical diagnosis, prenatal diagnosis and transgene therapy and providing a new research direction for preventing and treating mucopolysaccharidoses in China.

Drawings

FIG. 1 is a photograph of a prior person;

FIG. 2 is a schematic diagram of MPSIWC family in one embodiment;

FIG. 3 shows the results of Sanger sequencing of the precursor and parent genotypes in the examples;

FIG. 4 is a diagram showing the result of a conservative analysis of pathogenic mutation in examples;

FIG. 5 is a PUC57-HGSNAT:: MYC:: FLAG cloning vector;

FIG. 6 shows pCSC-IRES-GFP expression vector;

FIG. 7 is a pCSC-HGSNAT-WT:: MYC:: FLAG expression vector;

FIG. 8 is a pCSC-HGSNAT-R344C:: MYC:: FLAG expression vector;

FIG. 9 is a pCSC-HGSNAT-G248E:: MYC:: FLAG expression vector;

FIG. 10 is a pCSC-HGSNAT-P237Q:: MYC:: FLAG expression vector;

FIG. 11 is a graph showing the results of protein expression detection by SDS-PAGE after cell lysis by overexpressing the wild-type (WT) and the full-length HGSNAT::: MYC:: FLAG plasmid, R344C, G248E, P237Q, respectively, in 293T cells;

FIG. 12 is a graph of the activity of HGSNAT enzyme and control NAGase enzyme, respectively, after cell lysis, for the overexpression of the wild-type (WT), full-length HGSNAT::: MYC:: FLAG plasmid, respectively, R344C, G E in 293T cells;

FIG. 13 is a pLAMP1-mCherry reporter vector;

FIG. 14 is a graph of the results of the detection of HGSNAT localization in lysosomes using immunofluorescence for the full length HGSNAT::: MYC::: FLAG plasmid, and lysosomal localized reporter plasmid pLAMP1-mCherry, over-expressing Wild Type (WT), R344C, G248E, P237Q, respectively, in 293T cells.

Detailed Description

The method for producing the monoclonal antibody of the present invention and its application are described in further detail and fully below with reference to examples. The following examples are illustrative only and are not to be construed as limiting the invention.

The experimental methods in the examples described below, unless otherwise specified, are generally according to conventional conditions such as those described in J.Sam Brooks et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations. Unless otherwise specified, all reagents involved in the examples of the present invention are commercially available products and are commercially available.

The main biological materials related to the embodiment of the invention are as follows:

DMEM complete medium: DMEM,10% Fetal Bovine Serum (FBS) and 1% green streptomycin cocktail

Green streptomycin mixture (Solarbio, beijing, china, #P1400)

4％ PFA(Servicebio,Wuhan,China,#G1101)

Triton X-100(Solarbio,#T8200)

Tween-20(Macklin,Rochelle,IL,USA,#C10232628)

Bovine serum albumin(BSA,BioFroxx,Guangzhou,China,#4240)

Hoechst 33342(Beyotime,Shanghai,China,#C1025)

Poly(vinyl alcohol)(PVA,Macklin,#P816862)

Sealing liquid: 3% BSA,2% Triton X-100, DPBS

TBS (10X) Tris-base 48.4g and NaCl 160g dissolved in 0.8L water, and pH adjusted to 7.6 with concentrated hydrochloric acid

LB liquid medium: peptone 10g, yeast extract 5g, naCl 10g (constant volume to 1L, high pressure steam sterilization, preservation at 4 ℃)

TAE buffer (10X): tris-base 24.2g, EDTA 5.71g, glacial acetic acid 5.71ml (constant volume to 1L)

McIlvain buffer (pH 5.5, source leaf organism, #R20258)

Glycine buffer (0.4M): 1.5g glycine was dissolved in 50ml water and the pH was adjusted to 10.4 with 1N NaOH

4-methylumbelliferone-beta-D-galactoside (MU-beta GlcNH) ₂ ,Biosynth,#EM31025)

4-Methylproteophenol Acetyl-beta-D-glucosamine (MU-beta GlcNAc, biosynth, # M5504)

4-methyl umbrella ketone (4-MU, sigma, #M1381)

acetyl-CoA (Sigma, #A2056)

The types and sources of enzymes and reagents used for molecular cloning are shown in Table 1

TABLE 1 enzymes and reagents for molecular cloning

Experimental materials	Goods number	Source
			Gel-Green nucleic acid dye	#SCT125	Merck
AgeI-HF	#R3552	NEB
			BsrG1-HF	#R3575	NEB
DpnI	#R0176	NEB
			PrimeSTAR HS DNA polymerase	#R010A	TAKARA
T4 ligase	#EL0011	Thermo

The types and sources of primary and secondary antibodies used for immunofluorescent staining and SDS-PAGE are shown in Table 2.

TABLE 2 primary and secondary antibodies for immunofluorescent staining and SDS-PAGE

Example identification and verification of mutation sites of pathogenic Gene

1. Screening of mutation sites of pathogenic genes

1. Study population

Study cohort: a3 rd generation MPSILC family is selected, and a first person II6, a female, 15 years old, clinically develop the investigation of the cause of the pain of the double hips and the investigation of the cause of the mental retardation. The first-evidence person has discomfort of double hip pain 5 years ago, and can not walk when serious. X-ray examination shows that the bilateral femoral head is flattened, the bilateral hip joint surface is subjected to multiple cystic low density change, the bilateral sacroiliac joint surface bone density is increased, meanwhile, the physiological curvature of the spine exists, the vertebral body sequence is slightly discontinuous, the lower edges of the T10 and T11 vertebral bodies are formed by Xu Moshi nodules, the corresponding vertebral bodies are slightly flattened (the image picture is shown in figure 1, wherein A, the X-ray examination of a forerunner shows that the bilateral femoral head is flattened, the bilateral hip joint surface is subjected to multiple cystic low density change, and the bilateral sacroiliac joint surface bone density is increased, B, the X-ray examination of the forerunner shows that the physiological curvature of the spine exists, the vertebral body sequence is slightly discontinuous, the lower edges of the T10 and T11 vertebral bodies are formed by Xu Moshi nodules, and the corresponding vertebral bodies are slightly flattened). In addition, the first person is at present at the level of 6 in primary school, has poor performance, cannot read himself on a plain day, and prompts that serious intellectual defect exists. The parents have normal phenotype and are not close to wedding; the first-evidence person has a sister, the phenotype is normal, two children are normal, and the mother of the first-evidence person complains and three children are all the same. Family chart see fig. 2, wherein black arrows show forerunner; black symbols represent the affected state; the diagonal lines indicate that the time has passed. According to the principle of informed consent, on the premise that the forensics and family members thereof sign the informed consent voluntarily, 5-10mL peripheral blood samples are sent, a medical record database is established, and data such as illness state and family conditions of the forensics are recorded in detail. The study was approved by the ethics committee of this unit.

2. Research method

2.1 exome sequencing of the precursor

Genomic gDNA is extracted from a subject sample to construct a genomic library. Exons of the target gene (about 20,000) and adjacent splicing regions (about 20 bp) were captured by probe hybridization and enriched. And (3) performing quality control on the enriched genes, and sequencing by using an Illumina high-throughput sequencer. The capture sequencing parameters of the target region of the sample to be tested are shown in Table 3:

TABLE 3 sample target region Capture sequencing parameters

Sample numbering	Raw data volume (G)	Average sequencing depth	Coverage of not less than 10X	Q30(％)
					07W210909GDT6075801B01	13.92	182.14	99.71	91.87

2.2 analysis

Sequencing original data firstly removes reads which do not meet quality control requirements, then compares the reads with hg19 version human genome reference sequences provided by UCSC by using BWA software, finds SNV and InDel variations in the sequences by using a GATK's biplotypeCaller, and carries out further annotation and screening by using the following professional database and belief prediction software and Wei Hansi own local database and analysis software. Copy number variation analysis was performed on the probe coverage area using the xhmm and clamms algorithms.

Crowd variant frequency database: 1000Genomes, ESP, exAC, gnomAD, etc.;

site and disease database: dbSNP, OMIM, HGMD, clinVar, decipher, DGV, etc.;

and (5) generating a letter prediction software: SIFT, polyphen2, LRT, mutationTaster, FATHMM, M-CAP, CADD, REVEL, dbscSNV, etc.

2.3 interpretation:

the sequence variation data interpretation rules refer to the classification standards and guidelines of genetic variation of the american society of medical genetics and genomics (American College of Medical Genetics and Genomics, ACMG), and the sequence variation interpretation guidelines (guideline-derived ClinGen official network) issued by the ClinGen sequence variation interpretation working group, the expert group for deafness, cardiomyopathy, phenylketonuria, and the like. Copy Number Variation (CNV) interpretation rules refer to ACMG copy number variation interpretation and reporting guidelines version 2019.

2.4 interpretation of variation

2 heterozygous variations were detected on the pre-protector hgsnap gene, missense variation 1: 1030C > T (p.Arg 344Cys), missense variation 2: 743G > A (p.Gly248 Glu). Variation 1 resulted in the variation of amino acid 344 from arginine to cysteine, variation 2 resulted in the variation of amino acid 248 from glycine to glutamic acid (see figure 3 for details showing that variation 1: c.1030c > t (p.arg 344cys) was from the father, variation 2: c.743g > a (p.gly248 glu) was from the mother, the first being a compound heterozygous mutation). By performing bioinformatics analysis, copy number variation analysis, and comprehensive analysis in combination with clinical phenotypes on the forerunner's second generation sequencing data, known/likely clinically significant CNVs associated with the forerunner's detection purpose were not found.

There are several documents reporting that a variation 1 is detected in a number of MPSIIIC patients, which is recorded in the HGMD database (CM 065262), 1 record in the ClinVar database showing that the variation is likely to be pathogenic and 4 records showing that the variation is pathogenic. Variation 2 was not reported in literature, and variation 1 was a pathogenic variation and variation 2 was a clinically unknown variation, with reference to ACMG related guidelines. Analysis of variant pathogenicity using confidence prediction software such as SIFT, polyphen2, mutationTaster, CADD, all showed that variant 2 is likely to be a pathogenic variant; in addition, hgsnap p.p237q was mutated to a reported gene polymorphism, and was used as a control without affecting hgsnap enzyme activity. The results of the In silico analysis are shown In Table 4:

TABLE 4 in silico predicts pathogenicity of HGSNAT mutations

In addition, a conservative analysis is carried out on the mutation site, specifically, analysis is carried out on the vertebrate amino acid sequence by using Weblogo software, and analysis results show that the R344 site and the G248 site are highly conserved (see FIG. 4 for details), which shows the importance of the two sites in the composition and the function of HGSNAT protein.

2. Identification of mutation sites of pathogenic genes

The detection kit provided by the invention is used for identifying pathogenic mutation of the same prover family member.

The embodiment also discloses a reagent for detecting pathogenic mutation, which comprises the following two primer pairs for amplification.

A first primer set that detects a mutation in the hgsnap gene, p.g248e:

an upstream primer: ex7-F CTGAAGGAGCTGGGATCTCCC (SEQ ID NO: 1)

A downstream primer: ex7-R AGTGGACACTGGCTCTGGCCT (SEQ ID NO: 2)

A second primer pair, which detects the mutation p.r344c on the HGSNAT gene:

an upstream primer: ex11-F GCCATGTCCCTGACTGACCCT (SEQ ID NO: 3)

A downstream primer: EX11-R CTGGGCAACACAGCAAGACCC (SEQ ID NO: 4)

The specific detection steps of the detection reagent are also disclosed:

1) Sample treatment: peripheral blood of the first person and their families (four people in total) was collected, and gDNA was extracted after erythrocyte lysis.

2) And (3) detection: PCR separation was usedAmplifying 2 mutation site peripheral regions, and cutting gel and sending to Sanger for sequencing after TAE nucleic acid gel is run; wherein the amplification-related steps are as follows: 150ng of gDNA to be tested was added to 50. Mu.L of a reaction system consisting of 5x PrimeSTAR Buffer (Mg ²⁺ plus) 10. Mu.L, dNTP (2.5. Mu.M) 4. Mu.L, forward and reverse primers (10. Mu.M) 1.25. Mu.L each, primeSTAR HS DNA polymerase (2.5 units/. Mu.L) 0.5. Mu.L, betaine (4M) 12.5. Mu.L, and water make up a total volume of 50. Mu.L. The PCR reaction procedure was: the pre-denaturation stage was 94℃for 60 seconds; denaturation phase 98 ℃,10 seconds; the annealing stage is 56 ℃ for 15 seconds; extension stage 72 ℃,1min/1kb; cooling to 4 ℃ for 10min; denaturation, annealing and extension are carried out for 35 times in three stages, thus completing the amplification.

The resulting PCR product was run against TAE gel and then cut to give Sanger sequencing (Peking's Prime sequencing Co.).

After sequencing, the hgsnap nucleotide sequence was as follows:

wild type HGSNAT CDS nucleotide sequence:

ATGAGCGGGGCGGGCAGGGCGCTGGCCGCGCTGCTGCTGGCCGCGTCCGTGCTGAGCGCCGCGCTGCTGGCCCCCGGCGGCTCTTCGGGGCGCGATGCCCAGGCCGCGCCGCCACGAGACTTAGACAAAAAAAGACATGCAGAGCTGAAGATGGATCAGGCTTTGCTACTCATCCATAATGAACTTCTCTGGACCAACTTGACCGTCTACTGGAAATCTGAATGCTGTTATCACTGCTTGTTTCAGGTTCTGGTAAACGTTCCTCAGAGTCCAAAAGCAGGGAAGCCTAGTGCTGCAGCTGCCTCTGTCAGCACCCAGCACGGATCTATCCTGCAGCTGAACGACACCTTGGAAGAGAAAGAAGTTTGTAGGTTGGAATACAGATTTGGAGAATTTGGAAACTATTCTCTCTTGGTAAAGAACATCCATAATGGAGTTAGTGAAATTGCCTGTGACCTGGCTGTGAACGAGGATCCAGTTGATAGTAACCTTCCTGTGAGCATTGCATTCCTTATTGGTCTTGCTGTCATCATTGTGATATCCTTTCTGAGGCTCTTGTTGAGTTTGGATGACTTTAACAATTGGATTTCTAAAGCCATAAGTTCTCGAGAAACTGATCGCCTCATCAATTCTGAGCTGGGATCTCCCAGCAGGACAGACCCTCTCGATGGTGATGTTCAGCCAGCAACGTGGCGTCTATCTGCCCTGCCGCCCCGCCTCCGCAGCGTGGACACCTTCAGGGGGATTGCTCTTATACTCATGGTCTTTGTCAATTATGGAGGAGGAAAATATTGGTACTTCAAACATGCAAGTTGGAATGGGCTGACAGTGGCTGACCTCGTGTTCCCGTGGTTTGTATTTATTATGGGATCTTCCATTTTTCTATCGATGACTTCTATACTGCAACGGGGGTGTTCAAAATTCAGATTGCTGGGGAAGATTGCATGGAGGAGTTTCCTGTTAATCTGCATAGGAATTATCATTGTGAATCCCAATTATTGCCTTGGTCCATTGTCTTGGGACAAGGTGCGCATTCCTGGTGTGCTGCAGCGATTGGGAGTGACATACTTTGTGGTTGCTGTGTTGGAGCTCCTCTTTGCTAAACCTGTGCCTGAACATTGTGCCTCGGAGAGGAGCTGCCTTTCTCTTCGAGACATCACGTCCAGCTGGCCCCAGTGGCTGCTCATCCTGGTGCTGGAAGGCCTGTGGCTGGGCTTGACATTCCTCCTGCCAGTCCCTGGGTGCCCTACTGGTTATCTTGGTCCTGGGGGCATTGGAGATTTTGGCAAGTATCCAAATTGCACTGGAGGAGCTGCAGGCTACATCGACCGCCTGCTGCTGGGAGACGATCACCTTTACCAGCACCCATCTTCTGCTGTACTTTACCACACCGAGGTGGCCTATGACCCCGAGGGCATCCTGGGCACCATCAACTCCATCGTGATGGCCTTTTTAGGAGTTCAGGCAGGAAAAATACTATTGTATTACAAGGCTCGGACCAAAGACATCCTGATTCGATTCACTGCTTGGTGTTGTATTCTTGGGCTCATTTCTGTTGCTCTGACGAAGGTTTCTGAAAATGAAGGCTTTATTCCAGTAAACAAAAATCTCTGGTCCCTTTCGTATGTCACTACGCTCAGTTCTTTTGCCTTCTTCATCCTGCTGGTCCTGTACCCAGTTGTGGATGTGAAGGGGCTGTGGACAGGAACCCCATTCTTTTATCCAGGAATGAATTCCATTCTGGTATATGTCGGCCACGAGGTGTTTGAGAACTACTTCCCCTTTCAGTGGAAGCTGAAGGACAACCAGTCCCACAAGGAGCACCTGACTCAGAACATCGTCGCCACTGCCCTCTGGGTGCTCATTGCCTACATCCTCTATAGAAAGAAGATTTTTTGGAAAATCTGA(SEQ ID NO:5)

mutation 1 hgsnap-R344C CDS nucleotide sequence:

ATGAGCGGGGCGGGCAGGGCGCTGGCCGCGCTGCTGCTGGCCGCGTCCGTGCTGAGCGCCGCGCTGCTGGCCCCCGGCGGCTCTTCGGGGCGCGATGCCCAGGCCGCGCCGCCACGAGACTTAGACAAAAAAAGACATGCAGAGCTGAAGATGGATCAGGCTTTGCTACTCATCCATAATGAACTTCTCTGGACCAACTTGACCGTCTACTGGAAATCTGAATGCTGTTATCACTGCTTGTTTCAGGTTCTGGTAAACGTTCCTCAGAGTCCAAAAGCAGGGAAGCCTAGTGCTGCAGCTGCCTCTGTCAGCACCCAGCACGGATCTATCCTGCAGCTGAACGACACCTTGGAAGAGAAAGAAGTTTGTAGGTTGGAATACAGATTTGGAGAATTTGGAAACTATTCTCTCTTGGTAAAGAACATCCATAATGGAGTTAGTGAAATTGCCTGTGACCTGGCTGTGAACGAGGATCCAGTTGATAGTAACCTTCCTGTGAGCATTGCATTCCTTATTGGTCTTGCTGTCATCATTGTGATATCCTTTCTGAGGCTCTTGTTGAGTTTGGATGACTTTAACAATTGGATTTCTAAAGCCATAAGTTCTCGAGAAACTGATCGCCTCATCAATTCTGAGCTGGGATCTCCCAGCAGGACAGACCCTCTCGATGGTGATGTTCAGCCAGCAACGTGGCGTCTATCTGCCCTGCCGCCCCGCCTCCGCAGCGTGGACACCTTCAGGGGGATTGCTCTTATACTCATGGTCTTTGTCAATTATGGAGGAGGAAAATATTGGTACTTCAAACATGCAAGTTGGAATGGGCTGACAGTGGCTGACCTCGTGTTCCCGTGGTTTGTATTTATTATGGGATCTTCCATTTTTCTATCGATGACTTCTATACTGCAACGGGGGTGTTCAAAATTCAGATTGCTGGGGAAGATTGCATGGAGGAGTTTCCTGTTAATCTGCATAGGAATTATCATTGTGAATCCCAATTATTGCCTTGGTCCATTGTCTTGGGACAAGGTGTGCATTCCTGGTGTGCTGCAGCGATTGGGAGTGACATACTTTGTGGTTGCTGTGTTGGAGCTCCTCTTTGCTAAACCTGTGCCTGAACATTGTGCCTCGGAGAGGAGCTGCCTTTCTCTTCGAGACATCACGTCCAGCTGGCCCCAGTGGCTGCTCATCCTGGTGCTGGAAGGCCTGTGGCTGGGCTTGACATTCCTCCTGCCAGTCCCTGGGTGCCCTACTGGTTATCTTGGTCCTGGGGGCATTGGAGATTTTGGCAAGTATCCAAATTGCACTGGAGGAGCTGCAGGCTACATCGACCGCCTGCTGCTGGGAGACGATCACCTTTACCAGCACCCATCTTCTGCTGTACTTTACCACACCGAGGTGGCCTATGACCCCGAGGGCATCCTGGGCACCATCAACTCCATCGTGATGGCCTTTTTAGGAGTTCAGGCAGGAAAAATACTATTGTATTACAAGGCTCGGACCAAAGACATCCTGATTCGATTCACTGCTTGGTGTTGTATTCTTGGGCTCATTTCTGTTGCTCTGACGAAGGTTTCTGAAAATGAAGGCTTTATTCCAGTAAACAAAAATCTCTGGTCCCTTTCGTATGTCACTACGCTCAGTTCTTTTGCCTTCTTCATCCTGCTGGTCCTGTACCCAGTTGTGGATGTGAAGGGGCTGTGGACAGGAACCCCATTCTTTTATCCAGGAATGAATTCCATTCTGGTATATGTCGGCCACGAGGTGTTTGAGAACTACTTCCCCTTTCAGTGGAAGCTGAAGGACAACCAGTCCCACAAGGAGCACCTGACTCAGAACATCGTCGCCACTGCCCTCTGGGTGCTCATTGCCTACATCCTCTATAGAAAGAAGATTTTTTGGAAAATCTGA(SEQ ID NO:6)

mutation 2 hgsnap-G248E CDS nucleotide sequence:

ATGAGCGGGGCGGGCAGGGCGCTGGCCGCGCTGCTGCTGGCCGCGTCCGTGCTGAGCGCCGCGCTGCTGGCCCCCGGCGGCTCTTCGGGGCGCGATGCCCAGGCCGCGCCGCCACGAGACTTAGACAAAAAAAGACATGCAGAGCTGAAGATGGATCAGGCTTTGCTACTCATCCATAATGAACTTCTCTGGACCAACTTGACCGTCTACTGGAAATCTGAATGCTGTTATCACTGCTTGTTTCAGGTTCTGGTAAACGTTCCTCAGAGTCCAAAAGCAGGGAAGCCTAGTGCTGCAGCTGCCTCTGTCAGCACCCAGCACGGATCTATCCTGCAGCTGAACGACACCTTGGAAGAGAAAGAAGTTTGTAGGTTGGAATACAGATTTGGAGAATTTGGAAACTATTCTCTCTTGGTAAAGAACATCCATAATGGAGTTAGTGAAATTGCCTGTGACCTGGCTGTGAACGAGGATCCAGTTGATAGTAACCTTCCTGTGAGCATTGCATTCCTTATTGGTCTTGCTGTCATCATTGTGATATCCTTTCTGAGGCTCTTGTTGAGTTTGGATGACTTTAACAATTGGATTTCTAAAGCCATAAGTTCTCGAGAAACTGATCGCCTCATCAATTCTGAGCTGGGATCTCCCAGCAGGACAGACCCTCTCGATGGTGATGTTCAGCCAGCAACGTGGCGTCTATCTGCCCTGCCGCCCCGCCTCCGCAGCGTGGACACCTTCAGGGAGATTGCTCTTATACTCATGGTCTTTGTCAATTATGGAGGAGGAAAATATTGGTACTTCAAACATGCAAGTTGGAATGGGCTGACAGTGGCTGACCTCGTGTTCCCGTGGTTTGTATTTATTATGGGATCTTCCATTTTTCTATCGATGACTTCTATACTGCAACGGGGGTGTTCAAAATTCAGATTGCTGGGGAAGATTGCATGGAGGAGTTTCCTGTTAATCTGCATAGGAATTATCATTGTGAATCCCAATTATTGCCTTGGTCCATTGTCTTGGGACAAGGTGCGCATTCCTGGTGTGCTGCAGCGATTGGGAGTGACATACTTTGTGGTTGCTGTGTTGGAGCTCCTCTTTGCTAAACCTGTGCCTGAACATTGTGCCTCGGAGAGGAGCTGCCTTTCTCTTCGAGACATCACGTCCAGCTGGCCCCAGTGGCTGCTCATCCTGGTGCTGGAAGGCCTGTGGCTGGGCTTGACATTCCTCCTGCCAGTCCCTGGGTGCCCTACTGGTTATCTTGGTCCTGGGGGCATTGGAGATTTTGGCAAGTATCCAAATTGCACTGGAGGAGCTGCAGGCTACATCGACCGCCTGCTGCTGGGAGACGATCACCTTTACCAGCACCCATCTTCTGCTGTACTTTACCACACCGAGGTGGCCTATGACCCCGAGGGCATCCTGGGCACCATCAACTCCATCGTGATGGCCTTTTTAGGAGTTCAGGCAGGAAAAATACTATTGTATTACAAGGCTCGGACCAAAGACATCCTGATTCGATTCACTGCTTGGTGTTGTATTCTTGGGCTCATTTCTGTTGCTCTGACGAAGGTTTCTGAAAATGAAGGCTTTATTCCAGTAAACAAAAATCTCTGGTCCCTTTCGTATGTCACTACGCTCAGTTCTTTTGCCTTCTTCATCCTGCTGGTCCTGTACCCAGTTGTGGATGTGAAGGGGCTGTGGACAGGAACCCCATTCTTTTATCCAGGAATGAATTCCATTCTGGTATATGTCGGCCACGAGGTGTTTGAGAACTACTTCCCCTTTCAGTGGAAGCTGAAGGACAACCAGTCCCACAAGGAGCACCTGACTCAGAACATCGTCGCCACTGCCCTCTGGGTGCTCATTGCCTACATCCTCTATAGAAAGAAGATTTTTTGGAAAATCTGA(SEQ ID NO:7)

in addition, to verify the pathogenicity of the two mutations, the reported polymorphic mutation point was used as a control, and the gene polymorphic mutation HGSNAT-P237Q CDS nucleotide sequence:

ATGAGCGGGGCGGGCAGGGCGCTGGCCGCGCTGCTGCTGGCCGCGTCCGTGCTGAGCGCCGCGCTGCTGGCCCCCGGCGGCTCTTCGGGGCGCGATGCCCAGGCCGCGCCGCCACGAGACTTAGACAAAAAAAGACATGCAGAGCTGAAGATGGATCAGGCTTTGCTACTCATCCATAATGAACTTCTCTGGACCAACTTGACCGTCTACTGGAAATCTGAATGCTGTTATCACTGCTTGTTTCAGGTTCTGGTAAACGTTCCTCAGAGTCCAAAAGCAGGGAAGCCTAGTGCTGCAGCTGCCTCTGTCAGCACCCAGCACGGATCTATCCTGCAGCTGAACGACACCTTGGAAGAGAAAGAAGTTTGTAGGTTGGAATACAGATTTGGAGAATTTGGAAACTATTCTCTCTTGGTAAAGAACATCCATAATGGAGTTAGTGAAATTGCCTGTGACCTGGCTGTGAACGAGGATCCAGTTGATAGTAACCTTCCTGTGAGCATTGCATTCCTTATTGGTCTTGCTGTCATCATTGTGATATCCTTTCTGAGGCTCTTGTTGAGTTTGGATGACTTTAACAATTGGATTTCTAAAGCCATAAGTTCTCGAGAAACTGATCGCCTCATCAATTCTGAGCTGGGATCTCCCAGCAGGACAGACCCTCTCGATGGTGATGTTCAGCCAGCAACGTGGCGTCTATCTGCCCTGCAGCCCCGCCTCCGCAGCGTGGACACCTTCAGGGGGATTGCTCTTATACTCATGGTCTTTGTCAATTATGGAGGAGGAAAATATTGGTACTTCAAACATGCAAGTTGGAATGGGCTGACAGTGGCTGACCTCGTGTTCCCGTGGTTTGTATTTATTATGGGATCTTCCATTTTTCTATCGATGACTTCTATACTGCAACGGGGGTGTTCAAAATTCAGATTGCTGGGGAAGATTGCATGGAGGAGTTTCCTGTTAATCTGCATAGGAATTATCATTGTGAATCCCAATTATTGCCTTGGTCCATTGTCTTGGGACAAGGTGCGCATTCCTGGTGTGCTGCAGCGATTGGGAGTGACATACTTTGTGGTTGCTGTGTTGGAGCTCCTCTTTGCTAAACCTGTGCCTGAACATTGTGCCTCGGAGAGGAGCTGCCTTTCTCTTCGAGACATCACGTCCAGCTGGCCCCAGTGGCTGCTCATCCTGGTGCTGGAAGGCCTGTGGCTGGGCTTGACATTCCTCCTGCCAGTCCCTGGGTGCCCTACTGGTTATCTTGGTCCTGGGGGCATTGGAGATTTTGGCAAGTATCCAAATTGCACTGGAGGAGCTGCAGGCTACATCGACCGCCTGCTGCTGGGAGACGATCACCTTTACCAGCACCCATCTTCTGCTGTACTTTACCACACCGAGGTGGCCTATGACCCCGAGGGCATCCTGGGCACCATCAACTCCATCGTGATGGCCTTTTTAGGAGTTCAGGCAGGAAAAATACTATTGTATTACAAGGCTCGGACCAAAGACATCCTGATTCGATTCACTGCTTGGTGTTGTATTCTTGGGCTCATTTCTGTTGCTCTGACGAAGGTTTCTGAAAATGAAGGCTTTATTCCAGTAAACAAAAATCTCTGGTCCCTTTCGTATGTCACTACGCTCAGTTCTTTTGCCTTCTTCATCCTGCTGGTCCTGTACCCAGTTGTGGATGTGAAGGGGCTGTGGACAGGAACCCCATTCTTTTATCCAGGAATGAATTCCATTCTGGTATATGTCGGCCACGAGGTGTTTGAGAACTACTTCCCCTTTCAGTGGAAGCTGAAGGACAACCAGTCCCACAAGGAGCACCTGACTCAGAACATCGTCGCCACTGCCCTCTGGGTGCTCATTGCCTACATCCTCTATAGAAAGAAGATTTTTTGGAAAATCTGA(SEQ ID NO:8)

wherein the nucleotide sequencing result shows that the 1030 th nucleotide of the HGSNAT nucleotide sequence of the mutation 1 is mutated from C to T, and the 743 rd nucleotide of the HGSNAT nucleotide sequence of the mutation 2 is mutated from G to A.

Correspondingly, the amino acid sequence of the HGSNAT protein is as follows:

wild-type hgsnap protein amino acid sequence:

MSGAGRALAALLLAASVLSAALLAPGGSSGRDAQAAPPRDLDKKRHAELKMDQALLLIHNELLWTNLTVYWKSECCYHCLFQVLVNVPQSPKAGKPSAAAASVSTQHGSILQLNDTLEEKEVCRLEYRFGEFGNYSLLVKNIHNGVSEIACDLAVNEDPVDSNLPVSIAFLIGLAVIIVISFLRLLLSLDDFNNWISKAISSRETDRLINSELGSPSRTDPLDGDVQPATWRLSALPPRLRSVDTFRGIALILMVFVNYGGGKYWYFKHASWNGLTVADLVFPWFVFIMGSSIFLSMTSILQRGCSKFRLLGKIAWRSFLLICIGIIIVNPNYCLGPLSWDKVRIPGVLQRLGVTYFVVAVLELLFAKPVPEHCASERSCLSLRDITSSWPQWLLILVLEGLWLGLTFLLPVPGCPTGYLGPGGIGDFGKYPNCTGGAAGYIDRLLLGDDHLYQHPSSAVLYHTEVAYDPEGILGTINSIVMAFLGVQAGKILLYYKARTKDILIRFTAWCCILGLISVALTKVSENEGFIPVNKNLWSLSYVTTLSSFAFFILLVLYPVVDVKGLWTGTPFFYPGMNSILVYVGHEVFENYFPFQWKLKDNQSHKEHLTQNIVATALWVLIAYILYRKKIFWKI*(SEQ ID NO:9)

mutation 1 hgsnap-R344C protein amino acid sequence:

MSGAGRALAALLLAASVLSAALLAPGGSSGRDAQAAPPRDLDKKRHAELKMDQALLLIHNELLWTNLTVYWKSECCYHCLFQVLVNVPQSPKAGKPSAAAASVSTQHGSILQLNDTLEEKEVCRLEYRFGEFGNYSLLVKNIHNGVSEIACDLAVNEDPVDSNLPVSIAFLIGLAVIIVISFLRLLLSLDDFNNWISKAISSRETDRLINSELGSPSRTDPLDGDVQPATWRLSALPPRLRSVDTFRGIALILMVFVNYGGGKYWYFKHASWNGLTVADLVFPWFVFIMGSSIFLSMTSILQRGCSKFRLLGKIAWRSFLLICIGIIIVNPNYCLGPLSWDKVCIPGVLQRLGVTYFVVAVLELLFAKPVPEHCASERSCLSLRDITSSWPQWLLILVLEGLWLGLTFLLPVPGCPTGYLGPGGIGDFGKYPNCTGGAAGYIDRLLLGDDHLYQHPSSAVLYHTEVAYDPEGILGTINSIVMAFLGVQAGKILLYYKARTKDILIRFTAWCCILGLISVALTKVSENEGFIPVNKNLWSLSYVTTLSSFAFFILLVLYPVVDVKGLWTGTPFFYPGMNSILVYVGHEVFENYFPFQWKLKDNQSHKEHLTQNIVATALWVLIAYILYRKKIFWKI*(SEQ ID NO:10)

mutation 2 hgsnap-G248E protein amino acid sequence:

MSGAGRALAALLLAASVLSAALLAPGGSSGRDAQAAPPRDLDKKRHAELKMDQALLLIHNELLWTNLTVYWKSECCYHCLFQVLVNVPQSPKAGKPSAAAASVSTQHGSILQLNDTLEEKEVCRLEYRFGEFGNYSLLVKNIHNGVSEIACDLAVNEDPVDSNLPVSIAFLIGLAVIIVISFLRLLLSLDDFNNWISKAISSRETDRLINSELGSPSRTDPLDGDVQPATWRLSALPPRLRSVDTFREIALILMVFVNYGGGKYWYFKHASWNGLTVADLVFPWFVFIMGSSIFLSMTSILQRGCSKFRLLGKIAWRSFLLICIGIIIVNPNYCLGPLSWDKVRIPGVLQRLGVTYFVVAVLELLFAKPVPEHCASERSCLSLRDITSSWPQWLLILVLEGLWLGLTFLLPVPGCPTGYLGPGGIGDFGKYPNCTGGAAGYIDRLLLGDDHLYQHPSSAVLYHTEVAYDPEGILGTINSIVMAFLGVQAGKILLYYKARTKDILIRFTAWCCILGLISVALTKVSENEGFIPVNKNLWSLSYVTTLSSFAFFILLVLYPVVDVKGLWTGTPFFYPGMNSILVYVGHEVFENYFPFQWKLKDNQSHKEHLTQNIVATALWVLIAYILYRKKIFWKI*(SEQ ID NO:11)

gene polymorphism hgsnap-P237Q protein amino acid sequence:

MSGAGRALAALLLAASVLSAALLAPGGSSGRDAQAAPPRDLDKKRHAELKMDQALLLIHNELLWTNLTVYWKSECCYHCLFQVLVNVPQSPKAGKPSAAAASVSTQHGSILQLNDTLEEKEVCRLEYRFGEFGNYSLLVKNIHNGVSEIACDLAVNEDPVDSNLPVSIAFLIGLAVIIVISFLRLLLSLDDFNNWISKAISSRETDRLINSELGSPSRTDPLDGDVQPATWRLSALQPRLRSVDTFRGIALILMVFVNYGGGKYWYFKHASWNGLTVADLVFPWFVFIMGSSIFLSMTSILQRGCSKFRLLGKIAWRSFLLICIGIIIVNPNYCLGPLSWDKVRIPGVLQRLGVTYFVVAVLELLFAKPVPEHCASERSCLSLRDITSSWPQWLLILVLEGLWLGLTFLLPVPGCPTGYLGPGGIGDFGKYPNCTGGAAGYIDRLLLGDDHLYQHPSSAVLYHTEVAYDPEGILGTINSIVMAFLGVQAGKILLYYKARTKDILIRFTAWCCILGLISVALTKVSENEGFIPVNKNLWSLSYVTTLSSFAFFILLVLYPVVDVKGLWTGTPFFYPGMNSILVYVGHEVFENYFPFQWKLKDNQSHKEHLTQNIVATALWVLIAYILYRKKIFWKI*(SEQ ID NO:12)

the amino acid sequence result of the protein shows that arginine (Arg) at 344 th site of HGSNAT protein of mutation 1 is mutated into cysteine (Cys), and amino acid at 248 th site of HGSNAT protein of mutation 2 is mutated from glycine (Gly) to glutamic acid (Glu).

The results of the prior art family sequencing are consistent with those of FIG. 3, wherein the results of the detection of two mutations in the panel genes of the four members of the family are shown in Table 5:

TABLE 5 mutation detection results

A subject	Mutation 1-R344C	Mutation 2-G248E	Clinical symptoms
				Father and father	Positive and negative	Negative of	Health care
Mother's mother	Negative of	Positive and negative	Health care
				Sister (sister)	Negative of	Positive and negative	Health care
First-evidence person	Positive and negative	Positive and negative	Pathogenicity is caused by

As can be seen from Table 5, the first evidence was pathogenic due to carrying two pathogenic mutations at the same time, which is consistent with the characteristic that MPSILC is recessive inheritance. Further, sanger sequencing of a single mutation site was performed on this patient and 200 healthy controls, and it was found that only this mutation site was present in this patient, whereas none of the healthy controls was found to be present at this mutation site. It is worth to say that the inventor discovers a new mutation of a pathogenic gene HGSNAT for the first time, and discovers a new pathogenic mutation in Chinese population for the first time, and the pathogenic mutation detection reagent prepared by the inventor is also strongly verified in the family system.

3. G248 mutation pathogenic prediction

1. Enzyme activity detection of HGSNAT

1.1 construction of expression vectors

Constructing the expression vector of the full-length HGSNAT. Specifically, a synthesized PUC57-HGSNAT:: MYC:: FLAG cloning vector (shown in FIG. 5) was ordered, and the HGSNAT:: MYC: FLAG fragment was amplified by PCR using this as a template, and the primer pair sequence was:

an upstream primer: 0583-F CGCACCGGTAGTGGTACCATGAGCGGG (SEQ ID NO: 13)

A downstream primer: 0583-R CGCTGTACATCACTTGTCGTCATCGTCTTTGT (SEQ ID NO: 14)

The amplification-related steps are as follows: 100ng of the cloning vector was added to 50. Mu.L of a reaction system consisting of 1.25. Mu.L of each of the forward primer and the reverse primer (10. Mu.M), 5.5 x PrimeSTAR Buffer (Mg) ²⁺ plus) 10. Mu.L, dNTP (2.5. Mu.M) 4. Mu.L, primeSTAR HS DNA polymerase (2.5 units/. Mu.L) 0.5. Mu.L, and water was added to make the total volume 50. Mu.L. The PCR reaction procedure was: the pre-denaturation stage was 94℃for 60 seconds; denaturation phase 98 ℃,10 seconds; the annealing stage is 56 ℃ for 15 seconds; extension step72℃for 1min/1kb; cooling to 4 ℃ for 10min; denaturation, annealing and extension are carried out for 34 times in three stages, thus completing the amplification.

The PCR product obtained was digested with AgeI-HF and BsrGI-HF, and then recovered by TAE gel.

20. Mu.L of the digestion system was prepared from 1. Mu.g of the PCR product, 10x CutSmart Buffer 2. Mu.L of AgeI-HF, 1. Mu.L of BsrGI-HF and 1. Mu.L of water to a total volume of 20. Mu.L; the enzyme digestion is carried out for 1 hour at 37 ℃.

After the enzyme digestion is completed, adding 1 XDNA loading buffer solution, electrophoresis is carried out for 160V in 1% agarose gel for 30 minutes, then analysis is carried out on an ultraviolet analyzer, a target band is found, agarose of the area where the target band is located is cut off by a surgical knife blade, and DNA fragments are recovered by glue.

Meanwhile, the existing pCSC-IRES-GFP (shown in FIG. 6) in the laboratory is used as a vector backbone, and after double digestion by using AgeI-HF and BsrGI-HF, TAE gel is run, and the nucleic acid gel containing the vector backbone is excised and the vector fragment is recovered. The PCR product fragment purified above was ligated with T4 ligase, and the ligated product was transformed into E.coli Stbl 3. The cleavage system is the same as that of the PCR product. The ligase ligation system was 20. Mu.L, and 50ng of the recovered vector backbone after digestion was used as a fragment of the recovered PCR product, 1. Mu.L of T4 ligase, 2. Mu.L of 10 Xligation buffer, and water was added to a total volume of 20. Mu.L.

After transformation to E.coli, LB plates were incubated overnight at 37℃for 16-18 hours;

the next day, the single clone grown on LB plates was picked up with tip onto LB liquid medium (0.1 mg/ml ampicillin added) and shaken at 37℃for 16-18 hours.

The plasmid was extracted and verified by Sanger sequencing, and the resulting pCSC-HGSNAT-WT:: MYC:: FLAG vector was as shown in FIG. 7.

1.2 construction of the mutant vector

Site-directed mutagenesis (Site-Directed Mutagenesis) was performed by relying on the pCSC-HGSNAT-WT::: MYC::: FLAG vector constructed in the previous step. Specifically, pCSC-HGSNAT-WT:: MYC:: FLAG vector was used as a template, and mutation primers were designed to amplify the full-length HGSNAT:: MYC:: FLAG vector. The design of the mutation primer pair is as follows:

a first primer pair for amplifying mutant p.R344C

An upstream primer: 0584-F TTGTCTTGGGACAAGGTGTGCATTCCTGGTGTGCTGC (SEQ ID NO: 15)

A downstream primer: 0584-R GCAGCACACCAGGAATGCACACCTTGTCCCAAGACAA (SEQ ID NO: 16)

A second primer pair for amplifying mutant p.G248E

An upstream primer: 0585-F GCGTGGACACCTTCAGGGAGATTGCTCTTATACTCAT (SEQ ID NO: 17)

A downstream primer: 0585-R ATGAGTATAAGAGCAATCTCCCTGAAGGTGTCCACGC (SEQ ID NO: 18)

A third set of primers for amplifying mutant p.P237Q

See SEQ ID NO 15-20.

An upstream primer: 0586-F GGCGTCTATCTGCCCTGCAGCCCCGCCTCCGCAGCGT (SEQ ID NO: 19)

A downstream primer: 0586-R ACGCTGCGGAGGCGGGGCTGCAGGGCAGATAGACGCC (SEQ ID NO: 20)

The amplification-related steps are as follows: 100ng of the template carrier was added to 50. Mu.L of a reaction system consisting of 1.25. Mu.L of each of the forward primer and the reverse primer (10. Mu.M), 5.5 x PrimeSTAR Buffer (Mg) ²⁺ plus) 10. Mu.L, dNTP (2.5. Mu.M) 4. Mu.L, primeSTAR HS DNA polymerase (2.5 units/. Mu.L) 0.5. Mu.L, and water was added to make the total volume 50. Mu.L. The PCR reaction procedure was: the pre-denaturation stage was 94℃for 60 seconds; denaturation phase 98 ℃,10 seconds; the annealing stage is 56 ℃ for 15 seconds; extension stage 72 ℃,1min/1kb; cooling to 4 ℃ for 10min; denaturation, annealing and extension are carried out for 32 times in three stages, thus completing the amplification.

The obtained PCR product is subjected to DpnI enzyme digestion and methylation of a plasmid template, then is transformed into escherichia coli, single colony amplification is picked on the next day, and mutation success is verified by Sanger sequencing, so that R344C, G248E and P237Q expression vectors are respectively obtained (see figures 8-10). The DpnI enzyme digestion system was 60. Mu.L, and water was added to the mixture to a total volume of 20. Mu.L from 45. Mu.L, 10x CutSmart Buffer 6. Mu.L, and DpnI 0.5. Mu.L of the amplified product; the enzyme was digested at 37℃for 3 hours, and inactivated at 80℃for 20 minutes.

1.3 HGSNAT enzyme activity detection

293T cells are cultivated routinely, and the complete medium is DMEM+10% FBs+1% of neomycin diabody. 1. Mu.g of each of the constructed pCSC-HGSNAT:: MYC:: FLAG vector (WT, R344C, G E) was transfected into 293T cells using PEI. The transfection process is as follows: passage of 293T cells in advance at 3X 10 ⁵ Cells were seeded into 6-well plates. The next day, 1. Mu.g of plasmid was mixed with serum-free DMEM, and 3 volumes of PEI were added and mixed well, and allowed to stand at room temperature for 15 minutes. Slowly adding the mixture into the culture solution, shaking gently, and placing in a 37 deg.C incubator for 12-16 hr. After overnight transfection, the cells were washed once with PBS and continued to be cultured by replacing fresh 10% DMEM complete medium. After 48 hours of transfection, the medium was aspirated and washed once with PBS. Adding water to lyse cells, collecting in an EP tube, and then using ultrasonic disruption to prepare cell lysate for later use. The protein concentration of the lysate was also determined by BCA method.

The protein lysates were first tested using polyacrylamide gel electrophoresis (SDS-PAGE) experiments, each of 30. Mu.g of protein was taken and run in 10% gel (80V for 30 min for concentrated gel; 120V for 60-90 min for separation gel). Proteins were electrotransferred onto PVDF membranes, blocked with 5% skim milk, followed by incubation of the primary antibodies (MYC, GAPDH) overnight at 4 ℃. The next day, the primary antibody was removed and washed 3 times with TBST solution for 15 minutes each. HRP conjugated secondary antibody was added and incubated for 1 hour at room temperature. TBST was washed 3 times for 15 minutes each. Finally ECL substrate luminophores were added and protein signals were detected in a chemiluminescent instrument (Bio-Rad ChemidocXRS+).

As a result of the detection, MYC bands were detected in both wild type and mutant, which showed that HGSNAT:: MYC:: FLAG fusion protein was expressed.

In 96-well plates, 10. Mu.L of each protein lysate was added to 5. Mu.L of McIlvain buffer (pH 5.5), 5. Mu.L of 3mM substrate (4-methylumbelliferone-. Beta. -D galactoside (MU-. Beta. GlcNH) ₂ ) Or 4-methyl protein phenol p-acetyl-beta-D glucosamine (MU-. Beta.GlcNAc)), 5. Mu.L of 5mM acetyl-CoA. Incubate at 37℃for 1 hour. 225. Mu.L of 0.4M glycine buffer (pH 10.4) was added. The reaction solution is placed in an enzyme-labeled instrument, the wavelength of the detection excitation light is 360nm, and the wavelength of the emission light is 450nm. The standard curve was determined using 4-methylumbelliferone (4-MU). The calculated enzyme activity formula is:

fluorescence valuex 0.25ml

x1x

1＝nmol/h/mg

Slope 0.001ml 1 hour protein concentration (mg/ml)

As shown in FIG. 12, the results of the enzyme activity measurement showed that the mutant HGSNAT enzyme activity of R344C, G248E was reduced to 6.0% and 4.1% compared with the wild type, respectively, indicating that the mutant HGSNAT showed almost no enzyme activity. Meanwhile, the mutant HGSNAT did not cause an enzyme activity change of NAGase downstream thereof, suggesting that the mutation specifically resulted in loss of HGSNAT enzyme activity.

2. Subcellular localization detection of HGSNAT

The constructed pCSC-HGSNAT:: MYC:: FLAG vector (WT, R344C, G248E, P237Q) and lysosomal localized reporter vector pLAMP1:: mCherry (adedge 45147) (see FIG. 13) were transfected into 293T cells using PEI. The transfection process is as follows: passaging 293T cells in advance at 4X10 ⁴ Cells were seeded onto cell climbing plates of a 24-well plate. The next day, 0.25. Mu.g HGSNAT plasmid and 0.25. Mu.g reporter plasmid were mixed with serum-free DMEM, and then 3 volumes of PEI were added and mixed well, and left to stand at room temperature for 15 minutes. Slowly adding the mixture into the culture solution, shaking gently, and placing in a 37 deg.C incubator for 12-16 hr. After overnight transfection, the cells were washed once with PBS and continued to be cultured by replacing fresh 10% DMEM complete medium. After 48 hours of transfection, the medium was aspirated and washed once with PBS. Cells were fixed with 4% pfa at room temperature for 20 min and then placed in PBS for use.

PBS was pipetted off and blocked for 30 min with blocking solution containing 3% BSA and 0.3% Triton-X-100. The blocking solution was removed and primary antibody (FLAG) was added and incubated overnight at 4 ℃. The next day, wash with PBST 3 times for 10 minutes each. The secondary fluoroantibody Alexa fluor 488 was added and incubated at room temperature for 1 hour in the dark. PBST was washed 3 times for 10 minutes each. Finally, hoechst 33342 staining solution was added for 5 minutes, washed with PBS for 5 minutes, and the slide was blocked with 4% PVA. The localization of the HGSNAT protein in lysosomes was then observed under a fluorescence microscope (Leica DMi 8).

Immunofluorescence staining results are shown in FIG. 14, and it is clear from FIG. 14 that the wild-type and polymorphic P237Q HGSNAT proteins were co-localized in cells with lysosome expressed mCherry (signal superposition), whereas the R344C, G248E mutant HGSNAT was not fully co-localized in cells with lysosome expressed mCherry (signal non-superposition), indicating that the R344C, G248E mutation resulted in failure of HGSNAT localization in lysosomes.

It is worth pointing out that the inventor discovers a new pathogenic mutation in a pathogenic gene HGSNAT of monogenic genetic disease MPSIWC for the first time, takes MPSIWC diseased family as a research object, carries out whole exome sequencing on diseased individuals (forensics) in the family, and then verifies the forensics and non-diseased individuals in the family through Sanger sequencing; complex heterozygous mutations were detected on the pre-protector hgsnap gene: variation 1: 1030C > T (p.Arg 344Cys) and variant 2: 743G > A (p.Gly248 Glu). Variation 1 is a missense mutation of exon 11, which causes an arginine Arg mutation at position 344 of hgsnap protein to a cysteine Cys; variation 2 is a newly discovered variation, missense mutation at exon 7, which causes glycine Gly at position 248 of hgsnap protein to mutate to glutamic acid Glu. The pathogenic mutation is also discovered for the first time in Chinese population, and the detection reagent provided by the example is also verified in the diseased family; in addition, the pathogenicity of the mutation is verified through bioinformatics and experiments, and the loss of activity of HGSNAT and the failure of lysosome localization caused by two variants are verified, so that the two variants are both harmful pathogenic variants, and the corresponding pathogenic mechanism is discussed. The pathogenic mutation expands MPSIWC pathogenic gene mutation spectrum, provides new data for developing gene diagnosis, and provides new molecular biology foundation for diagnosis of the disease.

Finally, what is necessary here is: the above embodiments are only for further detailed description of the technical solution of the present invention, and should not be construed as limiting the scope of the present invention, and any person skilled in the art should make some changes, modifications, substitutions, combinations and simplifications using the technical solution disclosed above without departing from the scope of the technical solution of the present invention, all of which are included in the scope of the present invention.

Claims

1. A mucopolysaccharidosis IIIC pathogenic mutant gene characterized by: the pathogenic mutant gene is mutated with wild HGSNAT gene, and the 7 th exon of the pathogenic mutant gene contains a missense mutation site c.743G > A.

2. The pathogenic mutant gene according to claim 1, wherein: the 743 nucleotide is mutated from G to A.

3. The pathogenic mutant gene according to claim 1, wherein: the 248 th amino acid of the protein of the gene is glutamic acid (Glu) from glycine (Gly).

4. A nucleotide, characterized in that: said nucleotide is associated with MPSIWC, said nucleotide having c.743G > A compared to the wild-type HGSNAT gene; or the mutant HGSNAT gene nucleotide 7 exon contains a missense mutation site c.743G > A.

5. The sum nucleotide according to claim 4, wherein: the 743 nucleotide of the nucleotide sequence is mutated from G to A.

6. The sum nucleotide according to claim 4, wherein: the nucleotide sequence is shown as SEQ ID NO. 7.

7. A protein, characterized in that: the protein is related to MPSILC, and compared with wild HGSNAT protein, the 248 th amino acid is glutamic acid (Glu) from glycine (Gly).

8. The protein of claim 7, wherein: the amino acid sequence of the mutant protein is shown as SEQ ID NO. 11.

9. Use of the pathogenic mutant gene of claim 1 or the nucleotide of claim 4 or the protein of claim 7 for the preparation of a MPSIIIC detection reagent or detection device.

10. A reagent for detecting MPSIIIC, characterized in that: the reagent at least comprises a reagent for detecting and detecting 743 nucleotide locus of HGSNAT gene; and/or a reagent for detecting 248 th amino acid site of HGSNAT protein.

11. The reagent according to claim 22, wherein the primer comprising the reagent for detecting the 743 rd nucleotide position of HGSNAT gene is: the upstream primer is shown as SEQ ID NO. 1, and the downstream primer is shown as a primer pair shown as SEQ ID NO. 2.