CN116064545B - Biomarker for regulating and controlling activation or proliferation of B lymphocytes of SLE patient and application of biomarker - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and discloses a biomarker for regulating and controlling B lymphocyte activation or proliferation of SLE patients and application thereof. The invention provides a biomarker for regulating the activation or proliferation of B lymphocytes of SLE patients, wherein the biomarker is LncRNA ENST00000537616. Activated Ba exosomes, after uptake by B cells, can promote B cell activation and proliferation by releasing their contents LncRNA ENST00000537616 into the B cells. The invention discovers the effect of activating LncRNA ENST00000537616 in Ba exosomes in promoting B cell activation in SLE for the first time, and provides a new direction for research and clinical diagnosis and treatment of SLE pathogenesis.

Description

Biomarker for regulating and controlling activation or proliferation of B lymphocytes of SLE patient and application of biomarker

Technical Field

The invention relates to the technical field of biological medicines, in particular to a biomarker for regulating and controlling activation or proliferation of B lymphocytes of SLE patients and application thereof.

Background

Systemic lupus erythematosus (systemic lupus erythematosus, SLE) is a chronic autoimmune disease that can induce damage to multiple organs, systems by the overactivation of autoreactive B cells to produce large amounts of pathogenic autoantibodies, cytokines, etc. Biological therapies that are centered on targeted B cell activation and the like, including intervention of B cell surface co-stimulatory molecules and activators, interfering with B cell intracellular signaling functions, even elimination of B cells and the like, are the focus of research in current ongoing clinical trials.

Basophils (Ba) are a classical innate immune cell that, although not more than 1% of human peripheral blood mononuclear cells (Peripheral Blood Mononuclear Cell, PBMCs), play a critical role in immune diseases. Ba can activate autoreactive IgE and home to secondary lymphoid organs, promoting Th2 polarization and autoantibody production, and further promoting mouse SLE and LN development. In MRL-lpr mice, peripheral blood Ba activation is increased, and clearance of Ba can prolong the survival time of lupus mice and reduce the production of autoantibodies IgG and IgE. In addition, ba is also related to activity degree and disease severity of lupus nephritis, and inhibition of Ba activation can obviously reduce SLEDAI score of SLE patients and improve clinic of SLE patients. In addition, ba from SLE patients can home to secondary lymphoid organs such as lymph nodes, spleens and the like. Ba promotes B cell proliferation, class switching, differentiation into plasma cells, and production of IgG-based antibodies. Studies based on SLE patients and lupus model mice with genetic background have found that, following abnormal activation of Ba, SLE onset is mediated primarily by homing into Secondary Lymphoid Organs (SLOs) and interaction with B cells. However, the molecular mechanisms that regulate B cells remain to be clarified, and how to mediate the regulatory effect of homing Ba on B cell activation is one of the key directions of clinical research and application.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a biomarker for regulating and controlling the activation or proliferation of B lymphocytes of SLE patients and application thereof, thereby providing a new idea for defining the pathogenesis of SLE and clinically diagnosing and treating SLE.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides a biomarker for modulating B lymphocyte activation or proliferation in a SLE patient, said biomarker being LncRNA ENST00000537616.

The invention co-cultures activated Ba-derived exosomes and B cells for 48 hours, and discovers that the Ba-derived exosomes can be taken up by the B cells; further co-culturing the activated Ba with B cells, it was found that B cells can be activated and that LncRNA ENST00000537616 expression in B cells is increased; in contrast, the addition of the exosome blocker GW4869 reduced the activation of activated Ba on B cells, and reduced the expression of LncRNA ENST00000537616 in B cells. Thus, the activated Ba exosomes, after uptake by B cells, can promote B cell activation and proliferation by releasing their contents LncRNA ENST00000537616 into the B cells. The invention discovers the effect of activating LncRNA ENST00000537616 in Ba exosomes in promoting B cell activation in SLE for the first time, and provides a new direction for research and clinical diagnosis and treatment of SLE pathogenesis.

As a preferred embodiment of the biomarker of the present invention, the nucleotide sequence of LncRNA ENST00000537616 is shown in SEQ ID No. 1.

As a preferred embodiment of the biomarker according to the present invention, the biomarker is present in basophil exosomes.

In a second aspect, the invention provides the use of an inhibitor of LncRNA, lncRNA ENST00000537616, in the manufacture of a medicament for modulating B lymphocyte activation or proliferation in a SLE patient.

As a preferred embodiment of the use according to the invention, the expression inhibitor comprises a lentiviral vector.

As a preferred embodiment of the use according to the invention, the lentivirus knocks down the expression of LncRNA.

In a third aspect, the invention provides the use of a basophil exosome blocker in the manufacture of a medicament for modulating B lymphocyte activation or proliferation in a SLE patient.

As a preferred embodiment of the use according to the invention, the basophil exosome blocker comprises a sphingomyelinase inhibitor.

As a preferred embodiment of the application of the invention, the medicament is prepared from pharmaceutically acceptable auxiliary materials into clinically usable medicament formulations.

Compared with the prior art, the invention has the beneficial effects that:

the activated Ba source exosome LncRNA ENST00000537616 molecule can promote B cell activation and proliferation, and further participate in SLE morbidity. The invention co-cultures activated Ba-derived exosomes and B cells for 48 hours, and discovers that the Ba-derived exosomes can be taken up by the B cells; further co-culturing the activated Ba with B cells, it was found that B cells can be activated and that LncRNAENST00000537616 expression in B cells is increased; in contrast, the addition of the exosome blocker GW4869 reduced the activation of activated Ba on B cells, and reduced the expression of LncRNA ENST00000537616 in B cells. Thus, activated Ba exosomes, after uptake by B cells, can promote proliferation of B cells by releasing their contents LncRNA ENST00000537616 into B cells. The invention discovers the effect of activating LncRNA ENST00000537616 in Ba exosomes in promoting B cell activation in SLE for the first time, and provides a new direction for research and clinical diagnosis and treatment of SLE pathogenesis.

Drawings

FIG. 1 shows the Ba state under an optical microscope; the scale bar in the figure is 100 μm;

FIG. 2 shows the purity of Ba after FCM verification and negative selection;

FIG. 3 is a Ba activation model;

FIG. 4 shows the B cell status under an optical microscope; the scale bar in the figure is 100 μm;

FIG. 5 shows the purity of FCM-verified B cells;

FIG. 6 is a B cell activation model;

FIG. 7 is a volcanic map of LncRNA differential expression (fold change on the abscissa and P-value on the ordinate);

FIG. 8 is a cluster map of LncRNA differential expression; in the graph, red is expression up-regulation, blue is expression down-regulation, and the larger the expression value is, the darker the color is;

FIG. 9 shows the RT-qPCR assay of LncRNA expression in the basophil source exosomes;

FIG. 10 shows the RT-qPCR assay for verifying LncRNA expression in B cells of SLE patients;

FIG. 11 shows immunofluorescence detection of activated Ba-derived exosomes co-localized with B cells; the scale bar in the figure is 100 μm;

FIG. 12 is a graph showing the RT-qPCR assay to verify the activation index of B cells after co-culturing activated Ba with B cells;

FIG. 13 is a graph showing the expression level of LncRNA ENST00000537616 in B cells after co-culturing activated Ba and B cells by RT-qPCR;

fig. 14 is information related to LncRNA ENST00000537616;

FIG. 15 shows the effect of lentivirus transfection on B cells under fluorescence microscopy; the scale bar in the figure is 100 μm;

FIG. 16 is a graph showing the transfection efficiency of LncRNA ENST00000537616 in B cells by RT-qPCR;

FIG. 17 is a graph showing the effect of CCK-8 on B cell viability of LncRNA ENST00000537616;

FIG. 18 is a graph of FCM verification of the proliferative effect of LncRNA ENST00000537616 on B cell U266;

FIG. 19 is a graph of FCM verification of the proliferative effect of LncRNA ENST00000537616 on B-cells Raji;

in the above-mentioned figures of the drawing, ^ns P>0.05，*P<0.05，**P<0.01，***P<0.001。

Detailed Description

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the following specific examples. It will be appreciated by persons skilled in the art that the specific embodiments described herein are for purposes of illustration only and are not intended to be limiting. The human genome contains a large amount of RNA that does not encode proteins, which is called non-coding RNA, and non-coding RNA in which transcripts > 200 nucleotides are called long non-coding RNA (LncRNA). Exosomes are membrane vesicles (30-200 nm) secreted by intracellular multivesicular bodies (Multivesicular bodies, MVB) and released into the extracellular environment by cells of different tissues and organs, and can be separated from cell culture supernatants and various body fluids. Exosomes play an important role in cellular communication, and can be fused with or taken up by target cells by endocytosis.

The test methods used in the examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are all commercially available.

Example 1: construction of Ba in vitro activation model

1. Clinical specimens

Clinical blood samples were from 2021, 6-2, and were clearly diagnosed as SLE patients in the affiliated hospitals of the university of medical science, guangdong. Healthy volunteers were recruited to withdraw peripheral blood for isolation of human peripheral blood Ba and B cells to construct SLE in vitro activation models. The invention is approved and approved by the ethical committee of the affiliated hospitals of Guangdong medical university. All SLE patient diagnoses in the group met the 1997 revised American society of rheumatology (American College of Rheumatology, ACR) classification criteria; excluding patients with other autoimmune diseases such as infection, hepatitis B, allergic diseases, and rheumatoid arthritis, tumor, and other serious systemic diseases.

2. Extraction of Ba

Human peripheral blood in EDTA anticoagulation tube was placed in a 15mL centrifuge tube, and 1mL HetaSep was added ^TM Solution, fully mixing the materials upside down, centrifuging (90 g,5min, room temperature) and standing for 10min at room temperature; the plasma was slowly transferred to a 50mL centrifuge tube using a 3mL Pasteur tube and 4 volumes of EasySep were added ^TM Buffer, fully and evenly mixing the mixture upside down, and centrifuging (120 g,10min, room temperature); the supernatant was removed with a 3mL Pasteur tube and EasySep was added ^TM Buffer resuspension, centrifugation (120 g,10min, room temperature); repeating the previous step; the supernatant was removed with a 3mL Pasteur tube and 1.5mL EasySep was used ^TM Buffer resuspended PBMC and PBMC were transferred into flow tubes using a 200uL gun head. Counting: mu.L of PBMC suspension was taken in 200. Mu.L Ep tubes with easy Sep ^TM Diluting Buffer to 10 mu L, adding 10 mu L of trypan blue, lightly blowing with a 10 mu L gun head, uniformly mixing, taking 10 mu L of trypan blue, counting in a counting plate, and detecting cell activity; the cell concentration was adjusted to 5X 10 ⁷ cells/mL, 50. Mu.L of primary antibody per mL,gently stirring, standing for 7min, adding secondary antibody of the same system (vortex shaking for 30 seconds before adding), and stirring with easy Sep ^TM The Buffer is resuspended to 2.5mL, the Buffer is immediately placed into a magnet, the liquid is directly poured into a new flow tube after standing for 3 minutes, and the process is repeated for 1 time, and finally Ba is obtained; centrifuging the suspension of basophils (300 g,6min, room temperature); the supernatant was removed and resuspended in 1mL of complete medium; cell activity was counted and detected: adding 10 mu L of Trypan blue into 200 mu L of Ep tube, lightly blowing and mixing with 10 mu L of gun head, counting 10 mu L of Ba in a counting plate, detecting cell activity, and continuing to carry out subsequent experiments when the cell activity reaches more than 95%; detection of CD203C by flow cytometry ⁺ CD123 ⁺ And continuing the subsequent experiments when the purity of Ba reaches more than 95 percent.

3. Cultivation of Ba

Preparing a complete culture medium: 5% exosome-free FBS,1% diabody, 5ng/mL IL-3, X-Vivo ^TM 15Medium. Containing 5% CO ₂ Culturing in an incubator at 37 ℃.

4. Activation of Ba

Ba was activated with 2. Mu.g/mL anti-Human IgE (epsilon-chain specific) at 5% CO ₂ After 15 minutes of incubation in an incubator at 37 ℃, ba activation levels were assessed by detecting the average fluorescence intensity (median fluorescence intensity, MFI) of the CD203C specific marker by CD203C specific labelling, flow cytometry.

5. Separation of Ba exosomes

Centrifuging the Ba culture supernatant, 300g,10min, and removing cells at 4 ℃, and taking the supernatant; centrifuging 2000g,10min, removing dead cells at 4deg.C, and collecting supernatant; centrifuging, removing cell debris at 10000g and 30min at 4deg.C, and collecting supernatant; the supernatant was filtered through a 0.22 μm sieve. Centrifuging at 120000g for 90min at 4deg.C, removing supernatant, and collecting the rest precipitate as exosomes and impurity proteins; resuspension with pre-chilled commercial PBS. Centrifuging at 120000 g/90 min/4 ℃, and removing the supernatant to obtain exosomes. Resuspension with commercial PBS pre-cooled in advance, and packaging the exosomes in a refrigerator at-80deg.C for use.

6. Identification of Ba exosomes

(1) Electron microscope identification

Diluting 5 mu L of exosomes with PBS according to the ratio of 1:1, lightly blowing and mixing uniformly; sucking 10 mu L of exosome suspension, dripping the exosome suspension on a copper net, settling and standing for 2min, and sucking floating liquid by using filter paper; sucking 10 mu L of 2% uranyl acetate, dripping the uranyl acetate on a copper net, standing for 1min, sucking redundant uranyl acetate dye liquor by using filter paper, and drying at normal temperature for 3min; JEM-1400 type transmission electron microscope, observing the morphology of exosomes, and recording by a 80kV,Gatan832 CCD camera working voltage.

(2) NTA identification

Taking 10 mu L of exosomes, adding 990 mu L of PBS, gently blowing and mixing; the sample was injected into the sample cell of the Nanosight NS300 nanoparticle tracking analyzer with a 1mL syringe, passed through the nanoscopic aperture at a constant speed, and the relevant results were observed and recorded.

Since Ba in SLE patients is in an activated state, ba in vitro activation models (simulating Ba activated in SLE patients) were constructed. By EasySep ^TM Human Basophil Enrichment Kit after negative selection of Ba in human peripheral blood, observing the morphology under an optical microscope, wherein Ba is round, the nucleus is clearly visible, the cytoplasm is transparent, and the Ba grows in suspension in a culture solution (see figure 1); the purity (FITC-CD 123) of the product is detected by FCM, and the purity of the product is found to be more than 96 percent (see figure 2); after a further 15min of Anti-IgE stimulation, FCM measures the activation (PE-CD 203C) and the result shows that Ba can be significantly activated by Anti-IgE (see FIG. 3); the results show that the Ba activation model is successfully constructed.

Example 2: construction of B cell in vitro activation model

1. Extraction of B cells from SLE patients

Extracting PBS equipped with 2% FBS; the human peripheral blood in the EDTA anticoagulation tube is placed in a 50mL centrifuge tube according to the peripheral blood: PBS containing 2% FBS was added at a ratio of pbs=1:1 containing 2% FBS, and thoroughly mixed; the lymph-separated liquid was placed in 50mL of lymph vessel, and the lymph-separated liquid was prepared as follows: peripheral blood: slowly adding the mixed solution in the step (2) above the lymph separation solution by using a 1mL gun head according to the ratio of PBS=1:1:1 containing 2% FES; centrifuging, 800g,20min, and at room temperature; after centrifugation, the upper plasma layer was removed and cloud layer peripheral blood mononuclear cells (Peripheral Blood Mononu)clear Cell, PBMC) in a new 50mL centrifuge tube, add 4-fold system of PBS containing 2% FBS for washing; centrifuging at 3000rpm for 10min at room temperature to remove platelets; the supernatant was removed and the washing was continued with a 2% FBS in PBS resuspension; centrifuging at 1200rpm for 10min at room temperature; the supernatant was removed, PBMC were resuspended in 1mL-1.5mL PBS containing 2% FBS and placed in a 5mL flow tube; counting, adjusting the cell concentration to 5×10 ⁷ cells/mL, 50 mu L Cocktail Enhancer and Isolation Cocktail are added per milliliter, the mixture is kept stand at room temperature for 7 minutes, and then rapidsphere of the same system is added ^TM (vortex oscillation 15s in advance); PBMC were treated with EasySep ^TM Suspending Buffer to 2.5mL, immediately placing the flow tube in a magnet, standing for 3min, pouring the liquid into a new flow tube, continuously placing the new flow tube in the magnet, and standing for 1min to obtain B cells; centrifuging 300g for 6min at room temperature; removing the supernatant, and re-suspending with 1mL of culture medium; cell activity was counted and detected: adding 10 mu L of Trypan blue into 200 mu L of Ep tube, lightly blowing and mixing with 10 mu L of gun head, counting 10 mu L of Ba in a counting plate, detecting cell activity, and continuing to carry out subsequent experiments when the cell activity reaches more than 95%; flow cytometry detection of CD19 ⁺ And continuing the subsequent experiments when the purity of the B cells reaches more than 95 percent.

2. Culture of B cells

Preparing a complete culture medium: 10% FBS,1% diabody, 1. Mu.g/mL IL-2,0.0035% beta-mercaptoethanol, X-Vivo ^TM 15Medium. Containing 5% CO ₂ Culturing in an incubator at 37 ℃.

3. Activation of B cells

The anti-IgM (BCR activation pathway, B cell activation level 1 signal of SLE patient), sCD40L (activation B cell activation co-stimulatory factor CD40 pathway, B cell activation level 2 signal of SLE patient), IL-4 and IL-21 (B cell activation level 3 signal of SLE patient) are used for activating B cells, and a B cell in vitro activation model is constructed.

Through easy Sep ^TM Human B Cell Enrichment Kit after B cells are negatively selected, the morphology of the B cells is observed under an optical microscope, the B cells are round, the cell nucleus is clearly visible, the cytoplasm is transparent, and the B cells grow in a suspension in a culture solution (see FIG. 4); the purity (PE-CD 19) of the product is detected by FCM, and the purity of the product is found to be more than 96 percent(see fig. 5); after 48-stimulation with recombinant factors sCD40L, anti-IgM, IL-21 and IL-4, FCM was tested for activation (APC-CD 86), which showed successful in vitro B cell activation model construction (see FIG. 6).

Example 3: transcriptome sequencing

1. Extraction of B cell RNA

The Trizol method is used for extracting RNA, and specifically comprises the following steps:

cells were seeded in 6-well plates, 5% CO ₂ Culturing at 37 ℃ for 48 hours, collecting cells when the cells grow to 80% -90%, centrifuging (300 g,6 mm, room temperature), and removing the supernatant. After washing with PBS, transfer to a 1.5mL Ep tube, centrifuge (300 g,6 mm, room temperature) and remove the supernatant. Every 1×10 ⁶ Adding 1mL RNAiso Plus into each cell, and standing at room temperature for 10min; per RNAiso Plus: bcp=5: 1, adding BCP into the mixture, shaking the mixture vigorously for 15s by vortex, fully and uniformly mixing the mixture, and standing the mixture for 5min. Centrifuging at 15000g and 4 ℃ for 20min; obvious delamination was seen after centrifugation, and the upper clear aqueous layer was gently pipetted with a gun head into a new 1.5mL Ep tube at about 400 μl; the following transparent aqueous phase layers: isopropanol=1: 2, isopropanol is added in proportion, and the mixture is inverted and mixed evenly. Standing at 4deg.C for 30min. Centrifuging at 15000g and 4 ℃ for 20min; the supernatant was removed, 500. Mu.L of 75% alcohol pre-chilled at 4℃was added, and the pellet was allowed to float by gentle blowing. Centrifuge, 15000g,4℃for 20min. Repeating the steps once; the supernatant was removed and the Ep tube was air dried in an ultra clean bench and resuspended in 25. Mu.L DEPC water; and (5) measuring the concentration.

2. Extraction of exosome RNA

The supernatant was filtered through a 0.22 μm sterile filter to exclude particles greater than 0.8 μm. Add 1 system buffer XBP to 1 system samples (1:1). Mixing for 5 times upside down; the sample/XBP mixture was added to an exoEasy spin column (up to 16 mL), 500g,1min was centrifuged, the liquid was discarded and the column was placed in the same collection tube. This step was repeated until all samples were filtered through the column. 10mL XWP was added and centrifuged 5000g,5min to wash the column, remove residual buffer, and discard the waste along with collection tubes. After centrifugation, the column was carefully removed to avoid contact with the liquid surface. The column was transferred to a new collection tube. mu.L QIAzol was added to the membrane. The lysate was collected by centrifugation at 5000g for 5min. The lysate was transferred to a 2mL tube. The mixture was vortexed briefly and incubated at room temperature for 5min. This step promotes dissociation of the nucleoprotein. If reference controls are used, they should be added to the lysate at this point. To the lysate was added 90. Mu.L of chloroform. The lid is closed and is thrown vigorously for 15s. Thorough mixing is important for subsequent phase separation. Incubating for 2-3min at room temperature. Centrifuge, 12000g,15min,4 ℃. After centrifugation, rewarming to room temperature in the centrifuge. After centrifugation, the samples were divided into three layers: the upper layer is RNA containing colorless water phase; the middle layer is a white interlayer; the lower layer is a red organic phase. The system of the aqueous layer was about 400. Mu.L. The upper aqueous layer was transferred to a new collection tube. Avoiding sucking to the middle layer. Add 2 system absolute ethanol (400 μl aqueous layer plus 800 μl absolute ethanol) and mix up and down several times. A maximum of 700 μl sample, including any pellet that has formed, was pipetted into an RNeasy MinElute column in a 2mL collection tube. The cover is lightly covered, and the mixture is centrifuged, and the concentration is more than or equal to 8000g (more than or equal to 10000 rpm), 15s and room temperature. Discard the waste liquid. The remaining sample is transferred further into the collection tube in the same way. 700. Mu.L Buffer RWT was applied to RNeasy MinElute column. The lid was gently capped and centrifuged at > 8000g (. Gtoreq.10000 rpm) for 15s. Discard the waste liquid. The collection tube is then used further. mu.L Buffer RPE was pipetted into RNeasy MinElute column. The lid is gently covered and centrifuged at 8000g (. Gtoreq.10000 rpm) for 15s. Discard the waste liquid. The collection tube is then used further. mu.L Buffer RPE was pipetted into RNeasy MinElute column. The lid is covered and centrifuged for 2min with a speed of 8000g (10000 rpm). Discard the collection tube and waste liquid therein. After centrifugation, the RNeasy MinElute column was carefully removed from the collection tube, avoiding contact of the column with the liquid surface. The RNeasy MinElute column was placed in a new 2mL collection tube. The lid was opened and centrifuged at full speed for 5min to dry the membrane. Discard the waste liquid and collect the tube. In order to avoid damage to the spin column lid, the column is placed in the centrifuge to centrifuge at least one void between the two columns, the direction of the lid is opposite to the direction of the spin. The column was placed in a new 1.5mL collection tube. 14. Mu.L of RNase-free water was directly added to the center of the spin column. The column was allowed to stand for 1min with the lid gently closed, and then the RNA was eluted by centrifugation at full speed for 1 min.

3. RNA reverse transcription

(1) Reverse transcription of mRNA

The kit comprises: TAKARA Prime Script TM RT reagent Kit with gDNA Eraser (Perfect Real Time), mRNA reverse transcription system is shown in tables 1 and 2.

TABLE 1 genomic DNA removal reaction System

Reagent(s)	Volume of
		5×gDNA Eraser Buffer	2.0μL
gDNA Eraser	1.0μL
		Total RNA	0μL～7μL
RNase Free dH 2 O	Up to 10μL

Reaction conditions: 42 ℃,2min,4 ℃; in a 10. Mu.L system, the RNA should not be present in an amount greater than 1. Mu.g.

TABLE 2 reaction System for reverse transcription of mRNA

Reagent(s)	Volume of
		Reaction liquid for removing genome DNA	10.0μL
PrimeScript RT Enzyme Mix I	1.0μL
		RT Primer Mix	1.0μL
5×PrimeScript Buffer 2(for Real Time)	4.0μL
		RNase Free dH 2 O	4.0μL

Reaction conditions: 37 ℃ for 15min;85 ℃,5s;4 ℃.

(2) Reverse transcription of miRNAs

The kit comprises: mir-X miRNA First-Strand Synthesis Kit

The miRNA reverse transcription reaction system is shown in table 3.

TABLE 3 preparation of reverse transcription reaction System of miRNAs

Reagent(s)	Volume of
		mRQ Enzyme Mix	1.25μL
mRQ Buffer(2×)	5.0μL
		RNA sample (0.25. Mu.g-8. Mu.g)	3.75μL
Total	10.0μL

Reaction conditions: in the first stage, reverse transcription is carried out at 37 ℃ for 1h; in the second stage, reverse transcriptase is inactivated at 85℃for 5min.

4、qPCR

The kit comprises: TB Green Premix Ex Taq II (Tli RNaseH Plus)

The TB green dye method qPCR reaction system is shown in table 4.

TABLE 4qPCR reaction System

Reagent(s)	Final concentration	Volume of
			TB Green Premix Ex Taq II(Tli RNaseH Plus)(2×)	1×	5μL
PCR Forward primer(10μM)	0.4μM	0.4μL
			PCR Reverse primer(10μM)	0.4μM	0.4μL
RT reaction solution	-	1μL
			RNAse Free dH 2 O	-	Up to 10μL

Reaction conditions: first stage, pre-denaturation (1 cycle), 94 ℃ for 30s; in the second stage, qPCR (40 cycle), 95℃and 5s denaturation; annealing at 60 deg.c for 20s and extension.

5. Primer sequences

The primer sequences of ENST00000537616 are:

F:CAGAGCAGGTAGCCAACCACTTC；

R:GGTCCAGTTAGTCACTCAGAATCCATC。

full transcriptome sequencing is performed on the unactivated Ba from the peripheral blood of normal people and the activated human Ba-derived exosomes induced by the Anti-IgE, and the differential expression analysis shows that the LncRNA in the activated human Ba-derived exosomes has obvious expression difference compared with the unactivated Ba-derived exosomes. The volcanic (see FIG. 7) and differential expression cluster (see FIG. 8) showed that the expression of LncRNA was significantly increased in the activated Ba exosomes, such as ENST00000537616, NR_024480, ENST00000513626, ENST00000488188 and uc001yrs.3, and significantly decreased in the activated Ba exosomes, such as uc031tgb.1, ENST00000355500, AY726569, and TCONS_12_00007006, compared to the non-activated Ba.

LncRNA molecules associated with B cell function in the activated Ba source exosomes were screened for RT-qPCR validation. As a result, lncRNA ENST00000537616 was found to be significantly highly expressed in the activated Ba source exosomes (see fig. 9). To verify the expression level of LncRNA ENST00000537616 in SLE patient B cells, the expression of LncRNA ENST00000537616 in SLE patient B cells was examined in healthy humans and, as a result, it was found that the expression level of the molecule in SLE patient B cells was significantly increased compared to healthy humans (see fig. 10); thus, lncRNA ENST00000537616 is presumed to be a key molecule that regulates B cell function.

The expression of LncRNA ENST00000537616 molecules in activated B cells was examined by RT-qPCR, and it was found that LncRNA ENST00000537616 expression levels in activated B cells were not elevated compared to non-activated B cells, presumably due to lack of stimulation of the Ba microenvironment.

Example 4: co-culture of Ba and B cells

The lower chamber of Transwell is inoculated with Ba, the upper chamber is inoculated with B cells, and the mixture contains 5% CO ₂ Culturing in an incubator at 37 ℃. The cell line was divided into a B cell control group, a B cell+activated Ba co-culture group, and a GW4869 (exosome blocker) group.

Immunofluorescence detects the uptake of Ba exosomes by B cells, as follows:

activated Ba was co-cultured with B cells for 48h, and B cells were collected and resuspended to 300 μl. Diluting 2 mu L of PKH26 dye solution with 300 mu L of Dilute C diluent, mixing with B cell suspension, blowing and mixing uniformly, incubating for 5min at room temperature in dark place, adding an equal volume (600 mu L) of 1% BSA to stop dyeing, and standing for 1min at room temperature; with X-VIVO ^TM B cells were resuspended in 15Medium, room temperature, 300g, centrifuged for 5min and the supernatant discarded; b cells were resuspended to 1mL; adding Hoechst 33342 staining solution (namely 1mL of cell suspension and 1uL of staining solution) according to a dilution ratio of 1/1000, and continuously culturing for 10min; b cell suspension was collected in a 1.5mL EP tube, centrifuged at room temperature, 300g for 6min, and the supernatant was discarded; and (3) blowing and mixing the cell sediment and a small amount of residual supernatant, dripping the mixture on a 35mm glass bottom culture dish, drying the mixture at normal temperature in a dark place for 5min, and detecting a target fluorescent signal on the machine.

Detecting the influence of the activated Ba source exosome on the B cells, co-culturing the activated Ba and the B cells, and discovering that the B cells can absorb the activated Ba source exosome through immunofluorescence; further, after culturing for 15min with the addition of the exosome blocker GW4869 while activating Ba, the activated Ba was co-cultured with B cells, and the number of exosomes was found to be significantly reduced (see FIG. 11). In order to verify the influence of activated Ba exosomes on LncRNA in B cells, co-culturing the activated Ba and the B cells, and detecting the activation index of the B cells and the expression condition of the LncRNA after 48 hours, the result shows that the activated Ba can promote the activation of the B cells and the expression of LncRNA ENST00000537616 in the B cells; in addition, the exosome blocker GW4869 added, the activation promoting effect of Ba on B cells is reduced (see figure 12), and the expression of LncRNA ENST00000537616 in B cells is reduced (see figure 13), which shows that the increase of the LncRNA ENST00000537616 of the activated B cells possibly comes from the stimulation of the exosome of the activated Ba source; together, the above results indicate that activated Ba source exosomes can be taken up by B cells and release their content LncRNA ENST00000537616 to promote B cell activation. LncRNA ENST00000537616 is a long-chain non-coding RNA with the length of 2508bps positioned on chromosome 12 (see FIG. 14), and the base sequence of the RNA is shown as SEQ ID No. 1. Bioinformatic predictions were made through LncRNA-related databases and found to be closely related to B cell function.

The RNA base sequence of LncRNA ENST00000537616 is as follows:

ggtttggcttgaaatgtcatatttcagaatgtgcatagaggccaggggtggtggatcacacctgtgatccacctgcctcggcctcccaaagtgttgagattacaggcatgagccactgcacctggcctgctcagtgacttctaacattgctgctgtacctgggtaaatacttccagtcatatttaagcgggcttggagttggcaaaatctctgagagagacatcttcggaaagcctccatgctggacttagtggataaagtttccaatgtccagatattttcagctggtttctccttggtataggatttcttctgcattctaccctgcacatcttaatgataaccctcatattttggctaagcatttgactcccctttagaattgttctaacttgtttttaacagatgtctacaagagattcccaccaggatcctgcccatgcaatctttgagactttaaactcactccagctggaaataggaaccaacttaacccaagagactttggttcacatttaaccagtactttcctgaatgcctctcctaagtaaatggctctagtttctctattggccactgcactgccactaggattcctgcaagggatccgatgggcccagagcaggtagccaaccacttctctgttggatggaatgcaatgctgtttgccagcatgtttgagccagtccttcaagatggattctgagtgactaactggacctaaatttaaatagcacaaagcagccatttgctaactagatttcatacaaatgctctgagttcctggaaaacccacactccttaactttgggactttcaagactcacctaaatcaatcaattaaagctcacttgtgtcagctaatcagggatcagctgtattgactaatgaaaactaagcgagtttcaaattttaaccatttatttgtgtagaagacttgattgggagcctgggtatgaatacttgctataaaatctgagcattccctttgttctctggagcaaacaatgttaagttgttaactctctgtacctttctctagaactggatggaaacaactccatctgaaatgcagccctaataccagggaactcctacagtaaagcgctaaacaactttattactctaaccaacgtttatgtccctaatcagcaagaagtagttagaatggtcatcatccctttccctcaagattgaggaatggacataaaaaggaggggatttgtaactgctccagactgatctgttgtcagaaaggggctcttgaaccagaccatgaaagagggttcttggatctcctgcaggaaggaattcaaggagagtcacagagtgtagagagaatagacagtttattgaaagctactcagttacagagtagggcatcctccaaaagcaggaggaggaatgtgctgtctttgttttaaactcttcttttataggggtttaatctatgtaaaacctaagctatgtctacatgtgggtaggctgtcagtgtgacaaaatttagtattttgttgatataaagaaacttatccttgtcatcttagtgcataagtacatcaaagtatgactttagctaccttaaaagcatgtattgttatgtgatattgggacatctggacattctgctgtcgtaggagtttgtccttgcagcattactaaatcgcttccttagctgtaaacatcttataatcgtaggtcataactgtcaaggaagtgccttgctagtttttagatggagttgattttaaaatagtgtcactctggctttcctatgctcctgctttcctaacaaatctggttcaactttttttttttttattcaacataatcttttttttccatgctacctcatttacagagtgcttcctatagatatggttggtctgtatgtttcatttttcagctttgattcttatttttttgaatcacacatgctttatgggggcttccactaccatgagccatattttctgtattaccagcaagatgtttgggtttgttttttgttttctttatatttcaaattttattttagatttaggaagtacgtgtgcaggtttgttaacatgggtgtattgcatgacgctgatcttacaataccaatgatcccatcactcaggtagtgagcataatatccaataggtagtttttcagaacttgccttatcttccctctctccctgctctcttaattcgaagcctatttttcctatctttatgtccacatgtttccagcatttagctcccacttatacgtgagagtatgtggtatttgtttttctgtgtctgcattaatttacttaggatgatggcttccagctgcatcttttgttgcaaaggacatgactttgttcttttttatgactgtgtagtattccatggtgtatatgtaccacattttctttatccagaacactgttgataggcatctacattgattccatgtcttggctattgtgaatagtgcagcaataaacatgcatggttcaacttttatggtaacaaa。

example 5: detection of B cell activation and proliferation

(1) Resuscitation of B cell line (Raji, U266)

Complete medium, 10% FBS,1% diabody, RPMI 1640 medium was prepared in advance. B cell lines (Raji, U266) are taken out from liquid nitrogen, rapidly rocked in a water bath box at 37 ℃, taken out when the content of a freezing storage tube is completely changed from solid state to liquid state, wiped by yarn blocks, sterilized by alcohol and then placed in an ultra clean bench. The cells in the cryopreservation tube were quickly transferred to a 15mL centrifuge tube, resuspended to 5mL with complete medium and centrifuged (300 g,6min, room temperature). Removing the supernatant, and using 2mL PBS was resuspended, washed, centrifuged (300 g,6min, room temperature). The supernatant was removed, resuspended in complete medium and the cells transferred to T25 flasks with 5% CO ₂ After culturing for 24 hours at 37 ℃, the liquid is changed, and dead cells are removed. And carrying out passage when the cell density is as high as 80% -90%. Detecting cell activity: 10 mu L of Ba is taken in a 200 mu L Ep tube, 10 mu L of trypan blue is added, the mixture is gently blown and evenly mixed by a 10 mu L gun head, 10 mu L of Ba is taken in a counting plate to detect the activity of cells, the activity of the cells reaches more than 99 percent, and when the growth state of the cells is observed under a lens, the subsequent experiment is continued.

(2) Culture of B cell lines

Complete medium was prepared: 10% FBS,1% diabody, RPMI 1640 medium. Containing 5% CO ₂ Culturing in an incubator at 37 ℃.

(3) Liquid exchange of B cell line

After 48 hours of cell culture, the nutrients in the complete medium are basically consumed, and the color of the complete medium is observed to change, so that the cells need to be changed. Cells were collected in 15mL centrifuge tubes, centrifuged, 300g,6min, room temperature. The supernatant was removed, washed with 2mL of PBS, centrifuged, 300g,6min, and room temperature. Removing supernatant, adding fresh complete medium, transferring cell suspension into new culture flask or culture plate, and adding 5% CO ₂ Culturing at 37 ℃.

(4) Passage of B cell lines

When the cell grows to 80% -90%, the cell can be passaged (normal proliferation cells can be passaged for 48 hours). Cells were collected in 15mL centrifuge tubes, centrifuged, 300g,6min, room temperature. The supernatant was removed, washed with 2mL of PBS, centrifuged, 300g,6min, and room temperature. Removing supernatant, adding fresh complete culture medium, transferring cell suspension into new culture bottle or culture plate at a ratio of 1:3, and adding 5% CO ₂ Culturing at 37 ℃.

(5) Transfection of B cell lines

Suspension of cell lines (U266, raji) at 4X 10 ⁴ Hole density was seeded in 24-well plates, 20. Mu.L HiTransB-2 infection enhancement solution was added to each well, lentiviral particles carrying the target molecule (LncRNA ENST 0000537616) were added at MOI=50, and mixed gently with 5% CO ₂ Culturing at 37 ℃; after 8 hours, 100 μl of complete medium (10% FBS,1% diabody, RPMI 1640 medium) was added to each well; observing the growth state of cells under a microscope after 48 hours, and changing liquid; and (5) observing the cell transfection efficiency under a fluorescence microscope after 72 hours, and if the cell transfection efficiency reaches more than 90%, continuing to carry out subsequent experiments. If the cells were successfully transfected, but the transfection efficiency was less than 90%, flow sorting was performed to ensure that the vast majority of cells subjected to subsequent experiments were successfully transfected.

(6) Flow cytometry to detect B cell activation

After 48h of cell culture, the cells were collected in a 5mL flow tube, centrifuged, 300g,6min, room temperature. The supernatant was removed, washed with PBS, centrifuged, 300g,6min, room temperature. The supernatant was removed, resuspended in 100. Mu.L of PBS, 2.5. Mu.L of APC-CD86 antibody was added to each tube of cells, incubated for 30min at 4℃and washed with 1mL of PBS, centrifuged, 300g,6min, room temperature, washed repeatedly once, the supernatant removed, resuspended in 300. Mu.L of PBS, and the mixture was loaded onto a machine.

(7) Flow cytometry to detect proliferation of B cells

After 72h of cell culture, the cells were collected in a 5mL flow tube, centrifuged, 300g,6min, room temperature. The supernatant was removed, washed with PBS, centrifuged, 300g,6min, room temperature. Removing the supernatant, resuspending with 100uL PBS, adding 2.5uL FITC-CD19 antibody into each tube, incubating at 4 ℃ for 30min, adding 1mL PBS for washing, centrifuging, 300g,6min, washing at room temperature repeatedly, adding 1mL of 70% absolute ethanol pre-cooled in advance into each tube for fixation and membrane rupture, standing at 4 ℃ for 24h, centrifuging, 300g,6min, and at room temperature. The wash was repeated once. The supernatant was removed, resuspended in 100. Mu.L of PBS, 2.5. Mu.L of Alexa fluor 647-ki-67 antibody was added to each tube of cells, incubated at 4℃for 30min, washed with 1mL of PBS, centrifuged, 300g,6min, room temperature, washed repeatedly once, the supernatant removed, resuspended in 300. Mu.L of PBS, and the cells were placed on the machine.

Transfection of overexpressed LncRNA ENST0000537616 in B cell lines (Raji and U266) with lentiviruses with eGFP fluorescent markers, which were found to be efficient in transfecting B cells by fluorescent microscopy (see fig. 15); the transfection efficiency of lentiviruses was verified by RT-qPCR, and the results showed that LncRNA ENST0000537616 could be successfully overexpressed in B cells (see fig. 16); to verify the effect of LncRNA ENST00000537616 on B cells, its effect on B cell proliferation was examined, and its effect on B cell viability was examined by CCK8 experiments, which indicated that LncRNA ENST00000537616 could significantly enhance the viability of U266-B and Raji-B cells (see fig. 17); further examination of Ki-67 by FCM showed that LncRNA ENST00000537616 significantly promoted U266-B cell proliferation (see FIG. 18); proliferation of Raji-B cells can also be promoted (see fig. 19). Together, the above results indicate that LncRNA ENST00000537616 can promote proliferation of B cells.

The invention co-cultures activated Ba-derived exosomes and B cells for 48 hours, and discovers that the Ba-derived exosomes can be taken up by the B cells; further co-culturing the activated Ba with B cells, it was found that B cells can be activated and that LncRNA ENST00000537616 expression in B cells is increased; in contrast, the addition of the exosome blocker GW4869 reduced the activation of activated Ba on B cells, and reduced the expression of LncRNA ENST00000537616 in B cells. Thus, it can be inferred that, after uptake of activated Ba exosomes by B cells, proliferation of B cells can be promoted by releasing its content LncRNA ENST00000537616 into B cells. The invention discovers the effect of activating LncRNA in Ba exosomes to promote B cell activation in SLE for the first time, and provides a new thought for research on SLE pathogenesis.

In addition, the overexpression of LncRNAENST0000537616 in the U266B cell line can promote the expression of PPP3CB, FOS, NRAS, RAF1, RASGRP3, JUN, MAPK1, BCL10 and other molecules in the BCR pathway, and inhibit the expression of AKT3, NFAT5, PRKCB and other molecules; overexpression of lncrrnaenst 0000537616 in Raji B cell lines promotes expression of PPP3CB, KRAS, NRAS, BCL and MAPK1 in the BCR pathway. Knocking down the expression of LncRNA ENST00000537616 in Raji B cells and U266B cells can significantly inhibit KRAS expression. Thus, KRAS is one of the targets for regulating B cell proliferation by the Ba source exosome LncRNA ENST00000537616. Overexpression of lncRNAENST00000537616 in Raji B cells and U266B cells can significantly promote the expression of PPP3 CB; knocking down LncRNAENST00000537616 in U266-B cells significantly inhibited PPP3CB expression. Therefore, PPP3CB is one of the important targets for regulating B cell proliferation by Ba source exosomes LncRNA ENST00000537616. It is speculated whether LncRNA ENST00000537616 could modulate KRAS or PPP3CB expression by competitively binding to specific micrornas to promote B cell proliferation. It was found by bioinformatic predictions that lncrrnaenst 00000537616 might regulate B cell activation by LncRNA ENST00000537616/has-miR-330-5p/KRAS axis or LncRNA ENST00000537616/has-miR-326/KRAS axis.

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted equally without departing from the spirit and scope of the technical solution of the present invention.

Claims (1)

1. Use of LncRNA for modulating B lymphocyte activation or proliferation in vitro, wherein said LncRNA is LncRNA ENST00000537616; the nucleotide sequence of LncRNA ENST00000537616 is shown in SEQ ID No. 1.