CN116024303A - EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof - Google Patents
EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof Download PDFInfo
- Publication number
- CN116024303A CN116024303A CN202211387144.8A CN202211387144A CN116024303A CN 116024303 A CN116024303 A CN 116024303A CN 202211387144 A CN202211387144 A CN 202211387144A CN 116024303 A CN116024303 A CN 116024303A
- Authority
- CN
- China
- Prior art keywords
- eml4
- primer
- alk
- probe
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an EML4-ALK fusion gene quantitative genome RNA standard substance and a preparation method thereof, wherein genome RNA containing two mutants of EML4-ALK fusion genes V1 and V3a/b is extracted and obtained by the method, yeast RNA storage buffer solution and quantitative standard substance solution are prepared, corresponding primers and probes are designed, a one-step reverse transcription digital PCR method is adopted, PCR amplification is carried out by taking the EML4-ALK V1 and V3a/b fusion mutant genome RNA as templates, and fluorescent signals are collected to detect the expression of the EML4-ALK fusion genes V1 and V3a/b, so that the copy number content and mutant gene abundance of the EML4-ALK fusion genes V1, V3a/b and ALK-ref are obtained as the values.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to an EML4-ALK fusion gene quantitative genome RNA standard substance and a preparation method thereof.
Background
The EML4-ALK fusion gene is formed by inversion of acanthopossum microtubule-associated protein-like protein 4 (echinoderm microtubule-associated proteinlike, EML 4) and anaplastic lymphoma kinase (anaplastic lymphoma kinase, ALK) on chromosome 2, is a continuously active structural kinase, has an activating effect on ALK tyrosine kinase in vitro and in vivo, so as to promote cell division and inhibit apoptosis, so that cells are malignant and proliferated, and cancer cells are remarkably deteriorated. To date, 11 different types of fusion variants have been reported, mainly mutant 1 (variant 1, V1: exon 13 fused to ALK exon 20), mutant 2 (variant 2, V2: exon 20 fused to ALK exon 20), mutant 3a/b (variant 3a/b, V3a/b: exon 6a/b fused to ALK exon 20), mutant 4 (variant 4, V4: exon 14 fused to ALK exon 20), mutant 5a/b (variant 5a/b, V5a/b: exon 2 fused to ALK exon 20), and the like; it is distinguished mainly by the maintenance of the same breaking point in ALK, while the different breaking points in EML 4.
It was found that about 90% of non-small cell lung cancer (non-small cell lung cancer, NSCLC) patients were three mutants of V1, V2 and V3a/b, with detection rates of V1 and V3a/b of 50% and 29%, respectively. Thus, ALK rearrangement has become a therapeutic target for NSCLC patients with EML4-ALK gene fusion. Therefore, EML4-ALK has become a promising therapeutic target and diagnostic molecular marker, and accurate measurement has clinical significance for disease diagnosis, follow-up targeted drug guidelines, and monitoring of minimal residual disease (monitor minimal residual disease, MRD).
In recent years, the technical method for detecting the specific fusion gene of the non-small cell lung cancer in China is gradually established and perfected. Current methods for detecting EML4-ALK include Immunohistochemistry (IHC), fluorescence In Situ Hybridization (FISH), PCR-based techniques, high throughput sequencing (Next Generation Sequencing, NGS), and the like. The methods have uncertainty in terms of specificity, sensitivity and accuracy, so that unified standards for related detection, such as detection of fusion genes by using FISH, IHC, RT-qPCR three techniques, are still lacking, and the RT-qPCR method is more sensitive and has the lowest subjective degree, but the differences in terms of reverse transcription, internal reference selection and standard curve construction are also the main reasons for the significant differences in data among laboratories.
CN108085391a discloses an RNA quality control product of a lung cancer fusion gene detection kit capable of being stably stored, the RNA quality control product comprises the following components: a positive reference, a negative reference, and a limit of detection reference; the positive reference, the negative reference and the detection limit reference respectively contain corresponding fusion gene RNA, aurin tricarboxylic acid ammonium salt, preservative and phenylbutazone inhibin hydrochloride; the preservative is selected from glycine, epsilon-polylysine or cysteine. Although the patent provides an RNA quality control product, the quality control product is in a pseudo-virus form, the length of a target RNA fragment is greatly different from the genome in a clinical sample, the quality control product is not accurately quantified, and the quality control product can only be used as a quality control product and cannot be used as a standard substance for verifying the accuracy.
Therefore, there is an urgent need in the art to develop an EML4-ALK fusion gene quantitative genomic RNA standard substance with an accurate mutation ratio for verifying the sensitivity and accuracy of each assay, related reagent validation evaluation, and laboratory quality control.
Disclosure of Invention
The invention aims to provide an EML4-ALK fusion gene quantitative genome RNA standard substance and a preparation method thereof.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the preparation method of the EML4-ALK fusion gene quantitative genome RNA standard substance comprises the following steps:
(1) Extracting genome RNA of a cell line containing EML4-ALK mutation, and detecting the concentration and purity of the genome RNA;
(2) The genome RNA of the EML4-ALK mutant cell line is used as a template, a reverse transcription kit and PCR amplification are adopted to obtain a gene fragment with target fusion mutation, and the accuracy of a target gene sequence is verified through Sanger sequencing PCR products;
(3) Adding a certain yeast RNA solution into RNA solution to prepare RNA storage buffer;
(4) The genomic RNA of the cell line is added to the RNA storage buffer solution to be diluted into a standard solution with a certain concentration.
(5) Designing and obtaining a specific primer 1, a primer 2 and a specific probe 1 of an EML4-ALK V1 fusion gene, wherein the nucleotide sequences of the primer 1 and the primer 2 are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of the probe 1 is shown as SEQ ID No. 3;
designing and obtaining a specific primer 3 and a primer 4 of an EML4-ALK V3a/b fusion gene and a specific probe 2; the nucleotide sequences of the primer 3 and the primer 4 are shown as SEQ ID No.4 and SEQ ID No.5, and the nucleotide sequence of the probe 2 is shown as SEQ ID No. 6;
designing and obtaining ALK-ref gene specific primers 5, primers 6 and specific probes 3; the nucleotide sequences of the primer 5 and the primer 6 are shown as SEQ ID No.7 and SEQ ID No.8, and the nucleotide sequence of the probe 3 is shown as SEQ ID No. 9;
(6) And carrying out PCR amplification by adopting a one-step reverse transcription digital PCR method and taking the EML4-ALK V1 and V3a/b fusion mutant genome RNA as a template, and collecting fluorescent signals to detect the expression of the EML4-ALK fusion genes V1 and V3a/b, so as to obtain the copy number content and the mutant gene abundance of the EML4-ALK fusion genes V1, V3a/b and ALK-ref as the values thereof.
In the step (3) and the step (4), the RNA storage buffer solution and the standard solution having a predetermined concentration are weighed, diluted and mixed by a balance weighing method.
Further, in the step (3), the yeast RNA concentration is 5 ng/. Mu.L.
Further, in the step (5), the EML4-ALK fusion gene probe 1 and the probe 2 are FAM fluorescent groups marked at the 5 'end and BHQ1 fluorescent groups marked at the 3' end; the ALK-ref gene specific probe 3 is HEX fluorescent group marked at the 5 'end and BHQ1 fluorescent group marked at the 3' end.
Further, in the step (5), the reaction concentration of the primer 1 and the primer 2 is 400nM, and the reaction concentration of the probe 1 is 200nM; the reaction concentration of the primer 3 and the primer 4 is 500nM, and the reaction concentration of the probe 2 is 300nM; the reaction concentration of the primer 5 and the primer 6 was 500nM, and the reaction concentration of the probe 3 was 400nM.
Further, the one-step reverse transcription digital PCR method comprises the following steps: 0 to 100ng,2 XOne-step Supermix (Bio-Rad) 5. Mu.L, reverse transcriptase. Mu.L, 300mM DTT 1. Mu.L, primer 1 and primer 2:0.8 μl, probe 1: 0.4. Mu.L; or primer 3 and primer 4:1.0 μl, probe 2: 0.6. Mu.L; or primer 5 and primer 6:1.0 μl, probe 3: 0.8. Mu.L.
Further, the PCR reaction conditions were: reverse transcription at 45℃for 60min and denaturation at 95℃for 10min; then denaturation at 94℃for 30sec, annealing at 54℃for 60sec at 60℃for 40 cycles; finally, the mixture is extended for 10min at 98 ℃ and stored at 4 ℃.
Further, the mutant gene abundance calculating formula is as follows
Further, the mutation types of the EML4-ALK fusion gene are V1 and V3a/b; the cell lines include the H3122 and H2228 cell lines.
The EML4-ALK fusion gene quantitative genome RNA standard substance prepared by the preparation method provided by the invention.
Compared with the prior art, the invention has the outstanding effects that:
(1) The method of the invention respectively extracts genome RNA containing two mutants of EML4-ALK fusion gene V1 and V3a/b, and prepares RNA storage buffer solution and quantitative standard solution by mixing yeast RNA and RNA solution through a balance weighing method.
(2) The one-step reverse transcription digital PCR method established by the method has the advantages of good precision and high accuracy, does not depend on a standard curve and CT values, directly calculates according to poisson distribution to achieve absolute quantification and the like, and the tracing route has passed the acceptance of the International quality Consultation Committee (CCQM) nucleic acid analysis working group (NAWG), thereby ensuring the reliability and traceability of the measurement result.
(3) The EML4-ALK fusion gene quantitative genome RNA standard substance can be used as a quantitative standard.
(4) The quantitative standard for detecting the EML4-ALK fusion gene comprises two common mutant forms of V1 and V3a/b, and can be used for development of an EML4-ALK fusion gene detection method, verification and evaluation of related reagents and laboratory quality control.
The quantitative genomic RNA standard substance of the EML4-ALK fusion gene and the preparation method thereof are further described below with reference to the accompanying drawings and specific examples.
Drawings
FIG. 1 shows the result of the detection of EML4-ALK fusion gene by electrophoresis of a quantitative genomic RNA standard substance chip.
FIG. 2 shows the sequencing results of the EML4-ALK fusion gene detection quantitative genomic RNA standard substance.
FIG. 3 shows the digital PCR reaction annealing temperature optimization of EML4-ALK fusion gene detection quantitative genomic RNA standard substance.
FIG. 4 shows the digital PCR reaction system optimization of the EML4-ALK fusion gene detection quantitative genomic RNA standard substance.
FIG. 5 shows the stability of the EML4-ALK fusion gene in the quantitative genomic RNA standard (V1) assay.
FIG. 6 shows the stability of the EML4-ALK fusion gene assay quantitative genomic RNA standard (V3 a/b).
Detailed Description
1. Confirmation of purity and concentration of extracted genomic RNA of cell line
By Qiagen, germany
The Mini Kit extracts and purifies genome RNA in a large amount of cultured cell lines containing EML4-ALK mutation (mutation types are V1 and V3 a/b) H3122 and H2228, and obtains an EML4-ALK genome RNA standard substance candidate. The specific operation steps are as follows:
1. for suspension cells, the cell density reached 10 7 cells/mL, transferred to a centrifuge tube and centrifuged at 300 Xg for 5min, all supernatant was carefully aspirated; for adherent cells, after the cells are fully confluentDigestion count (cell density up to 10 7 cells/mL), transferred to a centrifuge tube, centrifuged at 300 Xg for 5min, and all supernatant carefully aspirated.
2. Cells were lysed by addition of 600. Mu.L Buffer RLT, vortexed or blown down evenly.
3. Adding 70% ethanol with equal amount into the cell lysate, and mixing thoroughly.
4. Add 700. Mu.L of cell lysate to RNeasy spin column, centrifuge at 8000 Xg (. Gtoreq.10000 rpm) for 15s, and pour out the waste liquid.
5. The remaining solution was repeated for the previous step.
6. mu.L of Buffer RW1 was added to RNeasy spin column, centrifuged at 8000 Xg (. Gtoreq.10000 rpm) for 15s, and the waste liquid was poured off.
7. 500. Mu.L Buffer RPE was added to a RNeasy spin column spin column. The cover is lightly covered, the centrifugation is carried out for 2min at the speed of more than or equal to 8000 Xg (at the speed of more than or equal to 10000 rpm), and the waste liquid is poured out.
8. RNeasy spin column is placed in a new 2mL collection tube and the old collection tube is discarded along with the waste liquid. The lid was gently covered and centrifuged at full speed for 1min.
9. RNeasy spin column was placed in a fresh 1.5mL collection tube and 30-50. Mu.L of enzyme-free water was added to the spin-column membrane. The cover is lightly covered, and the mixture is centrifuged for 1min at the speed of more than or equal to 8000 Xg (at the speed of more than or equal to 10000 rpm).
10. To increase the RNA yield, the elution was repeated using the eluent of operation 9 (no enzyme water) to obtain higher concentration of RNA.
11. The high concentration RNA solution was collected.
The purity and concentration of the genomic RNA obtained by the above preparation were measured and repeated 5 times, and the measurement results are shown in tables 1 to 2. Meanwhile, the integrity of the sample is detected by utilizing micro-fluidic chip electrophoresis, and the detection result of Agilent 2100 is shown in FIG. 1.
TABLE 1 EML4-ALK V1 genomic RNA concentration and purity results
TABLE 2 EML4-ALK V3 genomic RNA concentration and purity results
2. Confirmation of the sequence of the extracted genomic RNA target mutant Gene of the cell line
The genome RNA is reversely transcribed into cDNA by a reverse transcription kit, a gene fragment of the target fusion mutation is obtained through common PCR amplification, and then the PCR product is sequenced by using a Sanger sequencing method. The sequencing results are shown in FIG. 2.
3. Three pairs of primers and probes for specifically amplifying EML4-ALK V1, V3a/b and ALK-ref genes are designed
Three pairs of specific primers and probes were designed using PrimerExpress3.0 according to NCBI database, in combination with EML4-ALK V1/V3 fusion mutation information. And the Blast is adopted for comparison, so that the specificity is high, and no potential nonspecific amplification region exists. The specific primers and probes comprise a specific primer 1 and a primer 2 for specifically amplifying EML4-ALK V1 and a specific probe 1; and a specific primer 3 and primer 4 for specifically amplifying EML4-ALK V3a/b and a specific probe 2; specific primers 5 and 6 for amplifying ALK-ref and specific probe 3; the nucleotide sequences of the primer 1 and the primer 2 are shown as SEQ ID No.1 and SEQ ID No.2, the nucleotide sequence of the probe 1 is shown as SEQ ID No.3, the nucleotide sequences of the primer 3 and the primer 4 are shown as SEQ ID No.4 and SEQ ID No.5, the nucleotide sequence of the probe 2 is shown as SEQ ID No.6, the nucleotide sequences of the primer 5 and the primer 6 are shown as SEQ ID No.7 and SEQ ID No.8, and the nucleotide sequence of the probe 3 is shown as SEQ ID No.9, see Table 3.
TABLE 3 digital PCR primer probe sequences
| Sequence numbering | Name of the name | Nucleotide sequence |
| SEQ ID No.1 | V1-F | GCCCACACCTGGGAAAGG |
| SEQ ID No.2 | V1-R | GGAGCTTGCTCAGCTTGTACTCA |
| SEQ ID No.3 | V1-P | FAM-CCGCCGGAAGCACCAGGAGC-BHQ1 |
| SEQ ID No.4 | V3-F | AAACTGCAGACAAGCATAAAGATGTC |
| SEQ ID No.5 | V3-R | GGAGCTTGCTCAGCTTGTACTCA |
| SEQ ID No.6 | V3-P | FAM-CCGCCGGAAGCACCAGGAGC-BHQ1 |
| SEQ ID No.7 | ALK-ref-F | GGCAAGACCTCCTCCATCAG |
| SEQ ID No.8 | ALK-ref-R | GCCCAGACCCCGAATGAG |
| SEQ ID No.9 | ALK-ref-P | HEX-AGGTGCCGCGGAAA-BHQ1 |
4. Optimizing the amplification conditions of three pairs of primers and probes for specifically amplifying the EML4-ALK V1, V3a/b and ALK-ref genes
The final concentrations of the primers of EML4-ALK V1 and V3a/b were fixed at 500nM and the probe concentrations were fixed at 250nM (FIGS. 3a and 3 b), and the annealing temperatures were set at 55℃and 56℃and 57℃and 58℃and 59℃and 60℃respectively.
The final concentration of ALK-ref was fixed at 500nM and the probe concentration was fixed at 250nM (FIG. 3 c), and the annealing temperature was set at 50℃at 52℃at 54℃at 56℃at 58℃at 60 ℃.
From the one-dimensional scatter diagram of the amplification results, the EML4-ALK V1 and the EML 3a/b are amplified better at the annealing temperatures of 6, but from the repeatability of the quantitative results, the repeatability under the condition of 60 ℃ is the best, so that the optimal annealing temperature of the EML4-ALK V1 and the EML 3a/b is determined to be 60 ℃; better amplification was obtained at 4 annealing temperatures of ALK-ref, the best of the dispersion of the two clusters of positive and negative droplets at 54℃and the reproducibility of the quantitative results were higher, thus determining the optimal annealing temperature of ALK-ref as 54 ℃.
The primer probe concentrations are set to be 200-500nM respectively, and according to the optimal conditions that the negative amplification signal is obviously separated from the positive amplification signal, the droplet number and the copy number are high, the final determined V1 primer probe concentration is 400nM and 200nM, the V3 primer probe concentration is 500nM and 400nM, and the ALK-ref probe concentration is 500nM and 400nM.
The system of the microdroplet digital PCR reaction is: genome: 0-100 ng,2X One-step Supermix (Bio-Rad Laboratories) 5. Mu.L, reverse transcriptase. Mu.L, 300mM DTT 1. Mu.L, V1 upstream and downstream primers: 0.8 μl, probe: 0.4. Mu.L; v3 upstream and downstream primers: 1.0 μl, probe: 0.6. Mu.L; ALK-ref upstream and downstream primers: 1.0 muL, probe: 0.8. Mu.L, 2. Mu.L of RNA template and ddH 2 O makes up 20. Mu.L.
PCR reaction procedure: reverse transcription at 45℃for 60min, denaturation at 95℃for 10min, denaturation at 94℃for 30s, annealing at 54℃for 60s,40 cycles, extension at 98℃for 10min, and preservation at 4 ℃.
5. Preparation of EML4-ALK fusion Gene detection quantitative Standard substance and fixed value
Through the processes of the step (I) and the step (II), preparing an RNA solution containing 5 ng/. Mu.L yeast RNA as an RNA storage buffer solution according to a balance weighing method, adding the obtained genome RNA of the EML4-ALK fusion gene cell line serving as a standard substance into the RNA storage buffer solution according to a weight method, uniformly mixing, sub-packaging for freezing, and then carrying out fixed value according to the established one-step reverse transcription digital PCR.
And (3) performing PCR amplification by adopting a one-step reverse transcription digital PCR method, taking the EML4-ALK V1 and V3a/b fusion mutant genome RNA as a template, and collecting fluorescent signals to detect the expression of the EML4-ALK fusion genes V1 and V3a/b, wherein the copy number content and the mutant gene abundance of the EML4-ALK fusion genes V1, V3a/b and ALK-ref are never obtained as the values thereof.
The calculation formula of the abundance of the target mutant gene is as follows:
6. testing the uniformity of the quantitative genome RNA standard substance of the EML4-ALK fusion gene
To ensure sufficient uniformity and stability of the standard substance providing a quality control reference during the detection process, the accuracy of the delivered quantity value is thus accurate. According to the technical requirements for evaluating the uniformity of standard substances in the national measurement technical specification JJF 1343-2012 general principles of standard substance constant value and statistical principles, randomly extracting 11 packaging units from each standard substance, performing constant value detection by adopting an established one-step reverse transcription digital PCR method, and repeatedly measuring each unit for 3 times to obtain data shown in tables 5 and 6. And F test is carried out on the obtained data, the calculated F value is compared with a critical Falpha obtained by table lookup, if F is smaller than Falpha, no obvious difference exists between the groups, and the uniformity of the sample is good.
And (3) carrying out uniformity measurement on the EML4-ALK fusion gene detection quantitative standard substance by using the established one-step reverse transcription digital PCR method, and firstly adopting a Charpy-Wilker method to test the normalization of data for the measurement result, wherein the uniformity data of all the standard substances meet the normal distribution. And then the Dixon's and Grubbs's inspection is adopted to reject the suspicious value, and no suspicious value is found. After F test, the results show F of all standard substances<F 0.05(10,22) I.e. the internal homogeneity of the standard substance solution has no significant difference.
TABLE 4 uniformity test results of EML4-ALK V1 fusion genes in genomic RNA
TABLE 5 uniformity test results of EML4-ALK V3 fusion genes in genomic RNA
7. Monitoring the stability of EML4-ALK fusion gene quantitative genome RNA standard substance
In order to ensure the stability under the standard substance transportation condition, the short-term stability test is carried out, two temperatures of-20 ℃ and 4 ℃ are examined, 3-tube samples are randomly selected at sampling time points of 3 days, 7 days and 14 days respectively, the measurement is repeated for 3 times for each tube sample, the copy number of two mutants of the EML4-ALK fusion gene, the copy number of ALK-ref gene and the mutation gene abundance are measured, and the standard substance under the preservation condition of-80 ℃ is taken as a reference temperature, and the reference temperature is shown in figures 5-6.
Thus, it can be demonstrated that the copy number concentration of the mutant gene of the standard substance and the mutation abundance do not change significantly within 14 days under the preservation conditions of-20 ℃ and 4 ℃. Therefore, dry ice is added in transportation or transportation is carried out under the condition that the temperature is controlled to be not more than 4 ℃, and the quantity of the standard substance can be kept stable as long as the transportation time is not more than 14 days, which lays an important foundation for the application of the standard substance.
The above examples are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solution of the present invention should fall within the scope of protection defined by the claims of the present invention without departing from the spirit of the present invention.
Claims (10)
1. The preparation method of the EML4-ALK fusion gene quantitative genome RNA standard substance is characterized by comprising the following steps of:
(1) Extracting genome RNA of a cell line containing EML4-ALK mutation, and detecting the concentration and purity of the genome RNA;
(2) The genome RNA of the EML4-ALK mutant cell line is used as a template, a reverse transcription kit and PCR amplification are adopted to obtain a gene fragment with target fusion mutation, and the accuracy of a target gene sequence is verified through Sanger sequencing PCR products;
(3) Adding a certain yeast RNA solution into RNA solution to prepare RNA storage buffer;
(4) The genomic RNA of the cell line is added to the RNA storage buffer solution to be diluted into a standard solution with a certain concentration.
(5) Designing and obtaining a specific primer 1, a primer 2 and a specific probe 1 of an EML4-ALK V1 fusion gene, wherein the nucleotide sequences of the primer 1 and the primer 2 are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of the probe 1 is shown as SEQ ID No. 3;
designing and obtaining a specific primer 3 and a primer 4 of an EML4-ALK V3a/b fusion gene and a specific probe 2; the nucleotide sequences of the primer 3 and the primer 4 are shown as SEQ ID No.4 and SEQ ID No.5, and the nucleotide sequence of the probe 2 is shown as SEQ ID No. 6;
designing and obtaining ALK-ref gene specific primers 5, primers 6 and specific probes 3; the nucleotide sequences of the primer 5 and the primer 6 are shown as SEQ ID No.7 and SEQ ID No.8, and the nucleotide sequence of the probe 3 is shown as SEQ ID No. 9;
(6) And carrying out PCR amplification by adopting a one-step reverse transcription digital PCR method and taking the EML4-ALK V1 and V3a/b fusion mutant genome RNA as a template, and collecting fluorescent signals to detect the expression of the EML4-ALK fusion genes V1 and V3a/b, so as to obtain the copy number content and the mutant gene abundance of the EML4-ALK fusion genes V1, V3a/b and ALK-ref as the values thereof.
2. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: in the step (3) and the step (4), when the RNA storage buffer solution and the standard solution with a certain concentration are prepared, the solution is weighed, diluted and mixed by a balance weighing method.
3. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: in the step (3), the concentration of yeast RNA is 5 ng/. Mu.L.
4. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: in the step (5), the EML4-ALK fusion gene probe 1 and the probe 2 are FAM fluorescent groups marked at the 5 'end and BHQ1 fluorescent groups marked at the 3' end; the ALK-ref gene specific probe 3 is HEX fluorescent group marked at the 5 'end and BHQ1 fluorescent group marked at the 3' end.
5. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: in the step (5), the reaction concentration of the primer 1 and the primer 2 is 400nM, and the reaction concentration of the probe 1 is 200nM; the reaction concentration of the primer 3 and the primer 4 is 500nM, and the reaction concentration of the probe 2 is 300nM; the reaction concentration of the primer 5 and the primer 6 was 500nM, and the reaction concentration of the probe 3 was 400nM.
6. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: the one-step reverse transcription digital PCR method comprises the following steps: 0 to 100ng,2 XOne-step Supermix (Bio-Rad) 5. Mu.L, reverse transcriptase. Mu.L, 300mM DTT 1. Mu.L, primer 1 and primer 2:0.8 μl, probe 1: 0.4. Mu.L; or primer 3 and primer 4:1.0 μl, probe 2: 0.6. Mu.L; or primer 5 and primer 6:1.0 μl, probe 3: 0.8. Mu.L.
7. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 6, wherein the method comprises the following steps: the PCR reaction conditions were: reverse transcription at 45℃for 60min and denaturation at 95℃for 10min; then denaturation at 94℃for 30sec, annealing at 54℃for 60sec at 60℃for 40 cycles; finally, the mixture is extended for 10min at 98 ℃ and stored at 4 ℃.
8. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: the mutant gene abundance calculating formula is as follows
9. The method for preparing the EML4-ALK fusion gene quantitative genomic RNA standard substance according to claim 1, wherein the method comprises the steps of: the mutation types of the EML4-ALK fusion gene are V1 and V3a/b; the cell lines include the H3122 and H2228 cell lines.
10. The EML4-ALK fusion gene quantitative genomic RNA standard prepared by the method of any one of claims 1-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211387144.8A CN116024303A (en) | 2022-11-07 | 2022-11-07 | EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211387144.8A CN116024303A (en) | 2022-11-07 | 2022-11-07 | EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116024303A true CN116024303A (en) | 2023-04-28 |
Family
ID=86076611
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211387144.8A Pending CN116024303A (en) | 2022-11-07 | 2022-11-07 | EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116024303A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117025766A (en) * | 2023-07-07 | 2023-11-10 | 银丰基因科技有限公司 | DNA standard for human ALK-E13 and A20 fusion gene detection, and preparation method and application thereof |
-
2022
- 2022-11-07 CN CN202211387144.8A patent/CN116024303A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117025766A (en) * | 2023-07-07 | 2023-11-10 | 银丰基因科技有限公司 | DNA standard for human ALK-E13 and A20 fusion gene detection, and preparation method and application thereof |
| CN117025766B (en) * | 2023-07-07 | 2024-04-30 | 银丰基因科技有限公司 | DNA standard for human ALK-E13 and A20 fusion gene detection, and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
| JP2011525106A (en) | Markers for diffuse B large cell lymphoma and methods of use thereof | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN1995386A (en) | BCR-ABL gene fluorescence quantitative RT-PCR primer and probe and reagent kit | |
| Ruan et al. | Nucleophosmin mutations in Chinese adults with acute myelogenous leukemia | |
| Rendtorff et al. | Analysis of 65 tuberous sclerosis complex (TSC) patients by TSC2 DGGE, TSC1/TSC2 MLPA, and TSC1 long‐range PCR sequencing, and report of 28 novel mutations | |
| CN105002283A (en) | QPCR composition used for detecting c-kit gene mutation of people and reagent kit | |
| CN103451268B (en) | A kind of standard substance of detection line plastochondria A3243G heterozygous mutant rate, test kit and detection method thereof | |
| CN108342461A (en) | DdPCR technologies detect primer, kit and the detection method of IDH1 genetic mutations | |
| CN116024303A (en) | EML4-ALK fusion gene quantitative genome RNA standard substance and preparation method thereof | |
| CN107254543B (en) | PCR primer combination, kit and real-time fluorescent quantitative detection method for detecting RhD mRNA spliceosome | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN1995385A (en) | PML-RARa gene fluorescence quantitative RT-PCR primer and probe and reagent kit | |
| CN113621692B (en) | Human FGFR1 gene copy number variation nucleic acid standard substance, preparation method thereof and kit | |
| KR102041001B1 (en) | Method for quantitative analysis of FLT3 gene mutation and kit | |
| CN116334180A (en) | BCR-ABL1 fusion gene quantitative genome RNA standard substance and preparation method thereof | |
| CN109762932A (en) | Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain | |
| CN117233400A (en) | KCNN3 gene detection kit for diagnosis and prognosis evaluation of multiple myeloma and application thereof | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| Sebestyén et al. | Distinct miRNA expression signatures of primary and secondary central nervous system lymphomas | |
| CN113718020A (en) | Primer-probe combination and kit for detecting internal tandem repeat mutation of human leukemia FLT3 gene and application of primer-probe combination and kit | |
| CN112831556A (en) | Kit for detecting MYD88L265P mutation based on AS-PCR and application thereof | |
| CN105861720A (en) | Primer pair and probe specifically aiming at MLAA-34 and fluorescent quantitative RT-PCR kit and detection method | |
| JP2008182993A (en) | Method, program and system for judging gene examination result | |
| Wang et al. | A high-throughput method to detect RNA profiling by integration of RT-MLPA with next generation sequencing technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |