CN116004911A - Test strip for detecting SARS-CoV-2 and its preparation and detection method - Google Patents

Test strip for detecting SARS-CoV-2 and its preparation and detection method Download PDF

Info

Publication number
CN116004911A
CN116004911A CN202211268972.XA CN202211268972A CN116004911A CN 116004911 A CN116004911 A CN 116004911A CN 202211268972 A CN202211268972 A CN 202211268972A CN 116004911 A CN116004911 A CN 116004911A
Authority
CN
China
Prior art keywords
aunp
dna
sequence
detection line
cov
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211268972.XA
Other languages
Chinese (zh)
Inventor
徐晓文
宋娟娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202211268972.XA priority Critical patent/CN116004911A/en
Publication of CN116004911A publication Critical patent/CN116004911A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a test strip for detecting SARS-CoV-2 and its preparation method and detection method. The test strip comprises a DNA hairpin mixture. The DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2; or D-H1, D-H2, om-H1 and Om-H2; the sequence is shown as SEQ ID NO. 1-8. The present invention provides a DNA hairpin mixture consisting of O-H1, O-H2, N-H1 and N-H2. The DNA hairpin mixture and the DNA modified gold nanoparticle are utilized, the ORF1ab and the N gene of SARS-CoV-2 are used as target models, visual SARS-CoV-2 detection is realized by a catalytic hairpin assembly method, and only one test strip can be used for detecting whether a sample to be detected contains SARS-CoV-2 virus. The detection method provided by the invention has the advantages of strong relative bit variability compared with the traditional detection method, high sensitivity, good color development effect, short detection period and simple operation steps, can detect the sample solution with the concentration of 500copies/ml in the actual sample detection, and can reach the visual effect, thereby providing a brand new thought and method for the detection of SARS-CoV-2 virus.

Description

Test strip for detecting SARS-CoV-2 and its preparation and detection method
Technical Field
The invention relates to a test strip for detecting SARS-CoV-2 and a preparation and detection method thereof, belonging to the technical field of biological detection.
Background
The novel coronavirus infection seriously threatens the health of human beings, and brings great influence to the daily life of people. The epidemic disease is caused by severe acute respiratory syndrome coronavirus (SARS-CoV-2), the SARS-CoV-2 is a single-stranded RNA virus belonging to the coronaviridae, and timely and reliable detection of the SARS-CoV-2 is of great importance for epidemic control and treatment of infectious agents. The currently prevailing detection method is the real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR). However, one limitation of RT-qPCR is that specialized and sophisticated equipment is required to perform accurate temperature changes to achieve amplification and monitor real-time fluorescence to obtain the cycling threshold. Reliance on large instruments requires more stringent sample storage and transport, eliminating the possibility of detection in time nearby. Especially in resource scarce areas, detection is more challenging due to the limited instrumentation. In addition, the extracted RNA sequence needs to be reverse transcribed into DNA and then amplified by a DNA polymerase. Together, these factors result in slower turn-around times and higher detection costs.
Recently, some isothermal amplification methods, which do not require specialized RT-qPCR instruments, were designed for SARS-CoV-2 detection. Representative include reverse transcription loop-mediated isothermal amplification (RT-LAMP), CRISPR system-assisted amplification and Rolling Circle Amplification (RCA), and the like. None of these methods require programmed temperature changes, where the output signal is mostly measured electrochemically, such as by current, impedance, or by fluorescence, such as fluorescence intensity, polarity, maximum fluorescence threshold time reached, etc., all requiring signal measurement equipment. Recently, colorimetry has been reported in which the results can be intuitively determined. For example, the DNA amplicon generated by the SARS-CoV-2 fragment triggering the RT-LAMP reaction can induce the solution to become acidic, as evidenced by a color change in the pH indicator. Alternatively, a DNA amplicon containing a SARS-CoV-2 fragment can bind Cas12a-gRNA ribonucleoprotein, activating its activity to cleave the hairpin transducer, then cross-link the gold nanoparticles into aggregates and cause a color change. These results can be visually observed by the color of the solution, but observing the generation of new colors in existing colors is not very sensitive to the eye and the solution needs to be measured with a spectrometer to achieve accurate quantification. Previous studies have shown that the color on the substrate is more sensitive to visual observation than the color in solution and that the intensity of the color can be calculated using a laptop or cell phone. In addition, the detection system in the solution has the potential of integration to facilitate the operator.
Lateral flow assays are platforms based on a dipstick assay in which a sample is moved across a membrane by capillary forces to detect and quantify an analyte. During the flow of the liquid sample, the pre-immobilized reagents at different parts of the strip become active and detection lines corresponding to the capture conjugates can be observed to be generated. The portable storage device has the advantages of no need of equipment, portability, convenience in use, low operation cost, stability in storage and the like. A detection strategy based on commercial pregnancy test paper and CRISPR-Cas12a mediated cleavage of gene fragments has recently been proposed. However, with existing pregnancy test strips, a cumbersome DNA re-modification step is required, such as the binding of the aminated DNA to human chorionic gonadotrophin. Sometimes, when the color of the detection line indicates that there is no result of the target object, the color may conflict with common sense. In addition, a method combining reverse transcriptase recombinase polymerase amplification, CRISPR/Cas9 and test strips is also established to detect viral genes. Reverse transcriptase does not have a proofreading function to check errors in newly synthesized DNA, and is therefore prone to errors, increasing the uncertainty in high fidelity reduction of RNA sequences. Immobilization of proteases on the test strips also increases costs, as well as requiring more stringent storage conditions and shorter shelf life.
Disclosure of Invention
The present invention provides a test strip for detecting SARS-CoV-2 and its preparation method and detection method.
A DNA hairpin mixture for detecting SARS-CoV-2, the DNA hairpin mixture consisting of O-H1, O-H2, N-H1 and N-H2; or D-H1, D-H2, om-H1 and Om-H2;
the sequence of the O-H1 is shown as SEQ ID NO. 1; the sequence of the O-H2 is shown as SEQ ID NO. 2;
the sequence of the N-H1 is shown as SEQ ID NO. 3; the sequence of the N-H2 is shown as SEQ ID NO. 4.
The sequence of the D-H1 is shown as SEQ ID NO. 5; the sequence of the D-H2 is shown as SEQ ID NO. 6;
the sequence of the Om-H1 is shown in SEQ ID NO. 7; the sequence of Om-H2 is shown in SEQ ID NO. 8.
According to the invention, preferably, the molar ratio of O-H1, O-H2, N-H1 and N-H2 is 1:1:1:1; the molar ratio of D-H1, D-H2, om-H1 and Om-H2 is 1:1:1.
A test strip for detecting SARS-CoV-2 comprises the DNA hairpin mixture.
According to the invention, the test strip comprises a bottom plate, and a sample pad, a bonding pad, a nitrocellulose membrane and absorbent paper which are sequentially jointed and attached to the bottom plate.
According to the invention, preferably, the binding pad is immobilized with DNA modified gold nanoparticles;
When the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the DNA modified gold nanoparticles are O-AuNP and C-AuNP modified gold nanoparticles, N-AuNP and C-AuNP modified gold nanoparticles;
when the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the DNA modified gold nanoparticles are D-AuNP and C-AuNP modified gold nanoparticles, om-AuNP and C-AuNP modified gold nanoparticles.
According to the invention, the sequence of the O-AuNP is preferably: 5'-SH-CGTATTCAAGGTTAT-3';
the sequence of the N-AuNP is as follows: 5'-SH-CTAGTCAATTGAACC-3';
the sequence of the C-AuNP is as follows: 5'-SH-GTCTCGGTTAGGTAC-3';
the sequence of the D-AuNP is as follows: 5'-SH-CCTATTCGAGTTTAT-3';
the Om-AuNP sequence is as follows: 5'-SH-CTAGCAATGGGGCGC-3';
further preferably, the DNA-modified gold nanoparticles are prepared according to the following method:
(1) Preparing aqueous solution of sodium citrate with concentration of 38.8mM and HAuCl with concentration of 1mM 4 An aqueous solution; HAuCl 4 The aqueous solution was heated to boiling and then the sodium citrate aqueous solution was added to HAuCl with stirring 4 In the aqueous solution, reacting for 10min under the heating and boiling state, stirring for 15min after the reaction is finished, cooling to 25 ℃, and filtering to obtain nano gold particles;
(2) Incubating O-AuNP, N-AuNP, D-AuNP, om-AuNP and C-AuNP with TCEP at 25deg.C for 2 hr to obtain treated O-AuNP, N-AuNP, D-AuNP, om-AuNP and C-AuNP;
(3) Uniformly mixing the treated O-AuNP, C-AuNP and gold nanoparticles, incubating for 16 hours at 25 ℃, adding 100 mu L of salt buffer solution, stirring for 24 hours after incubation, washing, and dispersing into Tris-HCl buffer solution to obtain O-AuNP and C-AuNP modified gold nanoparticles; and then obtaining the N-AuNP and C-AuNP modified gold nanoparticles, the D-AuNP and C-AuNP modified gold nanoparticles, the Om-AuNP and C-AuNP modified gold nanoparticles according to the same method.
According to a preferred embodiment of the present invention, in the step (2), the molar ratio of O-AuNP, N-AuNP, D-AuNP, om-AuNP, and C-AuNP to TCEP is 1:50.
According to a preferred embodiment of the present invention, in the step (3), the molar ratio of the O-AuNP, C-AuNP and nano-gold particles is 100:100:1; the molar ratio of the N-AuNP to the C-AuNP to the nano gold particles is 100:100:1; the molar ratio of the D-AuNP, the C-AuNP and the nano gold particles is 100:100:1; the molar ratio of Om-AuNP, C-AuNP and the gold nanoparticles was 100:100:1.
According to a preferred embodiment of the present invention, in step (3), the salt buffer composition is 57mM Tris-HCl, 2280mM NaCl, pH 8.0; the salt buffer is added in 10 times, and the time interval of each addition is 40min.
According to the invention, the nitrocellulose membrane is provided with a first detection line, a second detection line and a control line; the first detection line is fixed with a first DNA capturing chain; the second detection line is fixed with a second DNA capture chain; the control line is fixed with a DNA control chain.
The DNA capturing chain is a DNA capturing chain modified by 5' -end biotin, and is fixed by streptavidin to jointly form a DNA capturing chain-biotin-streptavidin structure.
According to the present invention, preferably, when the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the sequence of the first DNA capturing strand is: 5'-Biotin-GTGTTTCGCGTT-3'; the sequence of the second DNA capture strand is: 5'-Biotin-CCACTAACGCCC-3';
when the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the sequence of the first DNA capturing strand is: 5'-Biotin-CCACTATGACGT-3'; the sequence of the second DNA capture strand is: 5'-Biotin-GTGTTTCGGGTA-3';
the sequence of the DNA control strand is: 5'-Biotin-GTACCTAACCGAGAC-3'.
The method for detecting SARS-CoV-2 by using the test strip comprises the following steps:
a. taking a genome of a sample to be detected as a template, and performing RPA amplification in an amplification reaction system to obtain an amplification product; then incubating the amplified product and DNA hairpin mixture for 2h at 37 ℃ to obtain a sample to be detected
b. Dripping a sample to be tested on a sample pad to obtain a test paper color development result within 10 min;
when the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the first detection line, the second detection line and the control line are all red, and the sample to be detected contains SARS-CoV-2; the first detection line and the second detection line are not developed, the control line is developed red, and the sample to be detected does not contain SARS-CoV-2; only one of the first detection line and the second detection line is red, and resampling is needed for detection; the first detection line, the second detection line and the control line are not developed, and the test strip fails;
when the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the first detection line is red, the second detection line is not red, the control line is red, and the sample to be detected contains SARS-CoV-2 of the Delta variant strain; the first detection line does not develop color, the second detection line develops red, the control line develops red, and the sample to be tested contains SARS-CoV-2 of the Omicron variant strain; the first detection line, the second detection line and the control line are red, and the sample to be detected contains the Delta variant strain and the SARS-CoV-2 of the Omicron variant strain; the first detection line and the second detection line are not developed, the control line is red, and the sample to be detected does not contain a variant strain SARS-CoV-2; the first detection line, the second detection line and the control line are not developed, and the test strip fails.
According to a preferred embodiment of the present invention, in step a, the amplification primers are as follows:
F-primer：5'-GTTGTTGTTGGCCTTTACCAGACATTTTGCTCT-3'；
R-primer：5'-CCTGTGGGTTTTACACTTAAAAACACAGTCTGTA-3'。
according to a preferred embodiment of the present invention, in step a, when the DNA hairpin mixture consists of O-H1, O-H2, N-H1, N-H2, single strand treatment of the amplified product is required;
the single-chain treatment method comprises the following steps: adding NaOH into the amplified product, adding a target sequence with 3 base mutation, and finally adding a neutralizing solution to change a target region into a single chain; the target sequences of the 3-base mutation are a 3-base muted ORF1ab shown in SEQ ID No.13 and a 3-base muted N shown in SEQ ID No. 14;
according to a preferred embodiment of the invention, in step a, the RPA amplification system is: 2.4. Mu.L of 10. Mu.M forward and reverse primer, 29.5. Mu.L of TwistAmp Basic RPA buffer, 8.2. Mu.L of DNase/RNase-free water, 5. Mu.L of plasmid vector, 2.5. Mu.L of 280mM magnesium acetate solution in a total volume of 50. Mu.L. Specific amplification methods and conditions are referred to TwistAmp Liquid Basic Kit instructions.
According to a preferred embodiment of the invention, in step b, the final concentration of the DNA hairpin mixture in the sample to be tested is 20nM.
The detection principle and the technical characteristics of the invention are as follows:
as shown in FIG. 1, the inventors selected two RNA gene fragments ORF1ab and N from the SARS-CoV-2 virus genome open reading frame and nucleocapsid, the nucleotide sequences shown in SEQ ID No.9 and SEQ ID No.10, respectively. A DNA hairpin mixture consisting of O-H1, O-H2, N-H1 and N-H2 was then designed based on these two gene fragments.
ORF1ab reacts with the 5' overhanging end of the O-H1 hairpin by base pairing and opens it, exposing the sequence of the previously blocked stem region. The exposed sequence of O-H1 further reacts with the 5' overhanging end of O-H2, and hybridization of O-H2 with O-H1 progressively replaces ORF1ab. An O-H1/O-H2 duplex having a 3 'overhanging end of O-H1 and a 3' overhanging end of O-H2 is produced. The replaced ORF1ab was further reacted with another O-H1, inducing the next round of hybridization between O-H1 and O-H2. ORF1ab thus catalyzes the continuous assembly of O-H1 and O-H2 as a catalyst, resulting in the creation of a large number of double-stranded structures with two overhanging ends at both ends. Similarly, N acts as a catalyst to assemble a large number of N-H1 and N-H2 into an N-H1/N-H2 double strand with two overhanging ends. And the two reactions can be performed in quadrature, that is, by sequencing, one reaction does not interfere with the other.
Then, O-AuNP and C-AuNP modified gold nanoparticles, N-AuNP and C-AuNP modified gold nanoparticles, which are sequences complementary to the overhanging end of the O-H1/O-H2 double strand and the capturing strand on the control line, respectively, and sequences complementary to the overhanging end of the NH1/N-H2 double strand and the capturing strand on the control line, are immobilized on the binding pad. Meanwhile, the other ends of the O-H1/O-H2 double strand and the N-H1/N-H2 double strand are designed to be complementary to the capturing strands on the first detection line and the second detection line. The O-H1/O-H2 double strand and the N-H1/N-H2 double strand generated after the orthogonal CHA reaction play a bridge role, and the capture strand on the detection line and the DNA modified gold nanoparticles are respectively connected on the detection line, so that the gold nanoparticles accumulate and develop color. The color of the two detection lines indicates the presence of two RNA fragments, respectively. The DNA modified gold nanoparticles continue to flow and hybridize with the control strand on the control line, staining it, thereby verifying the integrity and effectiveness of the test strip.
Based on this principle, the inventors have selected Delta fragments (SEQ ID No. 11) and Omicron fragments (SEQ ID No. 12) from the genomes of Delta variant strains and Omicron variant strains, and designed DNA hairpin mixtures composed of D-H1, D-H2, om-H1 and Om-H2 based on these two fragments, so that it is possible to further distinguish whether SARS-CoV-2 is Delta variant strain or Omicron variant strain according to the above principle.
The beneficial effects of the invention are as follows:
1. the present invention provides a DNA hairpin mixture consisting of O-H1, O-H2, N-H1 and N-H2. The DNA hairpin mixture and the DNA modified gold nanoparticle are utilized, the ORF1ab and the N gene of SARS-CoV-2 are used as target models, visual SARS-CoV-2 detection is realized by a catalytic hairpin assembly method, and only one test strip can be used for detecting whether a sample to be detected contains SARS-CoV-2 virus. The detection method provided by the invention has the advantages of strong relative bit variability compared with the traditional detection method, high sensitivity, good color development effect, short detection period and simple operation steps, can detect the sample solution with the concentration of 500copies/ml in the actual sample detection, and can reach the visual effect, thereby providing a brand new thought and method for the detection of SARS-CoV-2 virus.
2. The invention provides a DNA hairpin mixture composed of D-H1, D-H2, om-H1 and Om-H2, and the DNA hairpin mixture and DNA modified gold nanoparticles are utilized to effectively solve the identification and differentiation problems of SARS-CoV-2 virus while detecting SARS-CoV-2 virus, thereby providing powerful information for the subsequent control of SARS-CoV-2 virus.
Drawings
FIG. 1 is a schematic diagram of the detection of double viral RNA fragments by the test strip of the present invention.
FIG. 2 is a polyacrylamide gel electrophoresis characterization of ORF1ab sequences and N sequences triggered by the catalytic hairpin assembly reaction and bridging of hybridized hairpin duplex.
In the figure, A is ORF1ab sequence; b is an N sequence; c is a hybridization hairpin double strand;
in a, lane 1: a DNA marker; lane 2: O-H1; lane 3: O-H2; lane 4: ORF1ab; lane 5: O-AuNP; lane 6: o-capture; lane 7: O-H1+O-H2; lane 8: O-H1+O-H2+ORF1ab; lane 9: O-H1+O-H2+ORF1ab+O-AuNP; lane 10: O-H1+O-H2+ORF1ab+O-capture; lane 11: O-H1+O-H2+ORF1ab+O-AuNP+O-capture;
in B, lane 1: DNAmarker; lane 2: N-H1; lane 3: N-H2; lane 4: n; lane 5: N-AuNP; lane 6: n-capture; lane 7: N-H1+N-H2; lane 8: n-h1+n-h2+n; lane 9: N-h1+n-h2+n+n-AuNP; lane 10: N-H1+N-H2+N+N-capture; lane 11: n-h1+n-h2+n+n-aunp+n-capture;
In C, lane 1: DNAmarker; lane 2: O-H1+O-H2; lane 3: O-H1+O-H2+ORF1ab; lane 4: O-H1+O-H2+N; lane 5: N-H1+N-H2; lane 6: N-H1+N-H2+ORF1ab; lane 7: n-h1+n-h2+n; lane 8: O-H1+O-H2+N-H; lane 9: O-H1+O-H2+N-H2+ORF 1ab; lane 10: O-H1+O-H2+N; lane 11: O-H1+O-H2+N-H2+ORF 1ab+N.
FIG. 3 is a polyacrylamide gel electrophoresis characterization of the catalytic hairpin assembly reactions of O-H2+O-H2+ORF 1ab and N-H2+N at different reaction times.
In the figure, A is O-H1+O-H2+ORF1ab; b is N-H1+N-H2+N
In a, lane 1: DNAmarker; lane 2:0h; lane 3:0.5h; lane 4:1h; lane 5:1.5h; lane 6:2h; lane 7:2.5h;
in B, lane 1: a DNA marker; lane 2:0h; lane 3:0.5h; lane 4:1h; lane 5:1.5h; lane 6:2h; lane 7:2.5h.
Fig. 4 is a photograph of ultraviolet-visible absorption spectrum (a), transmission electron microscope image (B) and AuNP solution (C) of AuNPs.
FIG. 5 is a graph of dynamic light scattering characterization of O-AuNP and C-AuNP modified gold nanoparticles, N-AuNP and C-AuNP modified gold nanoparticles.
FIG. 6 is a graph showing the detection results of test strips with different concentrations of target RNA sequences.
In the figure, A is a first group; b is a second group; c is a third group; d is the fourth group.
FIG. 7 is a graph showing the relative intensity of detection lines in a test strip using Image J software.
FIG. 8 single base mutant ORF1ab and N reacted with DNA hairpin mixtures consisting of O-H1, O-H2, N-H1 and N-H2.
In the figure, lane 1: a DNA marker; lane 2:1 base mutation ORF1ab; lane 3: O-H1; lane 4: O-H2; lane 5: O-H1+1 base mutation ORF1ab; lane 6: O-H1+O-H2+1 base mutation ORF1ab; lane 7:1 base mutation N; lane 8: N-H1; lane 9: N-H2; lane 10: N-H1+1-base mutation N; lane 11: N-H1+N-H2+1 base mutation N.
FIG. 9 is a polyacrylamide gel electrophoresis characterization of the Delta sequence and Omicon sequence triggered catalytic hairpin assembly reaction and bridging of hybridized hairpin duplex.
Lane 1: DNAmarker; lane 2: D-H1+D-H2; lane 3: D-H1+D-H2+Delta; lane 4: D-H1+D-H2+Omicron; lane 5: om-H2+Om-H2; lane 6: om-H2+Om-H2+Delta; lane 7: om-H1+Om-H2+Omicron; lane 8: D-H1+D-H2+Om-H1+Om-H2; lane 9: D-H1+D-H2+Om-H1+Om-H2+Delta; lane 10: D-H1+D-H2+Om-H1+Om-H2+Omicron; lane 11: D-H1+D-H2+Om-H1+Om-H2+Delta+Omicron.
FIG. 10 is a graph of test results of test strips for different samples to be tested.
In the figure, a is group 1; b is group 2; c is group 3; d is group 4; e is group 5.
Detailed Description
The invention will be further illustrated with reference to specific examples, but the scope of the invention is not limited thereto.
Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the invention are desired to be protected by the following claims.
Reagents and raw materials:
DNA and RNA sequences (Table S1) were synthesized and purified by Biotechnology Inc. (Shanghai, china).
Sample pads, conjugate pads, nitrocellulose membranes, absorbent paper were purchased from Shanghai gold standard biotechnology limited (Shanghai, china).
Chloroauric acid trihydrate (HAuCl) 4 ·3H 2 O), sodium citrate (Na 3 C 6 H 5 O 7 ·2H 2 O), tris (2-carboxyethyl) phosphine (TCEP) was purchased from Sigma-Aldrich corporation (Mitsui, USA).
Tris, streptavidin, tetrasodium ethylenediamine tetraacetate (EDTA) and 40% (w/v) acrylamide/methylene bisacrylamide solution (19:1) were supplied by the company of biotechnology limited (Shanghai, china).
Diethyl Dicarbonate (DEPC) was purchased from BBI life sciences (toronto, ontario, canada).
TwistAmpBasicKit RPA amplification kit was purchased from the company TwitDX (UK). All other reagents were analytical grade and used as received. The experiment was performed using ultrapure water (18.25 M.OMEGA.cm) obtained by an UP water purification system.
The film scribing and gold spraying were performed on an HM3035 XYZ three-dimensional film scribing gold spraying machine (Shanghai gold standard biotechnology limited). Test strip cutting was performed on a ZQ2002 microcomputer automatic chopper (Shanghai gold standard biotechnology limited).
DNA quantification was performed by recording UV-visible absorbance spectra on TU-1901 spectrometer (chromatography, china). Transmission Electron Microscopy (TEM) measurements (JEOL, japan) were performed with a JSM-6700F-type transmission electron microscope at an accelerating voltage of 200 kV. Polyacrylamide gels were imaged on a GelDocTM XR+ imaging system (Bio-RAD Laboratories Inc., USA).
Table 1, oligonucleotide sequences used in the examples
Figure SMS_1
/>
Figure SMS_2
In Table 1, the stem regions of all hairpins H1 and H2 are underlined, with the hairpin loop region between the two underlines. The portion of H1 that interacts with the corresponding target sequence is shown in italics. The mutant bases in ORF1ab and N are bolded. The deleted sequences in the Delta variant are shown in italics in Deltacontrol sequence. Deletions in Omicron variants are shown underlined in italics in Omicroncontrol sequence.
Example 1
The present invention selects two RNA gene fragments ORF1ab (SEQ ID No. 9) and N (SEQ ID No. 10) based on the SARS-CoV-2 virus genome information (NCBI reference sequence: NC_ 045512.2) already disclosed in NCBI database. Then, a DNA hairpin mixture composed of O-H1 (SEQ ID No. 1), O-H2 (SEQ ID No. 2), N-H1 (SEQ ID No. 3) and N-H2 (SEQ ID No. 4) was designed based on these two gene fragments.
Example 2
The sequences O-H1, O-H2, N-H1 and N-H2 were added to 1 XTNaK buffer (20mM Tris,140mM NaCl,5mM KCl,pH =7.5), heated at 95℃for 5min, and then slowly cooled to 25℃to give stable secondary structures of O-H1, O-H2, N-H1 and N-H2. Then, respectively incubating O-H1, O-H2, ORF1ab, O-capture, O-AuNP, N-H1, N-H2, N, N-capture and N-AuNP and combinations of the sequences in 1×TNaK buffer at 37 ℃ for 2 hours, and subjecting the incubated products to polyacrylamide gel electrophoresis characterization. Electrophoresis was run at 150v in 1 XTBE buffer for 5h, then the gel was stained and imaged, and the results are shown in FIG. 2.
As is clear from FIG. 2A, DNAmarker (lane 1), O-H1 (lane 2), O-H2 (lane 3), ORF1ab (lane 4), O-AuNP chain (lane 5), O-capture chain (lane 6,O-capture chain) were observed to be unable to interact with O-H1 and O-H2 (lane 7), but a much slower double strand was produced in the presence of ORF1ab (lane 8). The resulting O-H1/O-H2 double strand can hybridize either to the O-AuNP strand (lane 9) or to the O-capture strand (lane 10) with high efficiency. The double strand may further bridge the O-AuNP and O-capture strands together to form a complex with the slowest migration rate (lane 11).
As can be seen from FIG. 2B, the N-sequence triggered reaction between N-H1 and N-H2, and the bridging of the N-AuNP and N-capture chains by the N-H1/N-H2 double strand.
As can be seen from FIG. 2C, the reaction between O-H1 and O-H2 is triggered only by ORF1ab and not by N (lanes 2 to 4), the reaction between N-H1 and N-H2 is triggered only by N and not by ORF1ab, and furthermore O-H1 and O-H2 do not cross react with N-H1 and N-H2 (lane 8). In the presence of ORF1ab, N, or both (lanes 9 to 11), the mixture of all hairpins can still produce the respective CHA products.
Example 3
The sequences O-H1, O-H2 and ORF1ab were mixed in 1 XDNA K buffer and incubated at 37℃for 0, 0.5, 1, 1.5, 2, 2.5H, respectively, to give the incubation products O-H1/O-H2. The sequences N-H1, N-H2 and N were mixed in 1 XTNaK buffer and incubated at 37℃for 0, 0.5, 1, 1.5, 2 and 2.5H to give the incubation products N-H1/N-H2. The incubation products were then characterized by polyacrylamide gel electrophoresis. Electrophoresis was run at 150v in 1 XTBE buffer for 5h, then the gel was stained and imaged, and the results are shown in FIG. 3.
As can be seen from fig. 3, the number of hybridized duplexes gradually increased with increasing incubation time, and saturation was achieved at 2h for CHA reactions.
Example 4
1. The preparation method of the nano gold particles comprises the following steps:
10mL of aqueous sodium citrate solution with a concentration of 38.8mM was prepared, and 100mL of HAuCl with a concentration of 1mM was prepared 4 An aqueous solution; HAuCl 4 The aqueous solution was heated to boiling and then the sodium citrate aqueous solution was added rapidly to HAuCl with vigorous stirring 4 In the aqueous solution, the reaction is carried out for 10min under the heating and boiling state, the stirring is carried out for 15min after the reaction is finished, the cooling is carried out to 25 ℃, and the gold nanoparticle (AuNPs) is obtained by filtering through a 0.22 mu m filter.
And adding a drop of gold nanoparticle solution on the carbon-coated copper grid, and drying at room temperature to prepare a sample for TEM characterization. Characterization was performed on a JSM-6700F transmission electron microscope with an acceleration voltage of 200 kV.
The ultraviolet-visible absorption spectrum of AuNPs prepared in this example is shown in fig. 4A, a Transmission Electron Microscope (TEM) image is shown in fig. 4B, and a photograph of AuNPs solution is shown in fig. 4C.
2. The preparation methods of the O-AuNP and C-AuNP modified gold nanoparticles, the N-AuNP and C-AuNP modified gold nanoparticles are as follows:
(1) Incubating the O-AuNP, N-AuNP and C-AuNP with TCEP at 25 ℃ for 2h to obtain treated O-AuNP, N-AuNP and C-AuNP; the mol ratio of the O-AuNP, the N-AuNP and the C-AuNP to the TCEP is 1:50; the sequence of the O-AuNP is as follows: 5'-SH-CGTATTCAAGGTTAT-3'; the sequence of the N-AuNP is as follows: 5'-SH-CTAGTCAATTGAACC-3';
(2) Uniformly mixing the treated O-AuNP, C-AuNP and gold nanoparticles according to the molar ratio of 100:100:1, incubating for 16 hours at 25 ℃, adding 100 mu L of salt buffer solution, continuously slowly stirring for 24 hours, washing, and dispersing into Tris-HCl buffer solution to obtain the O-AuNP and C-AuNP modified gold nanoparticles.
Wherein the salt buffer solution comprises 57mM Tris-HCl, 2280mM NaCl and pH 8.0; the salt buffer is added in 10 times, and the time interval of each addition is 40min.
The dynamic light scattering characterization graphs of the O-AuNP and C-AuNP modified gold nanoparticles, and the N-AuNP and C-AuNP modified gold nanoparticles prepared in the embodiment are shown in FIG. 5.
Example 5
A test strip for detecting SARS-CoV-2 comprises a DNA hairpin mixture composed of O-H1, O-H2, N-H1 and N-H2 and a test strip. The molar ratio of O-H1, O-H2, N-H1 and N-H2 is 1:1:1. The test strip comprises a bottom plate, and a sample pad, a bonding pad, a nitrocellulose membrane and absorbent paper which are sequentially connected and attached to the bottom plate, wherein each part is connected and overlapped by 2mm.
The gold nanoparticles modified by O-AuNP and C-AuNP and the gold nanoparticles modified by N-AuNP and C-AuNP are fixed on the binding pad. The nitrocellulose membrane is provided with a first detection line, a second detection line and a control line, and the distance between each two lines is 0.2cm. The first detection line is fixed with a first DNA capturing chain; the second detection line is fixed with a second DNA capture chain; the control line is fixed with a DNA control chain. The DNA capturing chain is a DNA capturing chain modified by 5' -end biotin, and is fixed by streptavidin to jointly form a DNA capturing chain-biotin-streptavidin structure. The sequence of the first DNA capture strand (O-capture) is: 5'-Biotin-GTGTTTCGCGTT-3'; the sequence of the second DNA capture strand (N-capture) is: 5'-Biotin-CCACTAACGCCC-3'; the sequence of the DNA control strand (C-capture) is: 5'-Biotin-GTACCTAACCGAGAC-3'.
Wherein, the DNA modified gold nanoparticle is immobilized on the binding pad according to the following method: O-AuNP and C-AuNP modified gold nanoparticles containing 10% sucrose at a concentration of 40nM, N-AuNP and C-AuNP modified gold nanoparticles were sprayed on the conjugate pad at a concentration of 3. Mu.L/cm, and dried.
The first detection line, the second detection line and the control line are arranged on the nitrocellulose membrane according to the following method: 20. Mu.L of streptavidin with a concentration of 2mg/mL and 20. Mu.L of biotinylated sequence with a concentration of 100. Mu.M are mixed uniformly, incubated for 1h at 25 ℃, then the reaction solution is transferred into a 30kD ultrafiltration tube, and 90. Mu.L of 10mM PBS buffer is added for purification centrifugation (12000 rpm,25 min), followed by washing by centrifugation for 3 times, thereby obtaining a first DNA capturing strand, a second DNA capturing strand and a control strand biotinylated with streptavidin. The first DNA capture strand, the second DNA capture strand and the control strand biotinylated with streptavidin were respectively scored on nitrocellulose membranes at a concentration of 0.5. Mu.L/cm to form a first detection line, a second detection line and a control line.
Example 6
With ORF1ab and N as target sequences, 4 groups of gradient concentrations are set for detection by using the test strips prepared in example 5, wherein the first three groups of test strips are 8, and the fourth group of test strips are 4.
A first group: ORF1ab was found to be 0, 1.5, 1, 2, 3, 5, 8, 10nM per lane. N was 0nM per lane.
Second group: ORF1ab was 0nM per lane. N concentrations were 0, 1.5, 1, 2, 3, 5, 8, 10nM each.
Third group: ORF1ab was 0, 1.5, 1, 2, 3, 5, 8, 10nM per lane. N is 0, 1.5, 1, 2, 3, 5, 8, 10nM in each channel.
Fourth group: ORF1ab was 0, 3nM per lane. N is 0, 3, 0 and 3nM in each channel.
The specific detection method comprises the following steps:
a. uniformly mixing the samples to be tested with the concentrations from the first group to the fourth group with a DNA hairpin mixture of 20nM respectively to prepare reaction solutions, and incubating for 2h at 37 ℃ under a 1 XTNaK buffer condition;
b. the reaction solution was applied dropwise to the sample pad of the test strip prepared in example 5, and the test strip was developed within 10 minutes, and the result is shown in FIG. 6.
As can be seen from FIG. 6, as the concentration of ORF1ab increases, the first detection line appears red, and the color gradually deepens (FIG. 6A). This is because the number of O-H1/O-H2 double strands generated increases, bridging more O-AuNP and C-AuNP modified gold nanoparticles on the first detection line. When the ORF1ab concentration is as low as 500pM, a visible color can also be produced on the test line. Similarly, as the N concentration increases, the second detection line bridges more N-AuNP and C-AuNP-modified gold nanoparticles, the second detection line appears red and the color gradually deepens (fig. 6B). The control line always bridged the gold nanoparticle containing C-AuNP and thus always showed a red color.
If both ORF1ab and N were present, it could be observed that both lines were simultaneously red (FIG. 6C), indicating that the sample tested contained SARS-CoV-2 as a positive case. However, only one of the first detection line and the second detection line was red, and it was not possible to sufficiently contain SARS-CoV-2 in the sample, and positive cases were confirmed. It can only represent single gene positive, and needs resampling for detection according to the requirements of the national health committee of China. From FIG. 6D, it can be further confirmed that the first detection line is red only when ORF1ab is present and the second detection line is red only when N is present, indicating that the coloration of the detection lines has good agreement with the specific target RNA.
The detection result obtained in fig. 6 was subjected to relative intensity quantification by Image J software, and the result is shown in fig. 7. As can be seen from fig. 7, the intensity of the band color is also calculated conveniently by using Image J software, and the band color can be quantified more accurately according to the same trend of visual coloration, and such detection limit meets the need of diagnosing individuals with high transmission rate and early symptoms.
The relative intensity quantization formula is: relative intensity = detection line intensity/control line intensity.
Example 7
Polyacrylamide gel electrophoresis characterization results for one base mutated ORF1ab (1-base mutated ORF1 ab), N (1-base mutated N), O-H1, O-H2, N-H1 and N-H2, and combinations of these sequences, are shown in FIG. 10, following the procedure described in example 2.
As can be seen from FIG. 8, the method of the present invention can distinguish single nucleotide polymorphisms that are difficult to detect by some isothermal amplification methods, effectively suppressing hybridization of mismatched base strands.
Example 8
1. The inventors selected the Delta fragment (SEQ ID No. 11) and the Omacron fragment (SEQ ID No. 12) of the Delta variant strain (NCBI reference sequence: MZ 635674.1) and the Omacron variant strain (NCBI reference sequence: OM 059386.1) genomes, and designed a DNA hairpin mixture consisting of D-H1 (SEQ ID No. 5), D-H2 (SEQ ID No. 6), om-H1 (SEQ ID No. 7) and Om-H2 (SEQ ID No. 8) based on these two fragments.
The results of polyacrylamide gel electrophoresis characterization of the Delta fragments, omacron fragments, D-H1, D-H2, om-H1 and Om-H2, and combinations of these sequences, were then performed as described in example 2, and are shown in FIG. 8.
As can be seen from FIG. 9, D-H1, D-H2, om-H1 and Om-H2 achieve orthogonal CHA reactions of Delta fragments and Omicon fragments, and variant strains of Delta and Omicon of SARS-CoV-2 virus can be identified based on the same principle using D-H1, D-H2, om-H1 and Om-H2.
2. D-AuNP and C-AuNP modified gold nanoparticles, om-AuNP and C-AuNP modified gold nanoparticles were prepared according to the method described in example 4.
A test strip for detecting SARS-CoV-2 comprises a DNA hairpin mixture composed of D-H1, D-H2, om-H1 and Om-H2 and a test strip. The molar ratio of D-H1, D-H2, om-H1 and Om-H2 is 1:1:1. The test strip comprises a bottom plate, and a sample pad, a bonding pad, a nitrocellulose membrane and absorbent paper which are sequentially connected and attached to the bottom plate, wherein each part is connected and overlapped by 2mm.
The gold nanoparticles modified by O-AuNP and C-AuNP and the gold nanoparticles modified by N-AuNP and C-AuNP are fixed on the binding pad. The nitrocellulose membrane is provided with a first detection line, a second detection line and a control line, and the distance between each two lines is 0.2cm. The first detection line is fixed with a first DNA capturing chain; the second detection line is fixed with a second DNA capture chain; the control line is fixed with a DNA control chain. The DNA capturing chain is a DNA capturing chain modified by 5' -end biotin, and is fixed by streptavidin to jointly form a DNA capturing chain-biotin-streptavidin structure. The sequence of the first DNA capture strand (D-capture) is: 5'-Biotin-CCACTATGACGT-3'; the sequence of the second DNA capture strand (Om-capture) is: 5'-Biotin-GTGTTTCGGGTA-3'. The remainder was identical to the test strip described in example 5.
Example 9
1. The test strip described in example 5 is used for detection, the number of test strips is 5, and the detection samples are as follows:
group 1: lanes 1 are buffers, lanes 2 are ORF1ab and N, lanes 3 are one base mutated ORF1ab (1-base mutated ORF1 ab) and N (1-base mutated N), lanes 4 are two base mutated ORF1ab (2-base mutated ORF1 ab) and N (2-base mutated N), lanes 5 are three base mutated ORF1ab (3-base mutated ORF1 ab) and N (3-base mutated N), and the concentration of each lane is 3nM.
The detection method is the same as that described in example 6, and the detection result is shown in FIG. 10A.
2. Set 2 to-be-detected samples, detect by using the test strip described in embodiment 8, wherein the test strip is 4 channels, and the detection samples are as follows:
group 2: lanes 1 are buffer, lanes 2 are Delta (SEQ ID No. 11), lanes 3 are Omicron (SEQ ID No. 12), lanes 4 are Delta and Omicron, and the concentration of each lane is 3nM.
The detection method is the same as that described in example 6, and the detection result is shown in FIG. 10B.
3. Set 3 samples to be detected, detect using the test strip described in example 5, the test strip is 7 channels, and the detection samples are specifically as follows:
group 3: lanes 1 are buffer, 2 are Delta,3 are Delta sequences that are not deleted from the non-variant strain (Delta control sequence), 4 are Omicron,5 are Omicron sequences that are not deleted from the non-variant strain (Omicron control sequence), 6 are Delta and Omicron,7 are Delta sequences that are not deleted from the non-variant strain and Omicron sequences that are not deleted from the non-variant strain (Delta control sequence and Omicron control sequence), each at a concentration of 3nM.
The detection method was the same as that described in example 6, and the detection result is shown in FIG. 10C.
4. Set 4 to-be-detected samples, use the test strip described in example 5 after 6 months of storage for detection, the test strip is 2 channels, and the detection samples are as follows:
group 4: lanes 1 are buffer, lanes 2 are ORF1ab and N, each at a concentration of 3nM.
The detection method was the same as that described in example 6, and the detection result is shown in FIG. 10D.
5. Set 5 to-be-detected samples, detect by using the test strip described in embodiment 5, wherein the number of test strips is 2, and the detection samples are as follows:
group 5: lane 1 is buffer, lane 2 is SARS-CoV-2 virus mimic, at a concentration of 500copies/ml.
The detection method of the group is as follows:
a. taking a genome of a sample to be detected as a template, performing RPA amplification in an amplification reaction system, adding 2 mu L of 3M NaOH into 5 mu L of amplification products to react for 20min, adding 1 mu L of 500nM 3-base muted ORF1ab (SEQ ID No. 13) and 1 mu L of 500nM 3-base muted N (SEQ ID No. 14), and finally adding 5 mu L of 1M Tris-HCl neutralization solution (pH 8.0) to change a target region into single strands to obtain an amplification product after single-strand treatment; uniformly mixing the single-stranded amplification product with 20nM DNA hairpin mixture composed of O-H1, O-H2, N-H1 and N-H2 to prepare reaction solution, and incubating at 37 ℃ for 2H under 1 XTNaK buffer condition;
b. And (3) dripping the sample to be detected on a sample pad, and obtaining a test paper color development result within 10min, wherein the detection result is shown in fig. 10E.
The RPA amplification system is as follows: 2.4. Mu.L of 10. Mu.M forward and reverse primer, 29.5. Mu.L of TwistAmp Basic RPA buffer, 8.2. Mu.L of DNase/RNase-free water, 5. Mu.L of plasmid vector, 2.5. Mu.L of 280mM magnesium acetate solution, and the total volume was 50. Mu.L and amplified at 37℃for 30min. Specific amplification methods and conditions are referred to TwistAmp Liquid Basic Kit instructions.
The SARS-CoV-2 virus mimic is obtained according to the following method:
synthesis of a sequence containing the ORF1ab (SEQ ID No. 9) length: 5'-CTACAGCCATAACCTTTCCACATACCGCAGACGGTACAGACTGTGTTTTTAAGTGTAAAACCCACAGG-3' and a long sequence comprising N (SEQ ID No. 10): 5'-GTTGTTGTTGGCCTTTACCAGACATTTTGCTCTCAAGCTGGTTCAATCTGTCAAGCAGCAGCAAAGCAAGAGCAGCATCACCGCCATTGCCAGCCATTCTAGCAGGAGAACTTCCCC-3'. These two sequences were then constructed on pUC57 vector to form recombinant plasmid (both sequence synthesis and recombinant plasmid were completed by Shanghai Biotechnology Co., ltd.) exceeding 2900 base, which was used as SARS-CoV-2 virus mimetic.
As can be seen from FIG. 10A, the two detection lines only appear red in the presence of the target ORFs 1ab and N, but do not appear colored in the presence of any mutant sequence.
As can be seen from FIG. 10B, the first detection line is red in the presence of Delta strain RNA (SEQ ID No. 11), the second detection line is red in the presence of Omacron strain RNA (SEQ ID No. 12), or both detection lines are red in the presence of both variants. Therefore, the test strip provided by the invention can also realize detection of different strain types.
As can be seen from FIG. 10C, the SARS-CoV-2 virus RNA fragment without base deletion (Delta control sequence and Omicron control sequence) was detected using the test strip described in example 8, neither detection line developed.
As can be seen from FIG. 10D, the test strip described in example 5 also indicated the presence of ORF1ab or N gene fragment well after 6 months of storage, allowing for the detection of SARS-CoV-2 virus. This is due to the good stability of the DNA modified AuNPs and the preservation of the original state of the DNA oligonucleotides in the band.
As can be seen from FIG. 10E, the test strip prepared by the invention can effectively detect SARS-CoV-2 virus containing ORF1ab and N fragments, and the SARS-CoV-2 virus mimic with a concentration of 500copies/mL can be detected by naked eyes, has high sensitivity equivalent to RT-qPCR, and does not depend on special equipment.

Claims (10)

1. A DNA hairpin mixture for detecting SARS-CoV-2, characterized in that the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2; or D-H1, D-H2, om-H1 and Om-H2;
The sequence of the O-H1 is shown as SEQ ID NO. 1; the sequence of the O-H2 is shown as SEQ ID NO. 2;
the sequence of the N-H1 is shown as SEQ ID NO. 3; the sequence of the N-H2 is shown as SEQ ID NO. 4;
the sequence of the D-H1 is shown as SEQ ID NO. 5; the sequence of the D-H2 is shown as SEQ ID NO. 6;
the sequence of the Om-H1 is shown in SEQ ID NO. 7; the sequence of Om-H2 is shown in SEQ ID NO. 8.
2. The DNA hairpin mixture of claim 1, wherein the molar ratio of O-H1, O-H2, N-H1 and N-H2 is 1:1:1; the molar ratio of D-H1, D-H2, om-H1 and Om-H2 is 1:1:1.
3. A test strip for detecting SARS-CoV-2 comprising the DNA hairpin mixture of claim 1.
4. The test strip of claim 3, wherein the test strip comprises a base plate, and a sample pad, a binding pad, a nitrocellulose membrane and a bibulous paper sequentially attached to the base plate.
5. The test strip of claim 3, wherein DNA-modified gold nanoparticles are immobilized on the conjugate pad;
when the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the DNA modified gold nanoparticles are O-AuNP and C-AuNP modified gold nanoparticles, N-AuNP and C-AuNP modified gold nanoparticles;
When the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the DNA modified gold nanoparticles are D-AuNP and C-AuNP modified gold nanoparticles, om-AuNP and C-AuNP modified gold nanoparticles.
6. The strip of claim 5, wherein the O-AuNP has the sequence: 5'-SH-CGTATTCAAGGTTAT-3';
the sequence of the N-AuNP is as follows: 5'-SH-CTAGTCAATTGAACC-3';
the sequence of the C-AuNP is as follows: 5'-SH-GTCTCGGTTAGGTAC-3';
the sequence of the D-AuNP is as follows: 5'-SH-CCTATTCGAGTTTAT-3';
the Om-AuNP sequence is as follows: 5'-SH-CTAGCAATGGGGCGC-3';
the DNA modified gold nanoparticle is prepared according to the following method:
(1) Preparing aqueous solution of sodium citrate with concentration of 38.8mM and HAuCl with concentration of 1mM 4 An aqueous solution; HAuCl 4 Heating the aqueous solution toBoiling, then adding sodium citrate aqueous solution to HAuCl while stirring 4 In the aqueous solution, reacting for 10min under the heating and boiling state, stirring for 15min after the reaction is finished, cooling to 25 ℃, and filtering to obtain nano gold particles;
(2) Incubating O-AuNP, N-AuNP, D-AuNP, om-AuNP and C-AuNP with TCEP at 25deg.C for 2 hr to obtain treated O-AuNP, N-AuNP, D-AuNP, om-AuNP and C-AuNP;
(3) Uniformly mixing the treated O-AuNP, C-AuNP and gold nanoparticles, incubating for 16 hours at 25 ℃, adding 100 mu L of salt buffer solution, stirring for 24 hours after incubation, washing, and dispersing into Tris-HCl buffer solution to obtain O-AuNP and C-AuNP modified gold nanoparticles; and then obtaining the N-AuNP and C-AuNP modified gold nanoparticles, the D-AuNP and C-AuNP modified gold nanoparticles, the Om-AuNP and C-AuNP modified gold nanoparticles according to the same method.
7. The test strip of claim 6, wherein in step (2), the molar ratio of O-AuNP, N-AuNP, D-AuNP, om-AuNP and C-AuNP to TCEP is 1:50;
in the step (3), the molar ratio of the O-AuNP, the C-AuNP and the nano-gold particles is 100:100:1; the molar ratio of the N-AuNP to the C-AuNP to the nano gold particles is 100:100:1; the molar ratio of the D-AuNP, the C-AuNP and the nano gold particles is 100:100:1; the molar ratio of Om-AuNP, C-AuNP and the gold nanoparticles was 100:100:1.
8. The test strip of claim 3, wherein the nitrocellulose membrane is provided with a first detection line, a second detection line, and a control line; the first detection line is fixed with a first DNA capturing chain; the second detection line is fixed with a second DNA capture chain; the control line is fixed with a DNA control chain;
The DNA capturing chain is a DNA capturing chain modified by 5' -end biotin, and is fixed by streptavidin to jointly form a DNA capturing chain-biotin-streptavidin structure;
when the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the sequence of the first DNA capture strand is: 5'-Biotin-GTGTTTCGCGTT-3'; the sequence of the second DNA capture strand is: 5'-Biotin-CCACTAACGCCC-3';
when the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the sequence of the first DNA capturing strand is: 5'-Biotin-CCACTATGACGT-3'; the sequence of the second DNA capture strand is: 5'-Biotin-GTGTTTCGGGTA-3';
the sequence of the DNA control strand is: 5'-Biotin-GTACCTAACCGAGAC-3'.
9. A method for detecting SARS-CoV-2 using the test strip of claim 1, comprising the steps of:
a. taking a genome of a sample to be detected as a template, and performing RPA amplification in an amplification reaction system to obtain an amplification product; then incubating the amplified product and DNA hairpin mixture for 2h at 37 ℃ to obtain a sample to be detected
b. Dripping a sample to be tested on a sample pad to obtain a test paper color development result within 10 min;
when the DNA hairpin mixture consists of O-H1, O-H2, N-H1 and N-H2, the first detection line, the second detection line and the control line are all red, and the sample to be detected contains SARS-CoV-2; the first detection line and the second detection line are not developed, the control line is developed red, and the sample to be detected does not contain SARS-CoV-2; only one of the first detection line and the second detection line is red, and resampling is needed for detection; the first detection line, the second detection line and the control line are not developed, and the test strip fails;
When the DNA hairpin mixture consists of D-H1, D-H2, om-H1 and Om-H2, the first detection line is red, the second detection line is not red, the control line is red, and the sample to be detected contains SARS-CoV-2 of the Delta variant strain; the first detection line does not develop color, the second detection line develops red, the control line develops red, and the sample to be tested contains SARS-CoV-2 of the Omicron variant strain; the first detection line, the second detection line and the control line are red, and the sample to be detected contains the Delta variant strain and the SARS-CoV-2 of the Omicron variant strain; the first detection line and the second detection line are not developed, the control line is red, and the sample to be detected does not contain a variant strain SARS-CoV-2; the first detection line, the second detection line and the control line are not developed, and the test strip fails.
10. The method of claim 9, wherein in step a, the amplification primers are as follows:
F-primer：5'-GTTGTTGTTGGCCTTTACCAGACATTTTGCTCT-3'；
R-primer：5'-CCTGTGGGTTTTACACTTAAAAACACAGTCTGTA-3'；
when the DNA hairpin mixture consists of O-H1, O-H2, N-H1, N-H2, single strand treatment of the amplified product is required;
the single-chain treatment method comprises the following steps: adding NaOH into the amplified product, adding a target sequence with 3 base mutation, and finally adding a neutralizing solution to change a target region into a single chain; the target sequences of the 3-base mutation are a 3-base muted ORF1ab shown in SEQ ID No.13 and a 3-base muted N shown in SEQ ID No. 14;
The RPA amplification system is as follows: 2.4. Mu.L of 10. Mu.M forward and reverse primer, 29.5. Mu.L of TwistAmp Basic RPA buffer, 8.2. Mu.L of DNase/RNase-free water, 5. Mu.L of plasmid vector, 2.5. Mu.L of 280mM magnesium acetate solution in a total volume of 50. Mu.L;
in step b, the final concentration of the DNA hairpin mixture in the sample to be tested is 20nM.
CN202211268972.XA 2022-10-17 2022-10-17 Test strip for detecting SARS-CoV-2 and its preparation and detection method Pending CN116004911A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211268972.XA CN116004911A (en) 2022-10-17 2022-10-17 Test strip for detecting SARS-CoV-2 and its preparation and detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211268972.XA CN116004911A (en) 2022-10-17 2022-10-17 Test strip for detecting SARS-CoV-2 and its preparation and detection method

Publications (1)

Publication Number Publication Date
CN116004911A true CN116004911A (en) 2023-04-25

Family

ID=86021797

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211268972.XA Pending CN116004911A (en) 2022-10-17 2022-10-17 Test strip for detecting SARS-CoV-2 and its preparation and detection method

Country Status (1)

Country Link
CN (1) CN116004911A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112981008A (en) * 2021-04-20 2021-06-18 中国人民解放军陆军特色医学中心 Primer group, probe group and kit for multiple recombinase polymerase amplification technology for detecting novel coronavirus
CN114875178A (en) * 2022-05-11 2022-08-09 山东大学 SARS-CoV-2 detecting system and detecting method based on hybrid chain reaction
CN115058543A (en) * 2022-06-28 2022-09-16 中国医学科学院医学生物学研究所 Primer group and kit for identifying Delta variant strain and Omicron variant strain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112981008A (en) * 2021-04-20 2021-06-18 中国人民解放军陆军特色医学中心 Primer group, probe group and kit for multiple recombinase polymerase amplification technology for detecting novel coronavirus
CN114875178A (en) * 2022-05-11 2022-08-09 山东大学 SARS-CoV-2 detecting system and detecting method based on hybrid chain reaction
CN115058543A (en) * 2022-06-28 2022-09-16 中国医学科学院医学生物学研究所 Primer group and kit for identifying Delta variant strain and Omicron variant strain

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HONGXIA LI等: "Highly sensitive and portable mRNA detection platform for early cancer detection", JOURNAL OF NANOBIOTECHNOLOGY, vol. 19, no. 1, 26 September 2021 (2021-09-26), pages 2 - 3 *
康青等: "基于恒温扩增与发夹自组装双重信号放大技术对单增李斯特菌检测研究", 2021年中国食品科学技术学会第十八届年会, 28 June 2022 (2022-06-28) *

Similar Documents

Publication Publication Date Title
JP5951755B2 (en) Improved quantitative nuclease protection assay (qNPA) and quantitative nuclease protection sequencing (qNPS) methods
CN111455114B (en) High flux detection kit for SARS-CoV-2
CN1981052A (en) Detection of chromosomal disorders
CN107532213B (en) Method for simultaneously detecting multiple nucleic acid sequences in a sample
JP2905283B2 (en) Method for detecting human papillomavirus and oligonucleotides used therein
US20140017692A1 (en) Method and kit for detecting target nucleic acid
US20110294125A1 (en) Colorimetric biosensor with allosteric dnazyme activation and rolling circle signal amplification
CN107164541A (en) Many cross substitutions amplification of AUDG mediations combines the nucleic acid detection technique of bio-sensing
CN110551607A (en) mycobacterium tuberculosis drug-resistant gene multiple detection method based on RCA amplification
Li et al. Dual enzyme-assisted one-step isothermal real-time amplification assay for ultrasensitive detection of polynucleotide kinase activity
CA3067868A1 (en) Molecular fingerprinting methods to detect and genotype dna targets through polymerase chain reaction
CA3073954A1 (en) Nicking and extension amplification reaction (near) of respiratory syncytial virus species
CN104263827A (en) Novel probe design method for ligase reaction
CN116287129B (en) Ultra-short chain miRNA detection method and system based on reverse-folded crRNA
CN114875178B (en) SARS-CoV-2 detection system and method based on hybridization chain reaction
CN112359143A (en) Isothermal index amplification method based on Y-type probe set and application thereof
CN116004911A (en) Test strip for detecting SARS-CoV-2 and its preparation and detection method
EP3642359B1 (en) Methods for dna targets detection directly in crude samples through polymerase chain reaction and genotyping via high resolution melting analysis
KR20070100531A (en) Method for increasing the specificity of nucleic acid hybridization using zwitterionic compounds
CN114875180A (en) DNA walker for SARS-CoV-2 detection and its preparation method
KR102309189B1 (en) Multivalent Nucleic Acid Nanostructure for Nucleic Acids Detection and High-sensitive Nucleic Acid Probing Using The Same
EP3966346B1 (en) Combined solution phase and solid phase dna amplification
Long et al. MSSRCA Powered Sensitive Point-of-Care Detection of HPV mRNA for Cervical Cancer Screening
CN112176089B (en) System and method for identifying single nucleotide polymorphism of panax plants
US20240117414A1 (en) Sequence conversion and signal amplifier dna having abasic nucleic acids, and detection methods using same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination