CN116041478A

CN116041478A - Preparation method of human recombinant thermostable protein FGF2 based on escherichia coli in-vitro purification system

Info

Publication number: CN116041478A
Application number: CN202211634153.2A
Authority: CN
Inventors: 鲜米洗努尔·阿布来提; 王爱芳; 苏杭
Original assignee: Taidong Zhenjiang Biotechnology Co ltd
Current assignee: Taidong Zhenjiang Biotechnology Co ltd
Priority date: 2022-12-19
Filing date: 2022-12-19
Publication date: 2023-05-02

Abstract

The invention discloses a preparation method of human recombinant thermostable protein FGF2 based on an escherichia coli in-vitro purification system, which comprises the steps of firstly constructing pET-32a-FGF2 expression plasmid, then performing PCR cloning to obtain pET-32a-FGF2 fragments, then performing double enzyme digestion of Ecor1 and Xhol1 on skeleton plasmid of pET-32a-FGF2, and performing spot-mutation operation to obtain five spot-mutation plasmids of pET-32a-FGF 2; according to the method, the five amino acid sites of FGF2 are changed to obtain the thermostable protein FGF2 without changing the biological activity of the FGF2, then the escherichia coli in-vitro purification system is utilized to obtain high-yield, soluble and thermostable MBP-FGF2, and then the MBP label is cut off to obtain the FGF2 protein.

Description

Preparation method of human recombinant thermostable protein FGF2 based on escherichia coli in-vitro purification system

Technical Field

The invention relates to the technical field of in-vitro synthesis of proteins, in particular to a preparation method of human recombinant thermostable protein FGF2 based on an escherichia coli in-vitro purification system.

Background

Basic fibroblast growth factor FGF2 (basic fibroblast growth factor, also known as FGF 2) is a member of the fibroblast growth factor family, and receptors for 24 FGF family members and four FGF cytokines are now known. Human FGF2 exerts a multidirectional regulatory effect on proliferation, differentiation, migration and survival in a variety of cell types and has been studied as a promising drug for the treatment of cardiovascular diseases, cancer and mood disorders. FGF2 is a globular protein consisting of a single polypeptide with a molecular weight of 18kDa (encoding 155 aa) containing four cysteine residues, and does not form intramolecular disulfide bonds. It has also been shown to be effective in ulcers, wounds and epithelial healing and is routinely used as an important component of human embryonic stem cell culture medium. FGF2 exhibits potent angiogenic effects both in vivo and in vitro, and has the effects of stimulating smooth muscle cell growth, wound healing and tissue regeneration. Wound healing effects have made FGF 2a potential therapeutic agent of commercial importance, FGF2 also playing an important role in the differentiation and function of the nervous system and in the regeneration of eyes and bones.

FGF2 has been purified from a variety of bovine organs and tissues, including adenomas, brain, hypothalamus, thymus, and kidneys; however, since the content is extremely low, it is almost impossible to obtain a large amount of FGF2 from animal tissues, and thus purifying a small amount of FGF2 is expensive; experiments show that FGF2 can be directly expressed in various strains, and about 110mg of protein can be produced in each liter of bacterial liquid, but after purification, the amount of the protein which can be obtained in each liter of bacterial liquid is about 20mg; the main reasons for its low yield are that FGF2 is expressed in the form of inclusion bodies in bacterial systems and is poorly stable and easily degradable, and because FGF2 is rapidly degraded at 37 ℃, many stem cell researchers have added high levels of FGF2 to the medium, requiring cumbersome frequent medium exchanges, and long-term maintenance of growth factors in tissues or medium is an ideal choice for protein therapy and stem cell culture, but is hindered by the low thermal stability and limited half-life of FGF2 molecules; therefore, there is a need to design a method for preparing human recombinant thermostable protein FGF2 based on an in vitro purification system of escherichia coli.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, and provides a preparation method of human recombinant thermostable protein FGF2 based on an escherichia coli in-vitro purification system, which can not only effectively improve the yield of FGF2, but also greatly avoid the degradation of FGF2 in the purification process, and the required low cost provides possibility for FGF2 to be used for treatment targets and a large number of applications, thus having quite great prospect in stem cell research, medicine and pharmaceutical application.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the preparation method of the human recombinant thermostable protein FGF2 based on an in vitro purification system of escherichia coli comprises the following steps,

constructing pET-32a-FGF2 expression plasmid, and performing PCR cloning to obtain pET-32a-FGF2 fragment;

step (B), performing double enzyme digestion of Ecor1 and Xhol1 on a skeleton plasmid of pET-32a-FGF2, and performing spot-mutation operation to obtain five spot-mutation plasmids of pET-32a-FGF 2;

step (C), obtaining a large amount of MBP-FGF2 proteins by using an escherichia coli in-vitro purification system from the plasmid with five projections of pET-32a-FGF 2;

step (D), utilizing a thrombin enzyme to cleave off MBP labels in partial MBP-FGF2 protein, and obtaining FGF2 protein;

and (E) respectively placing the MBP-FGF2 protein and the FGF2 protein in a 37 ℃ environment, and verifying the thermal stability and the structural stability of the MBP-FGF2 protein and the FGF2 protein in the 37 ℃ environment to finish the preparation operation of the human recombinant thermostable protein FGF2.

Preferably, step (A), construct pET-32a-FGF2 expression plasmid, then carry on PCR cloning to get pET-32a-FGF2 fragment, it is to construct pET-32a-FGF2 expression plasmid, then carry on PCR cloning to the expression plasmid, and PCR cloning of pET-32a-FGF2 adopts primer Ecor1-32a-FGF2-F and Xhol1-32a-FGF2-R, and use cDNA of human melanin epithelial cell RPE as template to carry on PCR, get pET-32a-FGF2 fragment, and run the glue and recycle;

preferably, in the step (B), the skeleton plasmid of pET-32a-FGF2 is subjected to double enzyme digestion of Ecor1 and Xhol1, and spot-mutation operation is carried out to obtain five spot-mutation plasmids of pET-32a-FGF2, specifically comprising the following steps of,

step (B1), carrying out double enzyme digestion on the backbone plasmid of pET-32a-FGF2 and Xhol1, carrying out gel running recovery, taking the pET-32a-FGF2 plasmid and the Ecor1-FGF2-Xhol1 fragment after double enzyme digestion of Ecor1 and Xhol1 for homologous recombination, then adding homologous recombinase into a reaction system, carrying out homologous recombination operation at 37 ℃, then adding DH5 alpha competent transformation into homologous recombination products, shaking LB culture medium uniformly at 37 ℃, carrying out plate coating by using a culture plate of Amp, picking, cloning and small shaking after the plate coating, and carrying out sequencing;

and (B2) carrying out shaking bacteria on clones which are correctly sequenced, carrying out small plasmid extraction, and carrying out point mutation operation, wherein the human recombinant thermostable protein FGF2 comprises five amino acid site mutations, specifically, five amino acid site mutations of glutamine into isoleucine, 78 amino acid site mutation of cysteine into serine, 96 amino acid site mutation of cysteine into serine, 111 amino acid site mutation of asparagine into glycine and 128 amino acid site mutation of lysine into asparagine, thereby obtaining five point mutation plasmids of pET-32a-FGF 2.

Preferably, in the step (C), the plasmid with five projections of pET-32a-FGF2 is utilized by an escherichia coli in-vitro purification system to obtain a large amount of MBP-FGF2 protein, and the specific steps are as follows,

converting pET-32a-FGF2 plasmid into escherichia coli expression strain BL21-DE3, shaking up LB culture medium at 37 ℃, plating by using a culture plate of Amp, then picking and cloning to LA culture medium, transferring to 2XYT culture medium after shaking up, adding IPTG for induction after shaking up, centrifuging bacterial liquid, removing supernatant, adding heavy suspension, performing ultrasonic separation on whole bacteria, supernatant and precipitation, performing gel-running test, and obtaining a small amount of MBP-FGF2 protein;

transferring the expression bacterial liquid to 2XYT, transferring to 2XYT, shaking, adding IPTG for induction, centrifuging to collect bacterial body, re-suspending the heavy suspension, crushing at high pressure, centrifuging to obtain supernatant, shaking and incubating nickel and protein in a centrifuge tube, vertically placing the centrifuge tube on ice, sucking out nickel onto a column after the nickel is sunk to the bottom, eluting protein sample through the column, and eluting with gradient imidazole solution sequentially to obtain a large amount of MBP-FGF2 proteins.

Preferably, step (D), the MBP tag in part of the MBP-FGF2 protein is excised by using a thrombin enzyme, and FGF2 protein is obtained, specifically as follows,

step (D1), incubating part of MBP-FGF2 protein with thrombin enzyme, and confirming gel running after enzyme digestion;

and (D2) passing the enzyme-cut MBP-FGF2 protein through a nickel column again, and eluting with a gradient imidazole solution to obtain MBP and FGF2 protein respectively.

Preferably, in the step (E), MBP-FGF2 protein and FGF2 protein are respectively placed in a 37 ℃ environment, and the thermal stability and the structural stability of the MBP-FGF2 protein and the FGF2 protein in the 37 ℃ environment are verified, so that the preparation operation of the human recombinant thermal stable protein FGF2 is completed, and the specific steps are as follows,

step (E1), verifying the thermal stability of MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, specifically comprising the following steps of,

step (E11), placing MBP-FGF2 protein in an environment of 37 ℃, sequentially taking out protein samples from gel running at equal interruption time, and analyzing the thermal stability and relative quantification of the protein at 37 ℃;

step (E12), placing FGF2 protein in an environment of 37 ℃, sequentially waiting for interruption time to collect protein sample gel running, and analyzing the thermal stability and relative quantification of the protein in the environment of 37 ℃;

step (E2), verifying the structural stability of MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, specifically comprising the following steps of,

step (E21), placing MBP-FGF2 protein in an environment of 37 ℃, sequentially taking protein samples at equal intervals, and analyzing the structural stability of the protein at 37 ℃ by using a circular dichroism chromatograph;

step (E22), the FGF2 protein is placed in an environment of 37 ℃, protein samples are sequentially collected at equal intervals, and a circular dichroism instrument is used for analyzing the structural stability of the protein at 37 ℃.

The beneficial effects of the invention are as follows: according to the preparation method of the human recombinant thermostable protein FGF2 based on the escherichia coli in-vitro purification system, firstly, the five amino acid sites of the FGF2 are changed to obtain the thermostable protein FGF2 without changing the biological activity of the thermostable protein FGF2, then, the escherichia coli in-vitro purification system is utilized to obtain high-yield, soluble and thermostable MBP-FGF2, and then, the FGF2 protein can be obtained by cutting off an MBP label.

Drawings

FIG. 1 is a sequence diagram showing the sequencing of pET-32a-FGF2 plasmid of the present invention;

FIG. 2 is a diagram of a protein dye of the invention for prokaryotic expression of MBP-FGF 2;

FIG. 3 is a diagram of purified MBP-FGF2 protein of the present invention;

FIG. 4 is a schematic representation of MBP tag cleavage of MBP-FGF2 protein by use of thrombin enzyme according to the present invention;

FIG. 5 is a schematic illustration of the MBP-FGF2 protein of the present invention after being digested with thrombin, re-column-packed with nickel and eluted with gradient imidazole;

FIG. 6 is a schematic representation of the stability of MBP-FGF2 of the present invention at 37 ℃;

FIG. 7 is a schematic representation of the quantification of MBP-FGF2 of the present invention at 37 ℃;

FIG. 8 is a schematic diagram of the stability of FGF2 of the present invention at 37 ℃;

FIG. 9 is a schematic diagram showing the structural stability of MBP-FGF2 at 37℃as determined by round dichroism of the present invention;

FIG. 10 is a schematic diagram showing the structural stability of FGF2 at 37℃as determined by circular dichroism.

Detailed Description

The invention will be further described with reference to the drawings.

The preparation method of the human recombinant thermostable protein FGF2 based on the in vitro purification system of the escherichia coli comprises the following steps,

constructing pET-32a-FGF2 expression plasmid, performing PCR cloning to obtain pET-32a-FGF2 fragment, specifically constructing pET-32a-FGF2 expression plasmid, performing PCR cloning on the expression plasmid, performing PCR cloning on pET-32a-FGF2 by adopting primers Ecor1-32a-FGF2-F and Xhol1-32a-FGF2-R, performing PCR by taking cDNA of human melanocyte RPE as a template to obtain pET-32a-FGF2 fragment, and performing gel running recovery;

wherein the sequences of the primers Ecor1-32a-FGF2-F and Xhol1-32a-FGF2-R are 5 'GTTCTGGATCCGAAATTCGACGacgaaggATGGCAGCCGGGAGCATCA3' and 5 'GGTGGTGGTGCTCGAGCTCGACCTTTAGCAGACATTGGAA 3', respectively;

step (B), performing double enzyme digestion of Ecor1 and Xhol1 on the skeleton plasmid of pET-32a-FGF2, performing spot-mutation operation to obtain five spot-mutation plasmids of pET-32a-FGF2, specifically comprising the following steps of,

Step (C), the plasmid with five points of the pET-32a-FGF2 is utilized by an escherichia coli in vitro purification system to obtain a large amount of MBP-FGF2 proteins, and the specific steps are as follows,

Step (D), cutting MBP label in partial MBP-FGF2 protein by utilizing thrombin enzyme, and obtaining FGF2 protein, specifically comprising the following steps of,

Step (E), respectively placing MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, verifying the thermal stability and protein structure stability of MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, completing the preparation operation of human recombinant thermostable protein FGF2, specifically comprising the following steps,

To better illustrate the utility of the present invention, a specific embodiment of the present invention is described below,

(1) The pET-32a-FGF2 expression plasmid is constructed, then PCR cloning is carried out on the expression plasmid, and the PCR cloning of the pET-32a-FGF2 adopts the primers Ecor1-32a-FGF2-F and Xhol1-32a-FGF2-R, and PCR is carried out by taking cDNA of human melanocyte RPE as a template, so as to obtain pET-32a-FGF2 fragments, wherein the reaction system and the reaction conditions are respectively shown in the table 1 and the table 2.

TABLE 1

TABLE 2

After obtaining fragments of FGF2, carrying out gel running recovery, carrying out Ecor1 and Xhol1 double digestion on backbone plasmids of pET-32a-FGF2, carrying out gel running recovery, taking pET-32a-FGF2 plasmids and Ecor1-FGF2-Xhol1 fragments after Ecor1 and Xhol1 double digestion, carrying out homologous recombination, adding 2ul of homologous recombinase into a 20ul reaction system, carrying out 30min of homologous recombination operation at 37 ℃, taking 10ul of homologous recombination products, adding DH5 alpha competent transformation, and carrying out shaking on LB culture medium for 60min at 37 ℃ under the transformation temperature and time of the competent transformation, coating plates by using culture plates of Amp, picking up clones, shaking slightly after 14 h, and carrying out sequencing.

The clone sequenced correctly was subjected to shaking and plasmid miniprep, and PCR was performed with pET-32a-FGF2 plasmid as template by using primers FGF2-K128N-F with sequence number 5'GTATGTGGCACTGAAcCGAACTGGGCAGTAT 3' and FGF2-K128N-R with sequence number 5'ATACTGCCCAGTTCGgTTCAGTGCCACATAC 3', wherein the reaction system and reaction conditions are shown in tables 3 and 4, respectively.

TABLE 3 Table 3

TABLE 4 Table 4

Obtaining PCR products, culturing 20ul+0.2ul of DMT enzyme in 37 ℃ environment for 1h, adding 10ul of the product into DH5 alpha competent transformation, wherein the transformation temperature and time of the competent transformation are 42 ℃ and 45s respectively, then placing the mixture into LB culture medium and shaking the mixture in 37 ℃ environment for 60min, plating the mixture on a culture plate of Amp, after 14 h, picking up clone, shaking the clone slightly, sequencing, and carrying out miniplasmid on clone with correct sequencing mutation sites to obtain pET-32a-FGF2 expression plasmid.

The same spot-wise method is used, and then primers FGF2-Q65I-F with the sequence number of 5 'ATCAAAGCTAACTTatcGCAGAAGAGAGAGGA 3', FGF2-Q65I-R with the sequence number of 5 'TCCTCTCTTCTGCgatAAGTTGTAGTGAGTATTGAT3', FGF2-C78S-F with the sequence number of 5'CTATCAAAGGAGTGTcTGCTAACCGTTACCT 3', FGF2-C78S-R with the sequence number of 5'AGGTAACGGTTAGCAgACACTCCTTTGATAG 3', FGF2-C96S-F with the sequence number of 5'TACTGGCTTCTAAATcTGTTACGGATGAGTG 3', FGF 3'FGF2-C96S-R with the sequence number of 5' CACTACTCGTACAGATTAAGAAGCCAGTA, FGF2-N111G-F with the sequence number of 5 'GAACGATTGGAATCTAATCTACTTACCGGTC 3' and FGF2-N111G-R with the sequence number of 5'GACCGGTAAGTATTGTAgccATTAGATTCCAATCGTTC 3' are used in sequence, so that plasmids of 562Q 65 and 3778G and S, C are obtained in sequence as described above; the sequencing result is shown in figure 1, and the plasmid is extracted from the clone with correct sequencing mutation site, and finally the plasmid with five points of pET-32a-FGF2 is obtained.

(2) The pET-32a-FGF2 plasmid is transformed into an escherichia coli expression strain BL21-DE3, the transformation temperature and time are 42 ℃ and 45 seconds respectively, LB culture medium is shaken for 60 minutes at 37 ℃, the culture plate of Amp is coated for 14 hours, then the culture plate is selected and cloned into LA culture medium, and the culture plate is stirred and mixed according to the following formula 1:100 was transferred to 3ml of 2XYT medium and after shaking up for 4h, 0.4mmol IPTG was added for induction at 16℃overnight.

Placing 1ml of bacterial liquid in a centrifuge, centrifuging at 12000rpm for 1min, removing supernatant, adding 100ul of heavy suspension, ultrasonically separating whole bacteria, supernatant and precipitate, adding loading to boil protein at 99deg.C, and sequentially running gel and dyeing; the pre-expression result is shown in figure 2, wherein MBP-FGF2 protein exists in the supernatant, 1 represents an expression bacterium without transferring plasmids, 2 represents an expression bacterium transferring 32a-MBP-FGF2, and 3 represents an expression bacterium transferring 32a-MBP-FGF2+0.4mmol IPTG; whole represents Whole bacteria, sup represents the supernatant of the bacteria, and pellet represents the pellet of the bacteria.

Transferring the expression bacterial liquid to 100ml of 2XYT culture medium, transferring to 1L of 2XYT after 4-5 hours, adding 0.4mmol IPTG at 16 ℃ after shaking for 4 hours in a 37 ℃ environment for overnight induction, then centrifuging for 15 minutes to collect 50ml of heavy suspension of the bacterial body for resuspension, crushing at high pressure for 620bar, centrifuging at 15000rpm for 30 minutes, taking supernatant, then incubating nickel and protein in a 50ml centrifuge tube for 3 hours after shaking at four degrees, vertically placing the centrifuge tube on ice, until the nickel is sunk to the bottom, sucking out the nickel to a column, eluting by the column, then passing 50ml of protein sample for two times, eluting by gradient imidazole solution, preparing sample, testing, washing with water and imaging in sequence; the purification results are shown in FIG. 3, and a large amount of MBP-FGF2 protein is obtained, wherein Whole represents the Whole bacteria, sup represents the supernatant of the bacteria, T represents the penetrating liquid of the nickel column, and 0, 50, 100, 200, 300 and 500 respectively correspond to the imidazole concentration under the number.

(3) Part of MBP-FGF2 protein was incubated with 4U/mg of thrombin enzyme at 4℃for 48h, and after cleavage, running the gel was confirmed, and the result was shown in FIG. 4, in which MBP-FGF2 was substantially cleaved into MBP and FGF2.

And (3) passing the digested MBP-FGF2 protein through a nickel column again, and eluting with a gradient imidazole solution to obtain MBP and FGF2 proteins respectively, as shown in figure 5.

(4) MBP-FGF2 protein was placed in an environment at 37 ℃ and 0h, 24h, 48h, 72h, 96h and 120h protein samples were collected in sequence for running and analyzed for thermal stability and relative quantification of the protein at 37 ℃ and the results show that MBP-FGF2 had a half-life of greater than 72h at 37 ℃ and fitted curve equation y=1.0001 e-0.001x and r2= 0.9408 as shown in fig. 6 and 7.

FGF2 protein was placed in an environment of 37 ℃ and samples of protein were taken up in sequence for running at 0h, 24h, 48h, 72h, 96h and 120h, and the thermal stability of the protein at 37 ℃ was analyzed, resulting in a half-life of FGF2 at 37 ℃ of greater than 72h as shown in fig. 8.

(5) MBP-FGF2 protein was placed in 37℃environment, 0h, 24h, 48h, 72h, and 96h protein samples were collected in order, and the structural stability of the protein at 37℃was analyzed by a round two chromatography apparatus, and as a result, as shown in FIG. 9, the structure of MBP-FGF2 protein was not changed after being placed at 37℃for 96 h.

FGF2 protein was placed in an environment of 37 ℃ to collect 0h and 72h protein samples in sequence, and the structural stability of the protein at 37 ℃ was analyzed by a round two chromatography instrument, and the result is shown in fig. 10, and after the FGF2 protein was placed at 37 ℃ for 72h, the structure of the FGF2 protein was not changed.

In summary, the preparation method of the human recombinant thermostable protein FGF2 based on the escherichia coli in-vitro purification system of the invention obtains the thermostable protein FGF2 without changing the biological activity of the thermostable protein FGF2 by changing five amino acid sites of the FGF2, then obtains high-yield, soluble and thermostable MBP-FGF2 by utilizing the escherichia coli in-vitro purification system, and obtains the FGF2 protein by cutting MBP labels.

The foregoing has outlined and described the basic principles, features, and advantages of the present invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims

1. The preparation method of the human recombinant thermostable protein FGF2 based on an escherichia coli in-vitro purification system is characterized by comprising the following steps of: comprises the steps of,

2. The method for preparing the human recombinant thermostable protein FGF2 based on an in vitro purification system of Escherichia coli according to claim 1, wherein: constructing pET-32a-FGF2 expression plasmid, performing PCR cloning to obtain pET-32a-FGF2 fragment, specifically constructing pET-32a-FGF2 expression plasmid, performing PCR cloning on the expression plasmid, performing PCR cloning on pET-32a-FGF2 by adopting primers Ecor1-32a-FGF2-F and Xhol1-32a-FGF2-R, performing PCR by taking cDNA of human melanocyte RPE as a template to obtain pET-32a-FGF2 fragment, and performing gel running recovery.

3. The method for preparing the human recombinant thermostable protein FGF2 based on an in vitro purification system of Escherichia coli according to claim 2, wherein: step (B), performing double enzyme digestion of Ecor1 and Xhol1 on the skeleton plasmid of pET-32a-FGF2, performing spot-mutation operation to obtain five spot-mutation plasmids of pET-32a-FGF2, specifically comprising the following steps of,

4. The method for preparing the human recombinant thermostable protein FGF2 based on the in vitro purification system of Escherichia coli according to claim 3, wherein: step (C), the plasmid with five points of the pET-32a-FGF2 is utilized by an escherichia coli in vitro purification system to obtain a large amount of MBP-FGF2 proteins, and the specific steps are as follows,

5. The method for preparing the human recombinant thermostable protein FGF2 based on the in vitro purification system of Escherichia coli according to claim 4, wherein: step (D), cutting MBP label in partial MBP-FGF2 protein by utilizing thrombin enzyme, and obtaining FGF2 protein, specifically comprising the following steps of,

6. The method for preparing the human recombinant thermostable protein FGF2 based on the in vitro purification system of Escherichia coli according to claim 5, wherein: step (E), respectively placing MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, verifying the thermal stability and protein structure stability of MBP-FGF2 protein and FGF2 protein in 37 ℃ environment, completing the preparation operation of human recombinant thermostable protein FGF2, specifically comprising the following steps,