CN116035999A

CN116035999A - Exosome composition, application and preparation method thereof

Info

Publication number: CN116035999A
Application number: CN202310123121.4A
Authority: CN
Inventors: 董康梅; 叶国栋; 陈茂立; 韩大雄; 许剑雄; 李强; 杨燕燕; 张志荣
Original assignee: Aisisong Yangzhou Biotechnology Co ltd; Xiamen Lifeint Technology Co ltd
Current assignee: Aisisong Yangzhou Biotechnology Co ltd; Xiamen Lifeint Technology Co ltd
Priority date: 2023-02-16
Filing date: 2023-02-16
Publication date: 2023-05-02

Abstract

The application relates to the technical field of exosomes, and particularly discloses an exosome composition, application and a preparation method thereof. The exosome composition comprises at least one of lemon exosome, ginseng exosome and ginger exosome, wherein the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are respectively and independently 4-20 mug/mL. The exosome composition has a good whitening and repairing function.

Description

Exosome composition, application and preparation method thereof

Technical Field

The application relates to the technical field of exosomes, and more particularly relates to an exosome composition, application and a preparation method thereof.

Background

Exosomes refer to small vesicles (30-150 nm) containing complex RNAs and proteins, which nowadays are specifically disc-shaped vesicles with diameters of 40-100 nm. Exosomes were first found in sheep reticulocytes in 1983, and Johnstone named "exosomes" in 1987. A variety of cells secrete exosomes under normal and pathological conditions. Mainly derived from the multivesicular body formed by the invagination of the lysosome particles in cells, and released into extracellular matrix after being fused with cell membranes through the outer membrane of the multivesicular body.

Exosomes (Exosomes) are multi-vesicles produced in cells, which are membranous vesicles secreted by living cells and have a diameter of about 30-150nm, a density of 1.13-1.19g/mL, and a typical "cupped" morphology. Almost all types of cells in humans produce exosomes, nearly 1000-10000 per human cell on average. Typically 1X 10 is present in 1mL of blood ¹² And (3) the exosomes. Exosomes are heterogeneous, and even exosomes secreted by the same cell may have a great functional difference. Exosomes are present in almost all tissues, cell spaces, body fluids, including blood, saliva, urine and breast milk. The exosomes carry proteins, miRNA, lncRNA, circRNA, mRNA and degradation fragments thereof involved in intracellular signal transduction, involved in important regulation of cellular activity; the composition is a brand-new corner in the treatment of tumor metastasis, immune regulation mechanism, disease occurrence and development, alzheimer's disease, immune diseases and other difficult and complicated diseases, and is expected to become a plurality of diseasesEarly diagnostic markers for disease.

The exosomes have a wide variety of functions. The function of the exosome depends on the cell type from which the exosome is derived, and the exosome can participate in aspects such as immune response of an organism, antigen presentation, cell differentiation, tumor invasion resistance and the like. Such as by enhancing antigen presentation or directly activating immune cells. Exosomes carry specific biological substances associated with their source cells, which not only reflect the source cell type, but are also closely related to the physiological function or pathological changes of the source cells. This means that by detection of specific exosomes we can learn about specific physiological or pathological conditions in the body.

The most representative exosomes in detection applications are undoubtedly early diagnosis of tumors and monitoring of disease. Part of liquid biopsy techniques are targeted by exosomes. A large number of researches show that the exosomes derived from tumor cells contain a large number of specific miRNAs, have stable biochemical performance and are easy to store, and can be used as markers for early diagnosis of tumors such as pancreatic cancer, colorectal cancer and the like.

Exosomes are also of great significance in the therapeutic field, scientists have found that the effect of exosomes on tumor growth can be reflected in the aspects of anti-tumor immunity, immune function inhibition and tumor immune escape, and they can influence the development of tumors by promoting tumor cell development, invasion and metastasis, promoting tumor angiogenesis and tumor immune regulation, and even can enhance tumor resistance. Therefore, we can develop corresponding therapies for their specific functions. For example, exosomes derived from tumor cells typically contain some tumor antigens that can activate antigen presenting cells, so exosomes can be used for the development of tumor vaccines, and some studies have found that such tumor vaccines have good feasibility and safety.

Besides diagnosis and treatment of cancer, the exosomes have other physiological functions, such as promoting the coagulation process, enhancing the endothelial cell connection function, inducing NK cell activation and the like, so the potential application range is very wide. Because exosomes can be loaded with drugs, the effect of treating the disease is achieved by uptake by specific target organs. Studies have shown that exosomes can carry curcumin across the blood brain barrier to treat ischemic reperfusion brain injury, improving prognosis. It is known that many drugs cannot cross the blood brain barrier and that the use of exosomes as carriers is an attempted method for drug molecules of small diameter.

Scientific researches show that the exosome has great repairing effect on skin, and has remarkable effects in inhibiting skin inflammation, inhibiting apoptosis and necrosis, repairing scars, promoting cell regeneration, activating cells, promoting cell repair, promoting regeneration of elastic fibers and collagen, promoting blood vessel growth, weakening red blood filaments and the like. The exosome has multiple effects of moisturizing, tightening skin, improving skin elasticity, resisting aging, removing wrinkles, resisting oxidation, brightening, whitening, removing speckle, repairing barrier, resisting allergy, relieving allergy, inhibiting inflammation, removing acne, removing scar, removing red blood streak, etc.

The prior related technology utilizes the combination of mesenchymal stem cell exosomes, PDRN and human serum albumin to improve the stability of exosomes and the effects of cell repair, whitening and the like; or combining mesenchymal stem cell exosomes with plant extracts to improve skin quality or whiten skin repair; or the stem cell exosome and the recombinant collagen and sodium hyaluronate are used together to prepare the anti-aging whitening skin care product.

As described above, many studies have been conducted on stem cell exosomes in the related art to achieve the whitening and repairing functions, but few studies have been conducted on plant exosomes. Thus, there is a need to provide a variety of exocrine related research protocols in terms of whitening repair function.

Disclosure of Invention

In order to solve the technical problems, the application provides an exosome composition, application and a preparation method thereof.

In a first aspect, the present application provides an exosome composition, which adopts the following technical scheme:

an exosome composition comprising at least one of lemon exosome, ginseng exosome and ginger exosome, wherein the concentrations of the lemon exosome, ginseng exosome and ginger exosome are 5-20 μg/mL, respectively.

By adopting the technical scheme, the plant exosomes, namely the lemon exosomes, the ginseng exosomes and/or the ginger exosomes with the concentration of 5-20 mug/mL are selected, so that the obtained exosome composition has a whitening and repairing function, and experiments prove that the exosome composition also has the whitening and repairing function on an animal model.

Each of the lemon exosomes, the ginseng exosomes, and/or the ginger exosomes has a concentration of 5-20 μg/mL, e.g., each alone may be 4 μg/mL, 4.5 μg/mL, 5 μg/mL, 5.5 μg/mL, 6 μg/mL, 6.5 μg/mL, 7 μg/mL, 7.5 μg/mL, 8 μg/mL, 8.5 μg/mL, 9 μg/mL, 9.5 μg/mL, 10 μg/mL, 11 μg/mL, 11.5 μg/mL, 12 μg/mL, 12.5 μg/mL, 13 μg/mL, 13.5 μg/mL, 14 μg/mL, 14.5 μg/mL, 15 μg/mL, 15.5 μg/mL, 16 μg/mL, 16.5 μg/mL, 17 μg/mL, 17.5 μg/mL, 18 μg/mL, 18.5 μg/mL, 19 μg/mL, 19.5 μg/mL, or any one of which may be present.

Preferably, the concentrations of the lemon exosomes, the ginseng exosomes and the ginger exosomes are 5-10 μg/mL respectively and independently.

By adopting the above technical scheme, the respective concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are 5-10 mug/mL, for example, each of the respective concentrations may be any one of 5 mug/mL, 5.5 mug/mL, 6 mug/mL, 6.5 mug/mL, 7 mug/mL, 7.5 mug/mL, 8 mug/mL, 8.5 mug/mL, 9 mug/mL, 9.5 mug/mL, 10 mug/mL.

Preferably, the concentration of the lemon exosomes is 8-12 mug/mL, and the concentrations of the ginseng exosomes and the ginger exosomes are respectively 4-6 mug/mL.

Preferably, the concentration of the lemon exosomes is 10 μg/mL, and the concentrations of the ginseng exosomes and the ginger exosomes are 5 μg/mL respectively and independently.

By adopting the technical scheme, as a preferable scheme, the concentration of the lemon exosomes is 8-12 mug/mL, and the concentrations of the ginseng exosomes and the ginger exosomes are respectively and independently 4-6 mug/mL. More preferably, the concentration of lemon exosomes is selected to be 10 μg/mL, and the concentrations of ginseng exosomes and ginger exosomes are both 5 μg/mL.

Preferably, the exosome composition comprises lemon exosomes, ginseng exosomes and ginger exosomes.

By adopting the technical scheme, the exosome composition can be a mixture comprising lemon exosome, ginseng exosome and ginger exosome simultaneously.

In a second aspect, the application provides an application of the exosome composition in a whitening repair preparation, which adopts the following technical scheme:

an application of the exosome composition in whitening and repairing preparation is provided.

In a third aspect, the present application provides a method for preparing an exosome composition, which adopts the following technical scheme:

the preparation method of the exosome composition comprises the step of mixing at least one of lemon exosome, ginseng exosome and ginger exosome to obtain the exosome composition.

By adopting the technical scheme, the exosome composition can be prepared and obtained, and the process is simple and convenient to implement.

In summary, the present application has the following beneficial effects:

1. the application adopts at least one exosome of lemon exosome, ginseng exosome and ginger exosome, and the obtained exosome composition has the whitening and repairing functions.

2. In the application, the exosome composition comprising the lemon exosome, the ginseng exosome and the ginger exosome is preferably adopted, so that a good whitening and repairing function is obtained.

Drawings

FIG. 1 is an electron microscopic view of ginseng exosomes obtained in the preparation examples of the present application;

FIG. 2 is an electron microscope image of cucumber exosomes obtained in the preparation examples of the present application;

FIG. 3 is an electron microscope image of lemon exosomes obtained in the preparation examples of the present application;

FIG. 4 is an electron microscope image of the ginger exosomes obtained in the preparation examples of the present application;

FIG. 5 is an electron microscope image of the seaweed exosomes obtained in the preparation examples of the present application;

FIGS. 6a, 6b, and 6c are electron microscope images showing growth conditions of cell basal cultures of three cells A375, hacat, and HSF in sequence in the examples of the present application;

FIGS. 7a, 7b are graphs of HSF cell viability assay data in examples of the present application;

FIGS. 8a, 8b are graphs of hacat cell viability assay data in embodiments of the present application;

FIG. 9a is a cell map reflecting HSF cell growth after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 9b is a cell map reflecting hacat cell growth after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 9c is a cell map reflecting HSF and hacat cell growth after treatment of seaweed exosomes in the examples of this application;

FIG. 10a is a graph showing the response of HSF apoptosis after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 10b is a graph showing the detection of hacat apoptosis after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 10c is a graph showing the detection of apoptosis of HSF and hacat cells after treatment of seaweed exosomes in the examples of this application;

FIG. 11a is a graph of early apoptosis statistical analysis of HSF after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of this application;

FIG. 11b is a graph of early apoptosis statistical analysis of HSF after seaweed exosomes treatment in the examples of this application;

FIG. 12a is a graph of statistical analysis of late apoptosis of HSF after exosome treatment in examples of the present application;

FIG. 12b is a graph of statistical analysis of late apoptosis of HSF after treatment of seaweed exosomes in the examples of this application;

FIG. 13a is a graph of statistical analysis of HSF total apoptosis after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 13b is a graph showing statistical analysis of HSF total apoptosis after seaweed exosomes treatment in the examples of this application;

FIG. 14a is a graph of early apoptosis statistical analysis of hacat after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 14b is a graph of early apoptosis statistical analysis of hacat after trefoil exosome treatment in the examples of the present application;

FIG. 15a is a graph of statistical analysis of late apoptosis of hacat after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 15b is a graph of statistical analysis of late apoptosis of hacat after treatment of seaweed exosomes in the examples of this application;

FIG. 16a is a graph of statistical analysis of total apoptosis of hacat after exosomes of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 16b is a graph of statistical analysis of hacat total apoptosis after seaweed exosomes treatment in the examples of this application;

FIG. 17 is a cell map of the change in HSF cell migration ability after treatment of lemon, ginseng, ginger, cucumber, seaweed exosomes in examples of this application;

FIG. 18 is a graph of the results of statistical analyses reflecting changes in HSF cell migration ability after treatment of lemon, ginseng, ginger, cucumber, seaweed exosomes in the examples of this application;

FIG. 19a is a graph reflecting the qPCR detection of IL-1β mRNA expression levels of HSF cells after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 19b is a graph reflecting the qPCR detection of IL-1β mRNA expression levels of HSF cells after treatment of seaweed exosomes in the examples of this application;

FIG. 20a is a graph reflecting the qPCR detection of TNF- α mRNA expression levels of HSF cells after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 20b is a graph reflecting the qPCR detection of TNF-. Alpha.mRNA expression levels of HSF cells after treatment of seaweed exosomes in the examples of this application;

FIG. 21a is a graph reflecting the qPCR detection of IL-18mRNA expression levels of HSF cells after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 21b is a graph reflecting the qPCR detection of IL-18mRNA expression levels of HSF cells after treatment of seaweed exosomes in the examples of this application;

FIG. 22a is a graph showing the detection of IL-1β mRNA expression levels by hacat cell qPCR after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 22b is a graph reflecting the detection of IL-1β mRNA expression levels by hacat cell qPCR after treatment of seaweed exosomes in the examples of this application;

FIG. 23a is a graph showing the detection of TNF- α mRNA expression levels by hacat cell qPCR after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 23b is a graph reflecting the detection of TNF- α mRNA expression levels by hacat cell qPCR after treatment of seaweed exosomes in the examples of this application;

FIG. 24a is a graph showing the detection of IL-18mRNA expression levels by hacat cell qPCR after treatment of lemon, ginseng, ginger, cucumber exosomes in the examples of the present application;

FIG. 24b is a graph reflecting the detection of IL-18mRNA expression levels by hacat cell qPCR after treatment of seaweed exosomes in the examples of this application;

FIG. 25a is a graph showing the viability of A375 cells after exosomes of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 25b is a graph showing the viability of A375 cells after treatment of seaweed exosomes in the examples of this application;

FIG. 26 is a cell map reflecting growth of A375 cells after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 27 is a graph showing the results of melanin content detection after exosome treatment of lemon, ginseng, ginger, cucumber in the examples of the present application;

FIG. 28 is a graph showing the results of tyrosinase assays after exosomes of lemon, ginseng, ginger, cucumber in the examples of the present application;

fig. 29 is an electron microscope of the group of green or red eggs with no exosomes added in the examples of the present application;

fig. 30 is an electron microscope image of a green clarion egg group to which lemon, ginseng and ginger exosomes are added in the examples of the present application.

Detailed Description

The present application is described in further detail below with reference to the drawings and examples.

Description of raw materials

The lemon exosomes, the ginseng exosomes and the ginger exosomes are all derived from commercial sources, or the exosomes with required concentration are obtained by extracting and separating commercial crude extracts.

Preparation example

Preparation example 1

The lemon exosomes, the ginseng exosomes and the ginger exosomes of the preparation example, and the cucumber exosomes and the seaweed exosomes involved in the following examples (performance detection tests) are all derived from commercial crude extracts and obtained by extracting them by a PEG precipitation method, and simultaneously the extracted exosomes are subjected to electron microscopy, particle size and BCA detection. The specific process is as follows:

1. sample case

1 sample of lemon exosome, ginseng exosome, ginger exosome, cucumber exosome and seaweed exosome were taken, and 5 samples were all derived from commercial crude extracts, see specifically table 1 below.

TABLE 1

/>

2. Main reagent and instrument

The main reagents and instruments are shown in Table 2.

TABLE 2

Name of the name	Branding	Goods number
			PBS	Sangon Biotech	E607008
0.45 μm filtration membrane	Millipore	R6BA09493
			Liquid transfer device	Eppendorf	Research Plus
Small-sized refrigerated centrifuge	Beckman	Microfuge 20R
			Ultralow temperature refrigerator	Thermo	905
Ultracentrifuge	Hitachi	CP100MX
			Transmission electron microscope	Hitachi	HT-7700
Particle size analyzer	NanoFCM	N30E
			Multifunctional enzyme labeling instrument	Thermo	Varioskan LUX

3. Experimental method

3.1PEG precipitation method for extracting exosomes mainly comprises the following steps:

s1: melting the sample at 37 ℃ at medium speed;

s2: the sample is moved into a new centrifuge tube, 2000 Xg, 4 ℃ and centrifuged for 30min;

s3: carefully transferring the supernatant to a new centrifuge tube, centrifuging again at 10000 Xg and 4 ℃ for 45min to remove larger vesicles;

s4: filtering the supernatant with 0.45 μm filter membrane, and collecting filtrate;

s5: the same volume of supernatant and PEG6000 solution were mixed and left overnight at 4 ℃.

S6:10000 Xg, centrifuging at 4deg.C for 60min, removing supernatant, re-suspending precipitate with 3mL pre-cooled PBS, and dialyzing overnight;

s7: transferring the dialyzed resuspension to an EP tube, centrifuging at 10000 Xg at 4 ℃ for 60min, removing supernatant, pre-cooling PBS, resuspension and precipitation, taking 20 mu L of electron microscope, 10 mu L of particle size, 10 mu L of protein extraction, and preserving the residual exosomes at-80 ℃.

3.2 the main steps of the transmission electron microscope observation of the exosome sample are as follows:

s1: taking out 10 mu L of exosomes;

s2: 10 mu L of the sample is sucked and dripped on a copper net to be deposited for 1min, and floating liquid is sucked by filter paper;

s3: dripping 10 mu L of uranyl acetate on a copper net to precipitate for 1min, and sucking floating liquid by filter paper;

s4: drying for several minutes at normal temperature;

s5: performing electron microscope detection imaging at 100 kv;

s6: and obtaining a transmission electron microscope imaging result.

3.3 the main steps of particle size analysis of exosome samples are as follows:

s1: the exosomes were withdrawn 10 μl diluted to 30 μl;

s2: firstly, performing instrument performance test by using a standard substance, and then loading an exosome sample, wherein the sample is required to be subjected to gradient dilution to avoid the sample blocking a sample injection needle;

s3: and obtaining the information of the particle size and concentration of the exosomes detected by the instrument after the sample is detected.

3.4 extraction of exosome sample protein and concentration determination mainly comprises the following steps:

s1: melting exosomes at 37 ℃ at medium speed, and rapidly adding 5 x RIPA lysate;

s2: after being evenly mixed, the mixture is cracked on ice for 30min, and evenly mixed during the period;

s3: preparing a standard sample for measuring protein concentration by a BCA method, adding 5 mu L of the sample into the BCA mixed solution, and uniformly mixing;

s4: incubation is carried out for 30min at 37 ℃, and the absorbance value is detected and recorded at OD562nm on an enzyme label instrument;

s5: and calculating the protein concentration of the sample to be detected according to the standard curve.

4. Experimental results of preparation examples

4.1 exosome electron microscopy images: the obtained electron microscope images of the ginseng exosomes, the cucumber exosomes, the lemon exosomes, the ginger exosomes and the seaweed exosomes are sequentially shown in fig. 1-5.

Examples

Example 1

The exosome composition of this example includes lemon exosomes at a concentration of 4 μg/mL.

Example 2

The exosome composition of this example comprises lemon exosomes at a concentration of 5 μg/mL.

Example 3

The exosome composition of this example comprises lemon exosomes at a concentration of 10 μg/mL.

Example 4

The exosome composition of this example comprises lemon exosomes at a concentration of 20 μg/mL.

Example 5

The exosome composition of this example includes lemon exosomes at a concentration of 9 μg/mL.

Example 6

The exosome composition of this example comprises ginseng exosomes at a concentration of 4 μg/mL.

Example 7

The exosome composition of this example comprises ginseng exosomes having a concentration of 5 μg/mL.

Example 8

The exosome composition of this example comprises ginseng exosomes having a concentration of 6 μg/mL.

Example 9

The exosome composition of this example comprises ginseng exosomes having a concentration of 10 μg/mL.

Example 10

The exosome composition of this example comprises ginseng exosomes at a concentration of 20 μg/mL. Example 11

The exosome composition of this example comprises ginger exosomes at a concentration of 4 μg/mL.

Example 12

The exosome composition of this example comprises ginger exosomes at a concentration of 5 μg/mL.

Example 13

The exosome composition of this example comprises ginger exosomes at a concentration of 6 μg/mL.

Example 14

The exosome composition of this example comprises ginger exosomes at a concentration of 10 μg/mL.

Example 15

The exosome composition of this example comprises ginger exosomes at a concentration of 20 μg/mL.

Example 16

The exosome composition of this example includes lemon exosome and ginseng exosome, each at a concentration of 4 μg/mL alone.

Example 17

The exosome composition of this example includes lemon exosome and ginseng exosome, each having a concentration of 5 μg/mL alone.

Example 18

The exosome composition of this example includes lemon exosome and ginseng exosome, each having a concentration of 6 μg/mL alone.

Example 19

The exosome composition of this example includes lemon exosome and ginseng exosome, each having a concentration of 10 μg/mL alone.

Example 20

The exosome composition of this example includes lemon exosome and ginseng exosome, each having a concentration of 20 μg/mL alone.

Example 21

The exosome composition of this example includes lemon exosome and ginseng exosome, the concentrations of which are respectively 10 μg/mL and 5 μg/mL in sequence.

Example 22

The exosome composition of this embodiment comprises lemon exosome and ginger exosome, wherein the concentrations of the lemon exosome and the ginger exosome are respectively 4-20 μg/mL.

Example 23

The exosome composition of this example comprises lemon exosome and ginger exosome, wherein the concentrations of the lemon exosome and the ginger exosome are respectively 4 μg/mL.

Example 24

The exosome composition of this example comprises lemon exosome and ginger exosome, wherein the concentrations of the lemon exosome and the ginger exosome are 5 μg/mL separately.

Example 25

The exosome composition of this example comprises lemon exosome and ginger exosome, wherein the concentrations of the lemon exosome and the ginger exosome are respectively 10 μg/mL.

Example 26

The exosome composition of this example comprises lemon exosome and ginger exosome, wherein the concentrations of the lemon exosome and the ginger exosome are 20 μg/mL separately.

Example 27

The exosome composition of this embodiment includes lemon exosome and ginger exosome, the concentration of which is respectively 10 μg/mL and 5 μg/mL in turn.

Example 28

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 4 μg/mL separately.

Example 29

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 5 μg/mL separately.

Example 30

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 6 μg/mL separately.

Example 31

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 10 μg/mL separately.

Example 32

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 20 μg/mL separately.

Example 33

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 4 μg/mL and 5 μg/mL, respectively, in sequence.

Example 34

The exosome composition of this example comprises ginseng exosomes and ginger exosomes, the concentrations of which are 5 μg/mL and 6 μg/mL, respectively, in sequence.

Example 35

The exosome composition of this embodiment includes lemon exosome, ginseng exosome and ginger exosome, where the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are respectively 4 μg/mL separately.

Example 36

The exosome composition of this embodiment includes lemon exosome, ginseng exosome and ginger exosome, where the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are 5 μg/mL separately.

Example 37

The exosome composition of this embodiment includes lemon exosome, ginseng exosome and ginger exosome, where the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are respectively 10 μg/mL separately.

Example 38

The exosome composition of this embodiment includes lemon exosome, ginseng exosome and ginger exosome, where the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are 20 μg/mL separately.

Example 39

The exosome composition of this example comprises lemon exosome, ginseng exosome and ginger exosome, wherein the concentration of the lemon exosome is 10 μg/mL, and the concentrations of the ginseng exosome and the ginger exosome are 5 μg/mL respectively and independently.

Performance test

1. Materials and instruments

1.1 sample case

The samples are: HSF (human skin fibroblasts), hacat (human immortalized epidermal cells), a375 (human melanoma).

1.2 major reagents and instruments

The main reagents and instruments are shown in table 3 below.

TABLE 3 Table 3

/>

1.3 preparation of the Main Agents

The components and the concentrations of the RIPA lysate adopted are as follows:

comprises Tris 50mM, naCl 150mM, triton X-100.1%, sodium deoxycholate 0.1% -1%, and SDS 0.1%; and adjusting pH to 7.5,4 deg.C for preservation, and adding protease inhibitor before use.

2. Experimental method

2.1 cell basal culture:

HSF (human skin fibroblast), hacat (human immortalized epidermal cell), A375 (human melanoma) in complete culture medium containing 1% diab and 10% fetal bovine serum (HSF uses 1640 medium, hacat and A375 use DMEM medium), 37℃and 5% CO ₂ The culture was maintained at saturated humidity and conventional passaging was performed at a cell density of about 80-90%.

2.2CCK8 method to detect cell viability (exosome intervention 1):

HSF and hacat cells were plated in 5000 plates per well in 96-well plates, 400. Mu. M H after cell attachment ₂ O ₂ The treatment is carried out for 4min to carry out oxidation injury. After oxidative damage, the old medium was discarded and the cells were treated with complete medium with or without exosomes at working concentrations of 5, 10, 20 μg/mL, respectively, for 48 h. Cells treated by oxidative damage are taken as model groups and are not normally locatedThe cells were used as controls. After 48h, CCK8 reagent was added for cell viability assay, and OD450 values were read within 2h.

2.3 exosome intervention 2:

after determination of the exosome use concentration according to 2.2, HSF, hacat cells were used according to 3X 10 ⁵ Plates were plated at 6cm plate 62.5. Mu. M H after cell attachment ₂ O ₂ The treatment is carried out for 4min to carry out oxidation injury. After oxidative damage, the old medium is discarded, cells are treated with complete medium with or without exosomes for 48 hours, cells treated with oxidative damage are used as model group, normal untreated cells are used as control, and after 48 hours of treatment, the cell function change is detected.

2.4 flow double-staining detection of apoptosis

The specific steps of flow type double-dyeing detection of apoptosis are as follows:

s1: before use, all reagents in the kit are transiently dissociated;

s2: preparing a 4×binding buffer in the kit into a 1×binding buffer by using sterile water;

s3: cells were subjected to pancreatin digestion, centrifuged at 1200rpm/min for 5min to collect cells, and washed 2 times with 1 XPBS;

s4: 195. Mu.L of 1×binding buffer suspension cells per tube (cell density 2×10) ⁵ -5×10 ⁵ cell/mL)；

S5: 5 mu L of Annexin V-FITC is added into each tube, and the tubes are incubated for 10 to 15 minutes at the temperature of 4 ℃ in a dark place;

s6: adding 200 mu L of 1 Xbinding buffer to wash cells, centrifuging at 1200rpm/min for 5min, and removing the supernatant;

s7: 190. Mu.L of 1 Xbinding buffer suspension cells were used per tube;

s8: after adding 10 mu L of PI into each tube, mixing uniformly, and loading the mixture into a machine for detection as soon as possible.

2.5Transwell method for detecting cell migration Capacity

The specific steps for detecting the migration capacity of cells by the Transwell method are as follows:

s1: digesting HSF and hacat cells, washing with serum-free culture medium for 3 times, counting, and preparing into 1×10 ⁵ Cell suspension per mL;

s2: cell pellet was collected by centrifugation, 62.5μM H ₂ O ₂ Oxidative damage was performed for 4min (1200 rpm immediately after cell resuspension, centrifugation for 4 min); the supernatant was discarded, and the cell pellet was resuspended in serum-free complete medium to prepare 1X 10 cells ⁵ mu.L of cell suspension was added to each well of the upper chamber per mL of cell suspension;

s3: 500 mu L of culture medium containing 20% serum and exosomes with corresponding concentrations are added into the lower chamber;

s4: culturing for 48h in a37 ℃ incubator, and detecting the number of cells passing through: the cells on the cell filters were removed from the cells with a cotton swab. After PBS washing, placing the cell in 4% poly-methanol for fixing for 20min, discarding the fixing solution, incubating for 30min with 1% crystal violet ethanol solution for dyeing, after 1×PBS washing, inverting to take a photograph under a common microscope at random;

s5: and (5) carrying out result statistical analysis.

2.6RT-qPCR detection of RNA expression level

The cells were collected, RNA extracted, reverse transcribed and qRT tested, as follows:

wherein, the RNA extraction comprises the following steps:

s1: adding 0.5mL of Tripure lysate into the cells, and blowing and sucking the cells for several times by using a gun head to completely lyse the cells;

s2: adding 0.1mL of chloroform, shaking vigorously for 15s, and standing at room temperature for 3min;

s3: centrifuge at 12000 Xg for 15min at 4 ℃. The samples were divided into three layers: the bottom layer is a yellow organic phase, and the upper layer is a colorless aqueous phase and an intermediate layer. RNA is mainly in the water phase, and the volume of the water phase is about 60% of that of the Tripure reagent used;

s4: transferring the aqueous phase to a new tube, precipitating RNA in the aqueous phase with isopropanol, adding 0.5mL of isopropanol per 1mL of Tripure, and standing at room temperature for 10min;

s5: centrifuging at 12000 Xg for 10min at 4deg.C, and removing supernatant after centrifuging to obtain colloidal precipitate on the side and bottom of the tube;

s6: the RNA pellet was washed with 75% ethanol. At least 1mL of 75% ethanol was added per 1mL of Tripure used. Centrifuging at 4deg.C of 7500 Xg for 5min, and discarding supernatant;

s7: after leaving to dry at room temperature, 50. Mu.L of DEPC water was added and stored at-80 ℃.

Wherein the reverse transcription comprises the steps of:

RNA template, primer Mix, dNTP Mix, DTT, RT Buffer, hiFiScript and RNase-Free Water were dissolved and placed on ice for use. The reaction system was formulated according to the following table in a total volume of 20. Mu.L.

The reagent and the final concentration are specifically as follows:

dNTP Mix，2.5mM Each：4μL，500μM Each；

*Primer Mix：2μL；

RNA Template：7μL，1μg；

5×RT Buffer：4μL，1×；

DTT，0.1M：2μL，10mM；

HiFiScript，200U/μL：1μL；

RNase-Free Water：up to 20μL。

vortex vibration mixing, short centrifugation, and collecting the solution on the pipe wall to the bottom of the pipe. Incubation was performed at 42℃for 50min and at 85℃for 5min. After the reaction was completed, the mixture was centrifuged briefly and cooled on ice. The reverse transcription product can be directly used for PCR reaction and fluorescent quantitative PCR reaction or stored at-20 ℃ for a long time.

RT-qPCR：

The cDNA obtained by reverse transcription was diluted 20-fold and placed on ice for use, and 2X UltraSYBR Mixture was also placed on ice, and the reaction system was prepared as follows, 20. Mu.L:

2×UltraSYBR Mixture：10μL；

*Primers(F/R mix)：2μL(0.2μM)；

cDNA：8μL；

the reaction procedure:

(1)95℃、10min；

(2)95℃、15sec；

(3)60℃、20sec；

(4)72℃、25sec；

wherein (1) to (4) are subjected to 40 cycles;

(5)72℃、5min；

the dissolution profile was added at 65℃to 95 ℃.

* The Primer design is shown in table 4 below.

TABLE 4 Table 4

Primer name	Primer sequence (5 '-3')
		hTNFa qRT F	aacctcctctctgccatcaa
hTNFa qRT R	ccaaagtagacctgcccaga
		hIL-18 qRT F	tgcatcaactttgtggcaat
hIL-18 qRT R	tccggggtgcattatctcta
		hIL-1βqRT F	gggcctcaaggaaaagaatc
hIL-1βqRT R	TTCTGCTTGAGAGGTGCTGA
		hGAPDH F	CAAGGTCATCCATGACAACTTTG
hGAPDH R	GTCCACCACCCTGTTGCTGTAG

2.7 CCK8 assay for cell viability (exosome intervention 3):

a375 cells were plated in 96-well plates at 5000 cells/well, and after cell attachment, cells were treated with complete medium with or without exosomes at working concentrations of 5, 10, 20 μg/mL, respectively, for 48 h. After 48h, CCK8 reagent was added for cell viability assay, and OD450 values were read within 2h.

2.8 exosome intervention 4:

after determination of exosome use concentration according to 2.7, A375 cells were assayed according to 2X 10 ⁷ The cells were plated to 15cm plates and treated with complete medium with or without exosomes for 72h after cell attachment.

2.9 sample preparation and concentration determination

The sample preparation specifically comprises the following steps:

s1: collecting cells: observing the cell state under a microscope, removing the culture medium, adding PBS precooled at 4 ℃ to gently shake and wash the cells, and discarding the washing liquid;

s2: pancreatin digests cells, cell pellet was collected and washed 1 time with PBS;

s3: 200. Mu.L of RIPA lysate to which PI and PMSF had been added was added;

s4: cracking on ice for 30min, or ultrasonic crushing;

s5: and (3) centrifuging at 15000 Xg for 15min at 4 ℃ by using a centrifugal machine, and collecting the supernatant to obtain an experimental sample.

Protein concentration assay (BCA method), comprising the specific steps of:

s1: taking out 2mg/mL BSA from the temperature of minus 20 ℃, putting on ice, and melting for later use;

s2: taking a plurality of 1.5mL centrifuge tubes, and marking the centrifuge tubes as 0,1,2,3,5,7, protein 1, protein 2, protein 3 and the like;

s3: determining the weight of BCA working solution according to 400 mu L of each tube, uniformly mixing the solution A and the solution B in a ratio of 50:1, and keeping out of light for later use;

s4: various reagents were added to each tube as shown in table 5 below;

s5: vortex mixing, instantaneous separation, and separating the liquid on the pipe wall;

s6: incubating for 30min in a water bath at 37 ℃ in a dark place;

s7: sub-packaging the two compound holes of each tube into 96-hole ELISA plates, wherein air bubbles are avoided;

s8: the multifunctional enzyme-labeled instrument detects OD562nm, and the concentration of different proteins is calculated according to a standard curve.

TABLE 5

2.10 melanin content detection:

all sample protein concentrations were adjusted to 5.77 μg/uL and 100 μl was used to determine OD470, 3 replicates per sample.

2.11 tyrosinase activity assay:

200 mu L of a solution containing 577 mu g of protein and 0.5mmol/L of levodopa substrate 2.8mL of the solution are added into an enzyme activity reaction measurement system with the total volume of 3.0mL, the mixture is fully and uniformly mixed, the mixture is subjected to water bath heat preservation at 37 ℃ for 10min, and then the absorbance value of a sample liquid group is measured at a wavelength of 475 nm.

3. Experimental results

3.1 cell basal culture:

the basal culture growth conditions of the A375, hacat and HSF cells are sequentially shown in FIGS. 6a, 6b and 6c, and the growth states of the three cells are good in FIGS. 6a, 6b and 6 c.

3.2CCK8 method to detect cell viability (exosome intervention 1):

CCK8 is used for detecting the influence of exosomes with different concentrations on cell viability, and the result is shown in fig. 7 and 8, and ginseng, ginger, cucumber and seaweed exosomes with the final concentration of 5 mug/mL are selected; follow-up formal experiments on development of lemon exosomes at 10 μg/mL.

3.3 exosome intervention 2:

the IC50 of about 62.5. Mu.M was obtained, the treatment was carried out for 4 minutes, and after oxidative damage was carried out under these conditions, the exosomes were incubated for 48 hours, and the cell growth was as shown in FIGS. 9a, 9b and 9c, and as shown in FIGS. 9a, 9b and 9c, the cell density was decreased after oxidative damage.

3.4 apoptosis detection:

the apoptosis in 3.3 was examined by flow cytometry, and the results are shown in FIGS. 10a, 10b and 10c, and the results of the statistical analysis are shown in FIGS. 11-16, showing that apoptosis was reduced to a certain extent after exosome treatment.

3.5 cell migration Capacity assay

The results of the Transwell detection and the co-incubation of exosomes after oxidative damage for 48 hours show the change of the cell migration capacity, as shown in fig. 17, and the results of the statistical analysis show in fig. 18 (remark: hacat migration capacity is weak, cell migration is not seen after multiple attempts, and the test of the cells is abandoned), so that the exosomes of lemon and ginger can enhance the cell migration capacity, and after the rest exosomes are treated, no significant difference exists compared with the oxidative damage group.

3.6qPCR detection of inflammatory factor expression

The 3.3 cells were collected and qPCR detected for IL-1β, IL-18, TNF- α, GAPDH expression levels, and the results were shown in FIGS. 19-24, where the differences in each group were not significant or consistent with the expectations (generally, differences of more than 2-fold were considered as differences in gene expression, and the expectations were that the genes to be examined were up-regulated after oxidative damage, and that the genes to be examined were down-regulated after exosome treatment, indicating that exosomes had effects of repairing oxidative damage and reducing inflammatory gene expression).

3.7CCK8 method to detect cell viability (exosome intervention 3):

CCK8 is used for detecting the influence of exosomes with different concentrations on cell viability, and the results are shown in figures 25a and 25b, and ginseng, ginger, cucumber and seaweed exosomes with the final concentration of 5 mug/mL are selected; follow-up formal experiments on development of lemon exosomes at 10 μg/mL.

3.8 exosome intervention 4:

the exosome co-incubation was performed for 72h according to the method 2.8, and the cell growth was as shown in FIG. 26, and as can be seen from FIG. 26, the state of each exosome treatment group was good.

3.9 melanin content detection

As shown in FIG. 27, it is apparent from FIG. 27 that the melanin content was decreased by the exosomes of lemon and ginger, which were obtained by collecting 3.8 cells and measuring the melanin content.

3.10 tyrosinase Activity assay

Cells from 3.8 were collected and assayed for tyrosinase, and as shown in fig. 28, lemon and ginger exosomes tended to decrease tyrosinase activity (melanin synthesis rate-limiting enzyme), but the difference was not significant.

3.11 animal model test:

and (3) combining and based on the data, preferentially selecting a concentration combination formed by three exosomes of lemon, ginseng and ginger as an exosome raw material combination with a whitening and repairing function, namely mixing to form an exosome composition of the application, and further testing fish egg model data. The results of the test of the fish egg model data are shown in figures 29-30.

As can be seen from fig. 29-30, the fish egg group without the functional exosome combination naturally formed black spots during normal development, while the addition of the functional exosome combination did not appear black spots due to exosomes, it can be concluded that: the exosome combination also has the function of whitening and repairing on an animal model.

The present embodiment is merely illustrative of the present application and is not intended to be limiting, and those skilled in the art, after having read the present specification, may make modifications to the present embodiment without creative contribution as required, but is protected by patent laws within the scope of the claims of the present application.

Claims

1. An exosome composition comprising at least one of lemon exosome, ginseng exosome and ginger exosome, wherein the concentrations of the lemon exosome, the ginseng exosome and the ginger exosome are each independently 4-20 μg/mL.

2. Exosome composition according to claim 1, wherein the concentration of lemon exosome, ginseng exosome and ginger exosome are each individually 5-10 μg/mL.

3. Exosome composition according to claim 1, wherein the concentration of lemon exosomes is 8-12 μg/mL, and the concentrations of ginseng exosomes and ginger exosomes are 4-6 μg/mL, respectively, alone.

4. Exosome composition according to claim 1, wherein the concentration of lemon exosomes is 10 μg/mL and the concentrations of ginseng exosomes and ginger exosomes are 5 μg/mL, respectively, alone.

5. The exosome composition according to any one of claims 1-4, comprising lemon exosomes, ginseng exosomes and ginger exosomes.

6. Use of an exosome composition according to any one of claims 1-5 in a whitening repair formulation.

7. A method of preparing an exosome composition according to any one of claims 1 to 5, wherein at least one of the lemon exosome, the ginseng exosome and the ginger exosome is mixed to obtain the exosome composition.