CN116024075A - Trace nucleic acid amplification detection device and application thereof - Google Patents

Abstract

The invention provides a portable nucleic acid amplification detection device which comprises a microfluidic nucleic acid amplification detection chip, a heating unit and a fluorescence acquisition unit, wherein one sample inlet in the microfluidic nucleic acid amplification detection chip is connected with a plurality of reaction chambers through a plurality of liquid channels, fluorescent dye, nucleic acid amplification reaction reagent and freeze-dried powder of nucleic acid amplification primers are sealed in the reaction chambers, the heating unit coats the reaction chambers, and the fluorescence acquisition unit acquires fluorescent signals in the reaction chambers. The invention uses the micro-fluidic chip as a reaction carrier, and has small volume; the microfluidic chip is internally provided with a freeze-dried reagent, is of a fully-sealed structure, and has no risk of uncovering pollution after sample addition; the chip is internally provided with a plurality of reaction detection channels, so that the detection of a plurality of nucleic acid targets can be realized simultaneously, and the aim of multi-joint detection is fulfilled.

Description

Trace nucleic acid amplification detection device and application thereof

Technical Field

The invention belongs to the field of biomedical detection, and particularly relates to a trace nucleic acid amplification detection device and application thereof.

Background

At present, most of the constant temperature nucleic acid amplification detection instruments in the market are universal instruments, a PCR tube is used as a reaction container, a sample and a reagent are added into the tube and then are put into the instrument for amplification reaction and detection, and part of the instruments even have no detection function. Such instruments suffer from the following disadvantages: 1) The temperature control module has large volume, needs to entirely wrap the PCR reaction tube, has large heat capacity, and needs to be matched with a larger heat dissipation part; 2) The whole machine has larger power and needs a high-power fixed power supply; 3) The samples and reagents of the instrument need to be mixed manually and added to the PCR tube, risking contamination of the cover.

In order to solve the problems, the invention provides a trace nucleic acid amplification detection device and application thereof, and the trace nucleic acid amplification detection device is used for completing amplification and detection of nucleic acid in a totally-enclosed manner, so that the heating efficiency can be improved, and multi-connection detection can be realized.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention provides a trace nucleic acid amplification detection device and application thereof, wherein a heating unit is attached to a monitoring cavity of a coated microfluidic chip to provide stable and accurate temperature required by expansion and rapidly finish multiplex nucleic acid amplification and detection.

The invention provides the following technical scheme:

the portable nucleic acid amplification detection device comprises a microfluidic nucleic acid amplification detection chip, a heating unit and a fluorescence acquisition unit, wherein one sample inlet in the microfluidic nucleic acid amplification detection chip is connected with a plurality of reaction chambers through a plurality of liquid channels, fluorescent dye, nucleic acid amplification reaction reagent and freeze-dried powder of nucleic acid amplification primers are sealed in the reaction chambers, the heating unit coats the reaction chambers, and the fluorescence acquisition unit acquires fluorescent signals in the reaction chambers.

Further, ventilation holes are formed in the liquid inlet channel and/or the liquid outlet channel of the reaction chamber of the microfluidic nucleic acid amplification detection chip.

Furthermore, the reaction chambers of the microfluidic nucleic acid amplification detection chip are several, and the volume of the reaction chambers is 20-30 mu L.

Further, the heating unit comprises an upper heating plate and a lower heating plate, the reaction chamber of the microfluidic nucleic acid amplification detection chip is inserted into the upper heating plate and the lower heating plate, and the upper heating plate and the lower heating plate are pressed together through springs and guide posts.

Further, the upper heating plate coats the upper surface and the side surface of the reaction chamber, the lower heating plate coats the lower surface of the reaction chamber, a light shielding sheet is arranged on the lower heating plate, and the light shielding sheet and the lower heating plate are provided with detection holes corresponding to the positions of the reaction chamber.

Further, the heating plate is sequentially provided with an insulating layer, a heating plate and a heat conducting layer from outside to inside, the heating plate adopts a resistance wire or Peltier temperature controller, a temperature sensor is buried in the heat conducting layer, and the shape of the heat conducting layer is identical to that of the chip.

Furthermore, the fluorescence acquisition unit is arranged below the microfluidic nucleic acid amplification detection chip, the fluorescence acquisition unit is an array multichannel single-wavelength excitation acquisition module, detection assemblies with the same number as the detection holes of the reaction chamber are arranged on the module, and the position of each detection assembly is opposite to the detection hole above.

Furthermore, the detection component uses a spectroscope matched with an optical filter, the wavelength range of excitation light is 490-495 nm, and the wavelength range of emission light is 515-520 nm.

Further, the controller controls the temperature of the heating plate of the heating unit, and the temperature of the heating plate is regulated through the temperature signal received by the temperature sensor; the controller controls the collection sequence and frequency of the fluorescent collection unit detection assembly, controls the detection assembly to work and receives and stores fluorescent signals; the two-dimensional code scanner is connected to the portable nucleic acid amplification detection device, reads the two-dimensional code labels on the microfluidic nucleic acid amplification detection chip and the sampling tube, and transmits information to the controller.

Further, the length of the outer shell of the portable nucleic acid amplification detection device is 140-160mm, the width is 110-130mm, and the height is 100-120mm; the detection device is powered by a 24V direct current power supply or connected with a portable battery pack and is adapted to a vehicle-mounted power supply.

A method for performing nucleic acid amplification detection of virus, influenza a and influenza b by a portable nucleic acid amplification detection device, comprising the steps of:

step 1) taking out a microfluidic nucleic acid amplification detection chip, wherein Bst DNA polymerase, influenza A gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 1 of the chip; bst DNA polymerase, influenza B gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in the reaction chamber 2 of the chip; bst DNA polymerase, viral gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 3 of the chip; bst DNA polymerase, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 4 of the chip;

step 2), a two-dimensional code scanner scans two-dimensional codes of the sampling tube and the microfluidic nucleic acid amplification detection chip, and information in the sampling tube and the chip is input into a controller;

step 3) adding a nucleic acid extracting solution sample in a sampling tube into a sample inlet of a microfluidic nucleic acid amplification detection chip, and respectively entering a virus, influenza A and influenza B detection reaction chamber through a liquid inlet channel;

step 4), inserting the microfluidic nucleic acid amplification detection chip into a heating unit, rotating a guide column, compressing a spring, and clamping the detection chip by an upper heating plate and a lower heating plate of the heating unit under the action of the guide column and the spring;

step 5), the controller controls the heating temperature of the upper heating plate and the lower heating plate to be 37-70 ℃ and the heating time to be 20-40 minutes;

step 6), the controller controls the detection assembly of the fluorescence acquisition unit to sequentially emit excitation light sources from the lower direction of the detection holes of each reaction chamber, the excitation light wavelength is 490-495 nm, and fluorescence signals are received and stored;

and 7) fitting the obtained fluorescence signal data to obtain a reaction map.

By adopting the technical scheme, the invention has the following beneficial effects:

1) The microfluidic chip is used as a reaction carrier, so that the volume is small; the microfluidic chip is internally provided with a freeze-dried reagent, is of a fully-sealed structure, and has no risk of uncovering pollution after sample addition;

2) A plurality of reaction detection channels are arranged in the chip, so that the detection of a plurality of nucleic acid targets can be realized simultaneously, and the aim of multi-joint detection is fulfilled;

3) The heating unit is adapted to the shape of the micro-fluidic chip, the reaction part realizes the temperature control of comprehensive lamination, the heating area is smaller, and the heating speed and the temperature control precision are higher;

4) The whole machine is reduced in size, the purpose of portability is achieved, a portable battery pack can be used for power supply or the scene such as vehicle-mounted adaptation is achieved, and meanwhile, a plurality of microfluidic chips can be used for continuous detection, so that the detection efficiency is improved.

Drawings

FIG. 1 is a schematic diagram showing the construction of a trace nucleic acid amplification detecting apparatus of the present invention;

FIG. 2 is a schematic structural diagram of a microfluidic nucleic acid amplification detection chip of the present invention;

FIG. 3 is a schematic view of the structure of the heating unit of the present invention;

FIG. 4 is an exploded view of the structure of the heating unit of the present invention;

FIG. 5 is a schematic diagram of the structure of a fluorescence acquisition unit of the present invention;

FIG. 6 is a schematic representation of the experimental results of the present invention.

Wherein: 1. a microfluidic nucleic acid amplification detection chip; 101. a sample inlet; 102. a liquid inlet channel; 103. a reaction chamber; 104. ventilation holes; 201. an upper heating plate; 202. a lower heating plate; 203 springs; 204. a guide post; 205 a heat preservation layer; 206. a heating sheet; 207. a heat conducting layer; 208 gobos; 209. a temperature sensor; 3. a fluorescence acquisition unit; 301 excite the acquisition module.

Detailed Description

The present invention will be described in further detail with reference to the drawings and examples, in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the drawings and detailed description are only intended to illustrate the invention and are not intended to limit the invention.

Example 1

As shown in fig. 1-2, the invention provides a portable nucleic acid amplification detection device, which comprises a microfluidic nucleic acid amplification detection chip 1, a heating unit and a fluorescence acquisition unit. One sample inlet 101 in the microfluidic nucleic acid amplification detection chip is connected with a plurality of reaction chambers 103 through a plurality of liquid channels 102, and a nucleic acid extracting solution sample to be detected enters the reaction chambers from the sample inlet. The reaction chamber is sealed with fluorescent dye-dyed nucleic acid amplification reaction reagent and freeze-dried powder of nucleic acid amplification primer, so that the pre-embedding of the reagent for amplification experiment is realized without refrigerated transportation. The heating unit coats the reaction chamber, so that the heating temperature in the PCR experiment or isothermal amplification process is ensured, and the fluorescent signal in the reaction chamber is collected by the fluorescent collection unit.

The air holes 104 are arranged on the liquid inlet channel and/or the liquid outlet channel of the reaction chamber 103 of the microfluidic nucleic acid amplification detection chip, the air holes are used for removing air in the reaction chamber, the air pressure balance in the reaction chamber is kept during sample adding, and the chip can complete nucleic acid amplification and detection in a fully-closed mode, so that uncovering pollution is reduced.

Preferably, the reaction chambers of the microfluidic nucleic acid amplification detection chip are a plurality of, and the volume of the reaction chambers is 20-30 mu L. Multiple reaction chambers can realize multiple detection of different nucleic acids, so that the detection efficiency is improved, the reaction chambers are small in size, the sample consumption is reduced, and the detection precision is improved.

The length of the shell of the portable nucleic acid amplification detection device is 140-160mm, the width is 110-130mm, and the height is 100-120mm; the detection device adopts a 24V direct current power supply to supply power or is connected with a portable battery pack and an adaptive vehicle-mounted power supply, the power consumption is low, the maximum power is less than or equal to 50W, the instrument and the equipment are small in size and convenient to carry and use.

Example 2

As shown in fig. 3 and 4, the heating unit includes an upper heating plate 201 and a lower heating plate 202, in which the microfluidic nucleic acid amplification detection chip is inserted the reaction chamber 103, and the upper and lower heating plates are pressed together by a spring 203 and a guide column 204.

The upper heating plate coats the upper surface and the side surface of the reaction chamber, the lower heating plate coats the lower surface of the reaction chamber, so that the whole part of the reaction chamber is coated to the greatest extent, the heating unit only heats the part of the reaction chamber, and the whole chip is not heated, so that the heating efficiency is improved. The lower heating plate is provided with the light shielding sheet 208, the influence of ambient light or stray light on detection signals can be effectively avoided by the light shielding sheet, and the light shielding sheet and the lower heating plate are provided with detection holes corresponding to the positions of the reaction chambers for fluorescence detection.

The heat plate is equipped with heat preservation 205, heating plate 206, heat conduction layer 207 in proper order from outside to inside, and the heating plate adopts resistance wire or peltier temperature controller spare, buries temperature sensor 209 in the heat conduction layer inside, and the shape and the chip shape of heat conduction layer coincide, can keep the good heat cladding of chip, provides stable temperature environment, and the temperature of heat plate can carry out alternating temperature or constant temperature heating as required of experiment.

Example 3

As shown in fig. 5, the fluorescent collection unit 3 is disposed below the microfluidic nucleic acid amplification detection chip, the fluorescent collection unit is an array multi-channel single-wavelength excitation collection module 301, detection assemblies with the same number as the detection holes above are arranged on the module, and the position of each detection assembly is opposite to the detection hole above.

The detection component uses spectroscope to match with the filter, the wavelength range of excitation light is 490nm-495nm, and the wavelength range of emission light is 515nm-520nm.

The portable nucleic acid amplification detection device is characterized in that a controller controls the temperature of a heating plate of a heating unit, and the temperature of the heating plate is regulated by receiving a temperature signal of a temperature sensor; the controller controls the collection sequence and frequency of the fluorescent collection unit detection assembly, controls the detection assembly to work and receives and stores fluorescent signals. The two-dimensional code scanner is connected to the portable nucleic acid amplification detection device, reads the two-dimensional code labels on the microfluidic nucleic acid amplification detection chip and the sampling tube, and transmits information to the controller.

Example 4

A method for performing nucleic acid amplification detection of virus, influenza a and influenza b by a portable nucleic acid amplification detection device, comprising the steps of:

step 1) taking out a microfluidic nucleic acid amplification detection chip, wherein Bst DNA polymerase, influenza A gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 1 of the chip; bst DNA polymerase, influenza B gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in the reaction chamber 2 of the chip; bst DNA polymerase, viral gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 3 of the chip; bst DNA polymerase, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 4 of the chip;

influenza a primer nucleic acid sequence:

F3a GTCTTCTAACCGAGGTCGA

B3a CCCAAAATCCCCTTAGTCAG

FIPa AAGTCTCTGCGCGATCTCGGACGTACGTTCTCTCTATCGT

BIPa TCTTTGCAGGGAAGAACACCGTGACAGGATTGGTCTTGTCT

LFa CTTTGAGGGGGCCTGAC

LBa CGAGGCTCTCATGGAATGG

influenza B primer nucleic acid sequence:

F3b GCAGACATTGAAGATCTAACC

B3b GTGATTTATCTTTTGCATCATCTC

FIPb CGTAAATGCTTATGGGAAGCACTACTGCTCGTAGTATGGTCGT

BIPb TGTTGAAGAGTACTCTATGGTTGGGTCTTAATATGGAGACAGGTGT

LFb GCCACAGAGGGCCTAACA

LBb TACGAAGCCATGGCTCTTTACAA

viral primer nucleic acid sequence:

F3x TCAAGCCTCTTCTCGTTCCT

B3x AGTGACAGTTTGGCCTTGTT

FIPx GCAGGAGAAGTTCCCCTACTGCCATCACGTAGTCGCAACAGT

BIPx GCGGTGATGCTGCTCTTGCTTTGTTGGCCTTTACCAGACA

LFx TGCCTGGAGTTGAATTTCTTG

LBx TTGCTGCTGCTTGACAGA

step 2), a two-dimensional code scanner scans two-dimensional codes of the sampling tube and the microfluidic nucleic acid amplification detection chip, and information in the sampling tube and the chip is input into a controller;

step 3), adding a nucleic acid extracting solution sample in the sampling tube into a sample inlet of a microfluidic nucleic acid amplification detection chip, and respectively entering virus, influenza A and influenza B detection reaction chambers through a liquid inlet channel;

step 4), inserting the microfluidic nucleic acid amplification detection chip into a heating unit, and clamping the detection chip by an upper heating plate and a lower heating plate of the heating unit under the action of a guide column and a compression spring;

step 5) the controller controls the heating temperature of the upper heating plate and the lower heating plate to be 37-70 ℃, preferably 65 ℃ and the heating time to be 20-40min, preferably 30min;

step 6), the controller controls the fluorescent device of the fluorescent collection unit to sequentially emit excitation light sources from the lower direction of the detection holes of each reaction chamber, the excitation light wavelength is 490-495 nm, and fluorescence signals are received and stored;

and 7) fitting the obtained fluorescence signal data to obtain a reaction map.

FIG. 6 is a graph of experimental results, red, orange, and green amplification curves for virus, A stream, and B stream, respectively; blue line is the amplification curve of the negative control. From the results, the three curves of red, orange and green show that the fluorescence value is increased, and the detection sample is amplified; the blue line remained essentially horizontal, indicating that the negative control was normal. In the experiment, three target detection shows that an S-shaped amplification curve basically appears in 15min, which indicates that the amplification reaction of the target sequence occurs; while negative quality control remained at a level at all times, indicating that no non-specific amplification occurred. The inflection point time of the S-shaped curve is basically within 15min, which indicates that the detection can judge the detected target sequence in the time, and the instrument can rapidly realize the display of the detection result while being portable.

The foregoing examples merely illustrate embodiments of the invention and are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (11)

1. The portable nucleic acid amplification detection device comprises a microfluidic nucleic acid amplification detection chip, a heating unit and a fluorescence acquisition unit, and is characterized in that one sample inlet in the microfluidic nucleic acid amplification detection chip is connected with a plurality of reaction chambers through a plurality of liquid channels, fluorescent dye, nucleic acid amplification reaction reagent and freeze-dried powder of nucleic acid amplification primers are sealed in the reaction chambers, the heating unit coats the reaction chambers, and the fluorescence acquisition unit acquires fluorescent signals in the reaction chambers.

2. The portable nucleic acid amplification detection apparatus according to claim 1, wherein ventilation holes are provided in a liquid inlet channel and/or a liquid outlet channel of a reaction chamber of the microfluidic nucleic acid amplification detection chip.

3. The portable nucleic acid amplification detection device according to claim 1, wherein the number of reaction chambers of the microfluidic nucleic acid amplification detection chip is several, and the volume of the reaction chambers is 20-30 μl.

4. The portable nucleic acid amplification detection apparatus according to claim 1, wherein the heating unit comprises an upper heating plate and a lower heating plate, the reaction chamber of the microfluidic nucleic acid amplification detection chip is inserted therein, and the upper heating plate and the lower heating plate are pressed together by a spring and a guide column.

5. The portable nucleic acid amplification detection apparatus according to claim 4, wherein the upper heating plate covers the upper surface and the side surface of the reaction chamber, the lower heating plate covers the lower surface of the reaction chamber, a light shielding sheet is provided on the lower heating plate, and the light shielding sheet and the lower heating plate are provided with detection holes corresponding to the positions of the reaction chamber.

6. The portable nucleic acid amplification detection device according to claim 5, wherein the heating plate is provided with a heat preservation layer, a heating sheet and a heat conduction layer from outside to inside in sequence, the heating sheet adopts a resistance wire or Peltier temperature controller, a temperature sensor is buried in the heat conduction layer, and the shape of the heat conduction layer is consistent with that of the chip.

7. The portable nucleic acid amplification detection device according to claim 5, wherein the fluorescent collection unit is arranged below the microfluidic nucleic acid amplification detection chip, the fluorescent collection unit is an array multichannel single-wavelength excitation collection module, detection assemblies with the same number as the detection holes of the reaction chamber are arranged on the module, and the position of each detection assembly is opposite to the detection hole above.

8. The portable nucleic acid amplification detection apparatus of claim 7, wherein the detection module uses a spectroscope with an optical filter, the wavelength range of excitation light is 490nm to 495nm, and the wavelength range of emission light is 515nm to 520nm.

9. The portable nucleic acid amplification detection apparatus according to claim 1, wherein the temperature of the heating plate of the heating unit is controlled by the controller, and the temperature of the heating plate is adjusted by a temperature signal received by the temperature sensor; the controller controls the collection sequence and frequency of the fluorescent collection unit detection assembly, controls the detection assembly to work and receives and stores fluorescent signals; the two-dimensional code scanner is connected to the portable nucleic acid amplification detection device, reads the two-dimensional code labels on the microfluidic nucleic acid amplification detection chip and the sampling tube, and transmits information to the controller.

10. The portable nucleic acid amplification detection apparatus of claim 1, wherein the outer housing of the portable nucleic acid amplification detection apparatus has a length of 140-160mm, a width of 110-130mm, and a height of 100-120mm; the detection device is powered by a 24V direct current power supply or connected with a portable battery pack and is adapted to a vehicle-mounted power supply.

11. A method of nucleic acid amplification detection of viruses, influenza a and influenza b by a portable nucleic acid amplification detection apparatus as claimed in any of claims 1 to 10, comprising the steps of:

step 1) taking out a microfluidic nucleic acid amplification detection chip, wherein Bst DNA polymerase, influenza A gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 1 of the chip; bst DNA polymerase, influenza B gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in the reaction chamber 2 of the chip; bst DNA polymerase, viral gene primer, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 3 of the chip; bst DNA polymerase, dNTPs, mg2+ and fluorescent dye freeze-dried powder are packaged in a reaction chamber 4 of the chip;

step 2), a two-dimensional code scanner scans two-dimensional codes of the sampling tube and the microfluidic nucleic acid amplification detection chip, and information in the sampling tube and the chip is input into a controller;

step 3) adding a nucleic acid extracting solution sample in a sampling tube into a sample inlet of a microfluidic nucleic acid amplification detection chip, and respectively entering a virus, influenza A and influenza B detection reaction chamber through a liquid inlet channel;

step 4), inserting the microfluidic nucleic acid amplification detection chip into a heating unit, rotating a guide column, compressing a spring, and clamping the detection chip by an upper heating plate and a lower heating plate of the heating unit under the action of the guide column and the spring;

step 5), the controller controls the heating temperature of the upper heating plate and the lower heating plate to be 37-70 ℃ and the heating time to be 20-40 minutes;

step 6), the controller controls the detection assembly of the fluorescence acquisition unit to sequentially emit excitation light sources from the lower direction of the detection holes of each reaction chamber, the excitation light wavelength is 490-495 nm, and fluorescence signals are received and stored;

and 7) fitting the obtained fluorescence signal data to obtain a reaction map.

Images