CN116042571A - Cas12a variant and application thereof in gene editing - Google Patents

Abstract

The invention provides a Cas12a variant and application thereof in gene editing, wherein the Cas12a variant is LbCAs12a-K538R, and the amino acid sequence is shown as SED ID NO. 2. According to the invention, the Cas12a variant is obtained through protein transformation for the first time, so that the PAM identification of Cas12a is stricter than that of corresponding wild type, thereby reducing off-target effect; the three Cas12a variants can perform gene editing on the genome of the eukaryote at fixed points under the mediation of crRNA and have lower off-target effect, and the variety of the gene editing tools is further expanded by the discovery of the three Cas12a variants.

Description

Cas12a variant and application thereof in gene editing

The invention patent application is a divisional application of an invention patent with the application number of "CN20211057885. X", the application date of the original application is "2021, 5 and 26 days", the application number of the invention is "CN20211057885. X", and the invention is named as "a Cas12a variant and application thereof in gene editing".

Technical Field

The invention relates to the technical field of gene editing, in particular to a Cas12a variant and application thereof in gene editing.

Background

Since 2013, gene editing technology has made breakthrough progress, which has led to new changes in many fields of basic scientific research, medicine, clinic, biotechnology, etc. Besides the representative Cas9 system, cas12, also called Cpf1, is used as a novel member of a discovered CRISPR system with a gene editing effect, greatly expands the editable range of a target point of the gene editing system, and provides more convenient and efficient editing capability for mediating polygene editing compared with the Cas9 system for the function of processing the precursor RNA of Cas12a compared with the Cas9 system. In addition, the guide RNA composition of Cas12a is simpler and the design is more convenient than the guide RNA of Cas9.

In 2015, team Zhang Feng first discovered another new member with gene editing capability outside of Cas9 system, cas12a, also known as Cpf1, which was classified into CRISPR system class 2V. Compared to Cas9 systems, the editing efficiency of Cas12a is comparable to that of Cas9, with some targets being lower than Cas9.Cas12a is a safe gene editing tool with very low off-target rate compared to the high off-target rate characteristic of Cas9.Cas12a forms a cohesive end after cleavage, while Cas9 forms a blunt end, and studies have shown that the cohesive end after Cas12a cleavage is more susceptible to homologous recombination repair than the blunt end of Cas9, which also provides a better tool for site-directed insertion and repair of genes. In the aspect of processing the guide RNA, the Cas12a has obvious advantages, and only the Cas12a can complete the processing of the precursor RNA, while the Cas9 system needs the processing of RNaseIII, which greatly promotes the application of the Cas12a in polygene editing. In PAM recognition, cas12a recognizes 5'-TTTN-3' or 5'-KYTV-3', and Cas9 recognizes 5'-NGG-3'.

Therefore, cas12a, as a novel gene editing tool, provides a powerful tool for scientific research and treatment of diseases along with Cas9 system. Based on studies on Cas12a currently available, it is a significant thing to find more Cas12a variants with certain properties in order to cope with gene editing events in various future situations.

Disclosure of Invention

The invention aims to provide a Cas12a variant and application thereof in gene editing, wherein the Cas12a variant comprises Lb2Cas12a-K518R, lbCAs12a-K538R and AsCas12a-K548R, which are more strict than corresponding wild type PAM in vitro; and the off-target effect in vivo is lower.

In a first aspect of the invention, there is provided a Cas12a variant, the Cas12a variant comprising at least one of:

lb2Cas12a-K518R, the amino acid sequence is respectively shown as SED ID NO. 1;

LbCAs12a-K538R, the amino acid sequence is shown as SED ID NO. 2;

the amino acid sequences of AsCas12a-K548R are respectively shown as SED ID NO. 3.

In a second aspect of the invention, there is provided a recombinant expression vector expressing the Cas12a variant.

Further, the recombinant expression vector includes one of a plasmid vector, a viral vector and a phage vector.

In a third aspect of the invention, there is provided a recombinant bacterium or recombinant cell line or recombinant virus comprising said recombinant expression vector.

In a fourth aspect of the invention, there is provided a recombinant virus obtained using said viral vector packaging, said recombinant virus comprising an adenovirus or lentivirus expressing said Cas12a variant.

In a fifth aspect of the invention, there is provided the use of the Cas12a variant, the recombinant expression vector, the recombinant bacterium or recombinant cell line and the recombinant virus in gene editing.

In a sixth aspect of the invention, there is provided a CRISPR/Cas12a gene editing system comprising the Cas12a variant.

In a seventh aspect of the present invention, there is provided the system further comprising: crRNA or crDNA targeting the target gene.

In an eighth aspect of the present invention, there is provided a method of gene editing a gene of interest in a recipient, the gene editing of the gene of interest in the recipient by means of a CRISPR/Cas12a system, the method comprising:

providing a Cas12a variant by introducing the recombinant expression vector into a receptor;

providing crRNA by introducing a crRNA or crDNA plasmid targeting the target gene into the recipient;

the Cas12a variant and the crRNA form a complex in the receptor that recognizes the gene of interest and completes editing.

Further, the receptor includes one of 293T cells, ATDC5 cells, and C6 cells.

One or more technical solutions in the embodiments of the present invention at least have the following technical effects or advantages:

according to the Cas12a variant and the application thereof in gene editing, the Cas12a variant is obtained by protein modification for the first time, wherein the Cas12a variant comprises Lb2Cas12a-K518R, lbCAs12a-K538R and AsCas12a-K548R, so that the PAM identification of the Cas12a is stricter than that of corresponding wild type, and the off-target effect is reduced; the three Cas12a variants can carry out gene editing on a eukaryotic genome at fixed points under the mediation of crRNA, have lower off-target effect, further expand the variety of gene editing tools by the discovery of the three Cas12a variants, and have very important roles in basic scientific research and clinical treatment.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the results of Lb2Cas12a-K518R, lbCAs12a-K538R and AsCas12a-K548R in application example 1 in gene editing; wherein a represents wild type Lb, B represents LbK538R, C represents wild type Lb2, D represents Lb2K518R, E represents wild type As, and F represents AsK548R;

FIG. 2 is a schematic diagram of a second generation sequencing analysis in application example 2;

fig. 3 is a result of the Lb2Cas12a-K518R, lbCas12a-K538R recognition in vitro being more stringent than the corresponding wild-type PAM in application example 2;

fig. 4 shows the results of application example 3 in which the in vivo off-target effects of Lb2Cas12a-K518R, lbCas12a-K538R, asCas12a-K548R are lower;

fig. 5 shows the results of application example 3 in which the in vivo off-target effects of Lb2Cas12a-K518R, lbCas12a-K538R, asCas12a-K548R were lower.

Detailed Description

The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.

Throughout the specification, unless specifically indicated otherwise, the terms used herein should be understood as meaning as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification will control.

Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, etc., used in the present invention are commercially available or may be obtained by existing methods.

The general idea of the technical scheme of the invention is as follows:

the inventor of the present application found through experiments that:

the wild-type Cas12a was engineered as follows:

lb2Cas12a-K518R, the amino acid sequence is respectively shown as SED ID NO. 1; the concrete transformation is as follows: the 518 th amino acid K is mutated into amino acid R,

LbCAs12a-K538R, the amino acid sequence is shown as SED ID NO. 2; the concrete transformation is as follows: mutation of 538 th amino acid K into amino acid R,

the amino acid sequences of AsCas12a-K548R are respectively shown as SED ID NO. 3; the concrete transformation is as follows: mutation of amino acid K at position 548 to amino acid R,

after the transformation is adopted, experiments prove that the Cas12a variant of the embodiment of the invention has more strict recognition than corresponding wild-type PAM in vitro and lower off-target effect.

One Cas12a variant of the present application and its use in gene editing will be described in detail below with reference to examples and experimental data.

EXAMPLE 1 construction of recombinant expression vectors

1. Construction of an expression vector for Lb2Cas12a-K518R

(1) The prokaryotic expression vector of Lb2Cas12a-K518R is constructed on the pET28a vector by taking NcoI and XhoI as double enzyme cutting sites, and the specific steps are as follows (the enzyme cutting sites NcoI and XhoI are underlined):

forward primer: 5' -CATGCCATGGGCATGTACTATGAGTCCCTGACCAAGCAGTAC-3’(SED ID NO.49)

Reverse primer: 5' -CCGCTCGAGTTTCAGCAGGTGTGTCTGGGCATACTCCAGC-3’(SED ID NO.50)

And amplifying a template of the Lb2Cas12a-K518R eukaryotic expression vector pcDNA3.1-Lb2Cas12a (K518R) by using the primer pair to obtain a PCR product, and performing enzyme digestion by using NcoI and XhoI after PCR purification and recovery, and recovering the PCR product again.

And (3) carrying out NcoI and XhoI double digestion on the pET28a vector, carrying out enzyme ligation on the linearized pET28a and the fragments obtained by the digestion after glue recovery, and obtaining pET28a-Lb2Cas12a (K518R).

(2) Eukaryotic expression vectors are obtained by direct mutation on the basis of the Lb2Cas12a original expression vector purchased on adedge (number: # 69983). The specific mutation step is (underlined indicates the codon corresponding to arginine R):

forward primer: 5' -CTGAACGGCTGGGATCGGAATAGGGAGACAGACAAC-3’(SED ID NO.51)

Reverse primer: 5'-GTTGTCTGTCTCCTTATTCCGATCCCAGCCGTTCAG-3' (SED ID NO. 52)

And carrying out turn PCR on the pcDNA3.1-Lb2Cas12a by adopting the primer pair, recovering a PCR product after obtaining the PCR product, then carrying out enzyme digestion by using DpnI, directly converting DH5 alpha escherichia coli by the digested product, and obtaining pcDNA3.1-Lb2Cas12a (K518R) by sequencing and analyzing a colony-growing plasmid.

2. Construction of expression vector for LbCAs12a-K538R

(1) The prokaryotic expression vector of LbCAs12a-K538R is constructed on a pET28a vector by taking NcoI and XhoI as double enzyme cutting sites; the specific steps are (underlined as cleavage sites NcoI and XhoI):

forward primer: 5' -CATGCCATGGGCATGAGCAAGCTGGAGAAGTTTACAAACTG-3’(SED ID NO.53)

Reverse primer: 5' -CCGCTCGAGGTGCTTCACGCTGGTCTGGGCGTACTCCAG-3’(SED ID NO.54)

And (3) amplifying the eukaryotic expression vector pcDNA3.1-LbCAs12a (K538R) template by adopting the primer pair to obtain a PCR product, and carrying out enzyme digestion by using NcoI and XhoI after PCR purification and recovery, and recovering the PCR product again.

The pET28a vector is subjected to NcoI and XhoI double digestion, after glue recovery, linearized pET28a is subjected to enzyme ligation with the fragments recovered by the digestion, and pET28a-LbCAs12a (K538R) is obtained.

(2) Eukaryotic expression vectors are obtained by direct mutation on the basis of the LbCAs12a original expression vector purchased on adedge (number: # 69988). The specific mutation step is (underlined indicates the codon corresponding to arginine R):

forward primer: 5' -GGCGGCTGGGACAAGGATAGGGAGACAGACTATCGGGC-3’(SED ID NO.55)

Reverse primer: 5'-GCCCGATAGTCTGTCTCCTTATCCTTGTCCCAGCCGCC-3' (SED ID NO. 56)

And carrying out turn PCR on the pcDNA3.1-LbCAs12a by adopting the primer pair, recovering a PCR product after obtaining the PCR product, then carrying out enzyme digestion by using DpnI, directly converting DH5 alpha escherichia coli by the digested product, and obtaining pcDNA3.1-LbCAs12a (K538R) by sequencing and analyzing a bacterial colony extract plasmid.

3. Construction of an expression vector for AsCas12a-K548R

(1) The prokaryotic expression vector of AsCas12a-K548R is constructed on a pET28a vector by taking NcoI and XhoI as double enzyme cutting sites; the specific steps are (underlined as cleavage sites NcoI and XhoI):

forward primer: 5' -CATGCCATGGGCATGACACAGTTCGAGGGCTTTACCAACC-3’(SED ID NO.57)

Reverse primer: 5' -CCGCTCGAGGTTGCGCAGCTCCTGGATGTAGGCCAGCCAGTC-3’(SED ID NO.58)

And amplifying the template of the AsCas12a-K548R eukaryotic expression vector pcDNA3.1-AsCas12a (K548R) by using the primer pair to obtain a PCR product, and carrying out enzyme digestion by using NcoI and XhoI after PCR purification and recovery, and recovering the PCR product again.

The pET28a vector is subjected to NcoI and XhoI double digestion, after glue recovery, linearized pET28a is subjected to enzyme ligation with the fragment recovered by the digestion, and pET28a-AsCas12a (K548R).

(2) The eukaryotic expression vector is obtained by directly mutating the ASCas12a original expression vector purchased on the adedge (number: # 69982); the specific mutation step is (underlined indicates the codon corresponding to arginine R):

forward primer: 5' -CCTCTGGCTGGGACGTGAATAGGGAGAAGAACAATGGCGC-3’(SED ID NO.59)

Reverse primer: 5'-GCGCCATTGTTCTTCTCCCTATTCACGTCCCAGCCAGAGG-3' (SED ID NO. 60)

And carrying out turn PCR on the pcDNA3.1-AsCas12a by adopting the primer pair, recovering a PCR product after obtaining the PCR product, then carrying out enzyme digestion by using DpnI, directly converting DH5 alpha escherichia coli by the digested product, and obtaining pcDNA3.1-AsCas12a (K548R) by sequencing and analyzing a colony-growing plasmid.

Example 2 CRISPR/Cas12a gene editing systems and methods for Cas12a variants

1. Obtaining crRNA plasmid

In the embodiment of the invention, DNMT1, PD1, B2M, CTLA4 and CFTR 5 293T cell endogenous gene targets are selected;

the crRNA plasmid construction procedure for the above 5 targets was as follows:

the crRNA comprises a direct repeated sequence (the direct repeated sequences of AsCas12a, lbCAs12a and Lb2Cas12a are different) and a spacer sequence corresponding to a target point, the two sequences are connected, a pair of mutually complementary primers are synthesized by adding NotI and XbaI enzyme cutting sites, and double-stranded DNA is obtained by annealing; the pU6 vector was digested with NotI and XbaI, and then subjected to enzymatic ligation with the double-stranded DNA obtained by the annealing. The primer pairs involved are shown in Table 1.

TABLE 1

/>

/>

The sequences of crrnas corresponding to the 5 targets (wherein underlined indicates direct repeats) are shown in table 2, respectively;

TABLE 2

2. Method for gene editing of target gene in receptor

Introducing the recombinant expression vectors described in example 1 separately into a receptor provides a Cas12a variant;

introducing a crRNA plasmid targeting a target gene into a recipient to provide crRNA;

the Cas12a variant and the crRNA form a complex in the receptor that recognizes the gene of interest and completes editing.

Said editing is such that said target sequence or adjacent sequence thereof is base inserted and/or deleted;

the crRNA targeting target sequences are shown in table 3:

TABLE 3 Table 3

Target name	PAM	Guide sequence(5'to 3')
			DNMT1	TTTG	GCTCAGCAGGCACCTGCCTCAGC
PD1	TTTA	GCACGAAGCTCTCCGATGTGTTG
			B2M	TTTA	CTCACGTCATCCAGCAGAGAATG
CTLA4	TTTC	AGCGGCACAAGGCTCAGCTGAAC
			CFTR	TTTC	GTATAGAGTTGATTGGATTGAGA

Application example 1, measurement of Gene editing efficiency

We selected DNMT1, PD1, B2M, CTLA4, CFTR 5 293T cell endogenous gene targets, respectively and simultaneously transfected Cas12a and variants thereof and crRNA plasmid, and harvested cells for 48 hours, and carried out 3 times of repeated T7E1 experiments. Average editing efficiencies of Lb2Cas12a-K518R, lbCas12a-K538R, asCas12a-K548R and the corresponding wild type are shown in fig. 1.

As can be seen from fig. 1, lb2Cas12a-K518R, lbCas12a-K538R, asCas12a-K548R are comparable to the corresponding wild type efficiencies in gene editing.

Application example 2, determination of Gene identification

1. A mixture containing 256 PAM substrates was obtained,

the mixed substrate is prepared by randomly arranging 4 bases at the position of PAM (pulse width modulation) on pcDNA-EGFP (enhanced amplified nucleic acid-enhanced fluorescent protein) by a PCR (polymerase chain reaction) method, and mixing 256 different PAM substrates with the length of 150bp (total 256 times of PCR) by equal mass to form a PAM library. Wherein the PCR primer is as follows:

forward primer: 5'-TAGAGAACCCACTGCTTACTGGC-3'

Reverse primer: 5'-TGAACTTGTGGCCGNNNNCGTCGCCGTCCAGCTCGACC-3' (N is one of A, G, C, T, 256 kinds in total)

2. The library containing 256 PAM substrates was incubated with LbCas12a-crRNA, lb2Cas12a-crRNA, lbCas12a (K538R) -crRNA, lb2Cas12a (K518R) -crRNA for 0min,1min,2min,3min,4min,5min,6min,7min,8min,10min,15min,25min, the uncleaved residual substrate was amplified by PCR, and the principle was as shown in fig. 2.

Wherein 256 kinds of random PAM are 5'-NNNN-3', and 5 'to 3' are 4,3,2,1 nucleotides of PAM respectively. The cleavage products at each time point were analyzed and the results are shown in FIG. 3;

as can be seen from fig. 3, the darker the color, the stronger the cleavage ability, the different the substrate cleavage ability of LbCas12a, lb2Cas12a, lb-K538R, lbCas12a-K518R for 256 different PAMs. The larger the number of colored lattices, the more PAM can be recognized. Lb2Cas12a-K518R, lbCAs12a-K538R recognizes more tightly than the corresponding wild-type PAM in vitro. Wherein Lb2Cas12a-K518R changes from 5'-YYN-3' (y=t/C, n=a/T/C/G) to 5'-TYN-3' as compared to Lb2Cas12a PAM; compared with LbCAs12a, lbCAs12a-K538R hardly recognizes C-containing atypical PAM such as CTTV, TCTV, and TTCV (V=A/G/C).

Application example 3 in vivo off-target Effect determination

The fidelity of LbCAs12a and LbCAs12a-K538R, lb2Cas12a and Lb2Cas12a-K518R, asCas12a and AsCas12a-K548R in gene editing was explored at the whole genome level, and the off-target effect of Cas12a and its corresponding variants at the whole genome level was compared. Selecting HEK293 site 1,PRKCH,POLQ target 1,POLQ target 2,B2M 5 293T cell endogenous gene targets, analyzing the off-target effect of the whole genome level by adopting a GUIDE-seq method, wherein the GUIDE-seq is a sharp tool for evaluating the off-target effect, the principle of the GUIDE-seq is to mark CRISPR-Cas induced fragmentation by using a short double-stranded oligonucleotide tag, then carrying out high-throughput sequencing on a gene region where the tag is located, and finally determining the position and mutation efficiency of off-target mutation by using bioinformatics analysis. The occurrence frequency of a certain off-target mutation is as low as 0.1%, and can be detected by GUIDE-seq. The specific operation is as follows:

simultaneously transfecting pcDNA3.1-Cas12a plasmid, pU6-crRNA plasmid and GUIDE tag in 293T cells, wherein the GUIDE tag is a short double-stranded DNA with the sequence:

5′-P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T-3′

5′-P-A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C-3′

wherein P represents phosphorylation, and x represents phosphorothioate modification. Cells were collected for 48h, the genome was extracted, a DNA library was constructed, and the sequencing results were collated as shown in FIG. 4 and FIG. 5.

As can be seen in fig. 4 and 5, lb2Cas12a-K518R, lbCas12a-K538R, asCas12a-K548R have lower off-target effect on the whole genome compared to the corresponding wild type.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Finally, it is also noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Claims (10)

1. A Cas12a variant, wherein the Cas12a variant is LbCas12a-K538R and the amino acid sequence is as set forth in SED ID No. 2.

2. A recombinant expression vector expressing the Cas12a variant of claim 1.

3. The recombinant expression vector of claim 2, wherein the recombinant expression vector comprises one of a plasmid vector, a viral vector, and a phage vector.

4. A recombinant bacterium or recombinant cell line or recombinant virus comprising the recombinant expression vector of claim 2.

5. A recombinant virus obtained using the viral vector package of claim 3, comprising an adenovirus or lentivirus expressing the Cas12a variant of claim 1.

6. Use of the Cas12a variant of claim 1, the recombinant expression vector of any one of claims 2-3, the recombinant bacterium or recombinant cell line of claim 4, and the recombinant virus of claim 5 in gene editing.

7. A CRISPR/Cas12a gene editing system comprising the Cas12a variant of claim 1.

8. The CRISPR/Cas gene editing system according to claim 7, further comprising: crRNA or crDNA targeting the target gene.

9. A method of gene editing a gene of interest in a subject, the method comprising gene editing the gene of interest in the subject with a CRISPR/Cas12a system, the method comprising:

providing a Cas12a variant by introducing the recombinant expression vector of any one of claims 2-3 into a receptor;

providing crRNA by introducing a crRNA or crDNA plasmid targeting the target gene into the recipient;

the Cas12a variant and the crRNA form a complex in the receptor that recognizes the gene of interest and completes editing.

10. The method of claim 9, wherein the receptor comprises one of 293T cells, ATDC5 cells, and C6 cells.

Images