CN114875180A - DNA walker for SARS-CoV-2 detection and its preparation method - Google Patents

DNA walker for SARS-CoV-2 detection and its preparation method Download PDF

Info

Publication number
CN114875180A
CN114875180A CN202210617332.9A CN202210617332A CN114875180A CN 114875180 A CN114875180 A CN 114875180A CN 202210617332 A CN202210617332 A CN 202210617332A CN 114875180 A CN114875180 A CN 114875180A
Authority
CN
China
Prior art keywords
chain
cov
sars
locked
walking
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210617332.9A
Other languages
Chinese (zh)
Inventor
徐晓文
葛婧雯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210617332.9A priority Critical patent/CN114875180A/en
Publication of CN114875180A publication Critical patent/CN114875180A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a DNA walker for SARS-CoV-2 detection and its preparation method. The DNA walker for SARS-CoV-2 detection comprises a walking chain W, a locked chain L1, a locked chain L2, a track chain Tr, a target chain T1, a target chain T2 and a nanogold particle. The invention also provides a preparation method of the DNA walker and a method for detecting SARS-CoV-2 by using the DNA walker. The DNA walker provided by the invention realizes visual SARS-CoV-2 detection, has the advantages of less interference factors, low price and good stability, and simultaneously the sensitivity can reach 1 nM. When the DNA walker or the kit is used for detection, a reverse transcription step is not needed, the use of enzyme, mark or modification is avoided, the result is visualized, the requirement on complex equipment is reduced, and a convenient, economic, rapid and reliable method is provided for SARS-CoV-2 virus detection.

Description

DNA walker for SARS-CoV-2 detection and its preparation method
Technical Field
The invention relates to a DNA walker for SARS-CoV-2 detection and a preparation method thereof, belonging to the technical field of biological detection.
Background
Since its first appearance, the new form of coronavirus pneumonia (COVID-19) has spread rapidly and is a global pandemic, posing a serious threat to public health. It is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV-2 is a single-stranded RNA virus belonging to the family Coronaviridae. The disease is mainly transmitted through respiratory droplets and contact, and has high infectivity. The rapid and reliable detection of SARS-CoV-2 is critical to prevent spread of the epidemic and to treat infection cases early. At present, the conventional detection method for SARS-CoV-2 is reverse transcription quantitative polymerase chain reaction (RT-qPCR). However, this method requires specialized equipment for cyclic adjustment of the reaction temperature and real-time monitoring of fluorescence, and requires specialized training of the operator. And due to the limitations of qPCR detection equipment, the timeliness and enormous detection volume of detection present challenges, especially in routine or large-scale detection. Meanwhile, the turn-around time of RT-qPCR detection is slow, and viral RNA should be reverse transcribed into complementary DNA before PCR. The reliability of RT-qPCR may also be affected by false positive results from non-specific amplification of environmental contaminants or false negative results from the presence of amplification inhibitors.
In view of the shortcomings of RT-qPCR, isothermal amplification methods have recently emerged for SARS-CoV-2 detection without the need for complex thermal cyclers. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) using DNA polymerase and several primers for recognizing different regions of the viral genome has been developed. In addition, based on the nonspecific side chain ssDNAse activity of the Cas protein when the target sequence binds under the direction of CRISPR RNA, the CRISPR-Cas system has also been applied to the detection of SARS-CoV-2 sequence. Although amplification can be performed at a single temperature, the signal is typically output in the form of fluorescence, meaning that at least an excitation light source is required. In order to make the signal easier to measure and even to be able to visualize the result, colorimetric methods have recently also emerged for detection. RT-LAMP based detection of SARS-CoV-2 transduces the signal into a color change by a pH indicator that reacts to acidic solutions from the amplified DNA molecules, or by staining the band by capturing protein-labeled DNA associated with RT-LAMP amplification. In addition, SARS-CoV-2 detection based on CRISPR-Cas, the output signal is transduced into color change caused by gold nanoparticle aggregation. However, in these methods, isothermal amplification requires a protease, which increases costs, requires strict storage conditions, and involves a risk of inactivation of the protein. And RNA still requires reverse transcription due to the unique activity of enzymes on DNA substrates. Meanwhile, since amplification is induced by single-sequence binding, only one target nucleic acid fragment can be detected at a time, and the efficiency of confirming positive cases is low.
Recently, the DNA molecular machinery has shown promise in biomarker detection with its biocompatibility, flexibility and integrity. The DNA walker is a DNA molecular machine which can walk step by step when being stimulated. Such spontaneous walking is considered to be an inherent way of signal amplification, as one recognition will result in repeated walking, which contributes to signal accumulation. The DNA walker may move on a one-dimensional linear orbit, a two-dimensional planar orbit, and a three-dimensional spherical orbit. For three-dimensional DNA walkers, it not only integrates the components into one nanoparticle or microparticle, but also confers nuclease resistance to the immobilized oligonucleotide due to the increase in local salt concentration around the particle. On the other hand, the DNA logic gate can analyze a plurality of inputs and respond to the output by boolean logic operation, providing convenience for handling different situations of the target. Various logic systems can be flexibly designed according to detection needs, such as an "AND" logic gate that outputs only a logic true value or obtains a signal if both inputs are present.
Therefore, it is urgently needed to develop a convenient, economical and rapid SARS-CoV-2 detection method.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a DNA walker for SARS-CoV-2 detection and a preparation method thereof.
A DNA walker for SARS-CoV-2 detection comprises a walking chain W, a locked chain L1, a locked chain L2, a track chain Tr, a target chain T1, a target chain T2 and nano gold particles;
the nucleotide sequence of the walking chain W is as follows: 5' -HS- (T) 42 TGGTTCAATCTGTCAATCTCTTCTCCGAGCCGGTCGAAATAGTCCATAACCTTTC CACA-3'；
The nucleotide sequence of the locked chain L1 is as follows: 5'-TGCGGTATGTGGAAAGGTTATGGACTA-3', respectively;
the nucleotide sequence of the locked chain L2 is as follows: 5'-AAGAGATTGACAGATTGAACCAGCTTGAG-3', respectively;
the nucleotide sequence of the track chain Tr is shown as follows; 5' -HS- (T) 6 GGCTGTGGACTAT/rA/GGAAGAGATTCAGCCCGCGTTTTTTTCGCG-6-Carboxyfluorescein (FAM)-3'；
The nucleotide sequence of the target chain T1 is as follows: 5'-CCATAACCTTTCCACATACCGCA-3', respectively;
the nucleotide sequence of the target chain T2 is as follows: 5'-CTCAAGCTGGTTCAATCTGTCAA-3' are provided.
According to the present invention, preferably, the gold nanoparticles are prepared by the following method:
sodium citrate aqueous solution with concentration of 38.8mM and HAuCl with concentration of 1mM are prepared 4 An aqueous solution; adding HAuCl 4 The aqueous solution was heated to boiling and then the aqueous sodium citrate solution was added to the HAuCl with stirring 4 And (3) reacting in the aqueous solution for 10min under a heating boiling state, stirring for 15min after the reaction is finished, cooling to 25 ℃, and filtering to obtain the gold nanoparticles (AuNPs).
A SARS-CoV-2 detection kit, the kit comprises the DNA walker and MgCl 2 And (3) solution.
Preferably, according to the invention, the working concentration of the DNA walker in the kit is 3nM, MgCl 2 The working concentration of the solution was 180 mM.
The preparation method of the DNA walker for SARS-CoV-2 detection comprises the following steps:
(1) uniformly mixing a walking chain W, a locked chain L1 and a locked chain L2 in an annealing buffer solution, heating at 95 ℃ for 10min, and cooling to 20-30 ℃ to obtain a completely closed walking chain; then incubating the completely closed walking chain and TCEP for 2h to obtain a sulfhydrylation completely closed walking chain;
(2) heating the track chain Tr at 95 ℃ for 10min to obtain an annealed track chain Tr;
(3) and (2) uniformly mixing AuNPs, the sulfhydrylation completely-closed walking chain and the annealed track chain Tr, incubating for 16h at 4 ℃ in a dark place, continuously adding a NaCl solution at a time interval of 40min until the final concentration of NaCl is 0.2M, incubating for 24h at 4 ℃ in a dark place, and performing centrifugal washing to obtain the DNA walker for SARS-CoV-2 detection.
Preferably, in step (1), the molar ratio of the walking chain W to the locked chain L1 to the locked chain L2 is 1:3: 3.
Preferably, in step (1), the molar ratio of the fully closed walking chains to TCEP is 1: 50.
According to the invention, in step (3), the molar ratio of the AuNPs, the thiolated fully-blocked-travel chain and the annealed orbital chain Tr is 1:20: 200.
The method for detecting SARS-CoV-2 by using the DNA walker comprises the following steps:
adding a sample to be detected into a buffer solution with the final concentration of 3nM of a DNA walker, reacting for 2.5-3.5 h at 20-30 ℃, and adding CaCl 2 When the incubation liquid shows purple color, SARS-CoV-2 is contained in the sample to be tested.
Preferably, according to the invention, said CaCl 2 The final concentration in the buffer was 180 mM.
The technical principle of the DNA walker for detecting SARS-CoV-2 of the invention is as follows:
the present inventors selected two RNA gene fragments ORF1ab and N as target strands T1 and T2 from the SARS-CoV-2 viral genome open reading frame and nucleocapsid. The walking chain W, locked chain L1, locked chain L2 and track chain Tr were designed from the target chains T1 and T2, and then DNA walker was synthesized by combining AuNPs.
As shown in fig. 1, the DNA walker is an ensemble of DNA-modified AuNPs, the DNA is connected with the AuNPs through a terminal-labeled thiol group, and a small amount of walking chain W and a large amount of track chain Tr are loaded on the surface of the AuNP. The walking chain W comprises a long swing arm area and Mg 2+ Specific deoxyribozymes (types 8-17) catalytic domains. The locked strands L1, L2 are not fully complementary to the target strands T1, T2, respectively, such that partial single strands of each of the locked strands L1, L2 are overhanging so as to recognize the target strands T1, T2, resulting in displacement of the locked strands. And the two sides of the catalytic core of the walking chain W are closed by locking chain locking chains L1 and L2. Deletion of either of target strands T1 or T2 results in failure of the traveling strand W to bind to the track strand Tr. Only when both target strands T1, T2 are present, the walking strand W is completely unblocked and exposes the entire deoxyribozyme catalytic region for further hybridization with the orbital strand Tr on AuNPs.
The track chain Tr is designed as a double stem loop structure comprising a substrate sequence with an adenine ribonucleotide (rA) located near the middle of the larger loop. The secondary structure of the DNA can ensure that AuNPs can keep the stability and maintain the dispersion state under high salt concentration through electrostatic action (electronegative phosphate skeleton in DNA molecules) and steric repulsion, and the solution color is red. After the walking chain W is hybridized with the track chain Tr, the deoxyribozyme can exert the catalytic ability thereof, and Mg is used 2+ As a cofactor, the orbital strand Tr is cleaved by hydrolysis of the phosphodiester bond between riboadenosine and guanine. Thereafter, the smaller loop and a part of the larger loop were separated from the remaining orbital strand Tr, leaving only the truncated single strand on the AuNPs. The walking chain W in turn hybridizes to the next orbital chain Tr, undergoing a "hybrid-hydrolysis" cycle whereby most of the orbital chain Tr will be cleaved and the AuNPs become unstable due to the reduction of the negatively charged backbone and the decay of steric repulsion. At this time, AuNPs tend to aggregate under the same salt concentration, resulting in color change from red to purple, and detection of SARS-CoV-2 target nucleic acid sequences T1 and T2 is realized, so that whether SARS-CoV-2 is contained in a sample to be detected can be judged according to the solution color.
The invention has the following beneficial effects:
1. the invention provides a DNA walker for SARS-CoV-2 detection, which realizes visible SARS-CoV-2 detection, and the DNA walker has the advantages of less interference factors, low price and good stability, and the sensitivity can reach 1 nM.
2. The detection method provided by the invention has good selectivity and high sensitivity, and the color of the reaction solution of the DNA walker is not changed under the condition of lacking any sequence, so that the target sequences can be distinguished by the specificity of the mononucleotide. When the DNA walker or the kit is used for detection, a reverse transcription step is not needed, the use of enzyme, mark or modification is avoided, the result is visualized, the requirement on complex equipment is reduced, and a convenient, economic, rapid and reliable method is provided for SARS-CoV-2 virus detection.
Drawings
FIG. 1 is a schematic diagram of colorimetric detection of nucleic acid fragments by a DNA walker according to the present invention.
FIG. 2 shows native polyacrylamide gel electrophoresis patterns of different strands L1(A) and L2 (B).
In FIG. A: lane M: a 20bp DNA marker; lanes 1-6 are the walking chain W, the track chain Tr, the locked chain 3bp-L1, 4bp-L1, 5bp-L1 and the target chain T1, respectively; lane 7: a traveling chain W + a track chain Tr; lane 8: a walking chain W + a locked chain 3 bp-L1; lane 9: a walking chain W + a locked chain 4 bp-L1; lane 10: a walking chain W + a locked chain 5 bp-L1; lane 11: a walking chain W/a locking chain 3bp-L1 double chain + a track chain Tr; lane 12: a walking chain W/a locking chain 4bp-L1 double chain + a track chain Tr; lane 13: a walking chain W/a locking chain 5bp-L1 double chain + a track chain Tr; lane 14: a walking chain W/a locking chain 3bp-L1 double chain + a target chain T1+ a track chain Tr; lane 15: a walking chain W/a locking chain 4bp-L1 double chain + a target chain T1+ a track chain Tr; lane 16: the walking chain W/the locking chain 5bp-L1 double strand + the target chain T1+ the track chain Tr.
In fig. B: lane M: a 20bpDNA marker; lanes 1-6 are the walking chain W, the track chain Tr, the locked chain 5bp-L2, 6bp-L2, 7bp-L2, and the target chain T2, respectively; lane 7: a traveling chain W + a track chain Tr (1: 2); lane 8: a walking chain W + a locked chain 5 bp-L2; lane 9: a walking chain W + a locked chain 6 bp-L2; lane 10: a walking chain W + a locked chain 7 bp-L2; lane 11: a walking chain W/a locking chain 5bp-L2 double chain + a track chain Tr; lane 12: a walking chain W/a locking chain 6bp-L2 double chain + a track chain Tr; lane 13: a walking chain W/a locking chain 7bp-L2 double chain + a track chain Tr; lane 14: the walking chain W/the locking chain 5bp-L2 double chain + the target chain T2+ the track chain Tr; lane 15: the walking chain W/the locking chain 6bp-L2 double chain + the target chain T2+ the track chain Tr; lane 16: the walking chain W/the locking chain 7bp-L2 double strand + the target chain T2+ the track chain Tr.
FIG. 3 is a native polyacrylamide gel electrophoresis diagram illustrating the logical response of the locked strands 4bp-L1 and 6 bp-L2.
In the figure: lane M: a 20bp DNA marker; lanes 1-6 are the traveling chain W, the track chain Tr, the locked chain 4bp-L1, 6bp-L2, the target chain T1, T2, respectively; lane 7: a traveling chain W + a track chain Tr; lane 8: a walking chain W + a locked chain L1+ a locked chain L2; lane 9: a walking chain W/a locking chain L1/a locking chain L2 complex + a track chain Tr; lane 10: walking chain W/locked chain L1/locked chain L2 complex + target chain T1; lane 11: walking chain W/locked chain L1/locked chain L2 complex + target chain T2; lane 12: walking chain W/locked chain L1/locked chain L2 complex + target chain T1+ track chain Tr; lane 13: walking chain W/locked chain L1/locked chain L2 complex + target chain T2+ track chain Tr; lane 14: the walking chain W/locked chain L1/locked chain L2 complex + target chain T1+ target chain T2+ track chain Tr.
Fig. 4 is a uv-vis absorption spectrum (a), a transmission electron microscope image (B), and a photograph (C) of AuNPs solution.
FIG. 5 is a fluorescence spectrum (A) of the DNA walker of the present invention and a calibration curve (B) of the concentration of the orbital chain Tr on the DNA walker with fluorescence at 520 nm.
FIG. 6 is a graph showing the UV-VIS absorption spectrum (A), the dynamic light scattering characterization (B), the fluorescence spectrum (C), the time-dependent fluorescence intensity (D) and the color change (E) of the reaction solution of the DNA walker after the DNA walker reacts at the concentrations of 0nM and 20nM of both the target strand T1 and the target strand T2.
FIG. 7 is a graph showing the color change of the solution of the SARS-CoV-2 virus at a gradient concentration of 0, 2, 4, 8, 12, 20nM, a graph showing the relationship between the UV absorption ratio and the SARS-CoV-2 concentration (A), and a calibration curve of a standard curve (C) for the DNA walker of the present invention
FIG. 8 is a diagram showing the results of visual observation of the DNA walker of the present invention in detecting SARS-CoV-2 virus gene fragments, SARS-CoV-2 virus gene fragments having no SARS-CoV-2 virus gene fragment, single target chain T1 or target chain T2, and SARS-CoV-2 virus gene fragments.
In the figure, 0 is T1 and T2 without target chains, and 1 is T1 or T2 with target chains.
FIG. 9 is the ultraviolet visible absorption spectrum of the DNA walker of the present invention detecting SARS-CoV-2 virus gene fragment, SARS-CoV-2 virus gene fragment of single target chain T1 or target chain T2.
FIG. 10 is a visual observation result of SARS-CoV-2 virus gene fragment with base mismatch in the detection target strand T1 or target strand T2 by the DNA walker of the present invention (B).
In the figure, 0 is no target strand T1 or target strand T2, and 1 is target strand T1 or target strand T2.
Detailed Description
The invention is further illustrated by the following examples, without restricting its scope.
Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Reagents and raw materials:
the DNA sequences (Table S1) were synthesized and purified by Biotechnology engineering Ltd (Shanghai, China).
40% acrylamide/bisacrylamide (19: 1) solution, Ammonium Persulfate (APS), N, N, N ', N' -Tetramethylethylenediamine (TEMED), Tris, tetrasodium Ethylenediaminetetraacetate (EDTA), purchased from Biotechnology, Inc. (Shanghai, China).
SYBR Gold nucleic acid gel dyes were purchased from Saimer Feishel technologies.
Hydrogen (III) tetrachloroaurate trihydrate (HAuCl) 4 ·3H 2 O) and tris (2-carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Sigma-Aldrich (misuri, usa).
All other reagents were analytically pure and used as received. Throughout the experiment, ultrapure water (18.25M Ω. cm) obtained from a UP water purification system was used.
The 20bp DNA ladder was purchased from Baori biomedical technologies, Inc. (Beijing).
The UV-visible absorption spectrum was recorded by a TU-1901 spectrometer (Pushu, China). Fluorescence emission spectra were measured with an F-320 spectrofluorometer (Tianjin Hongkong scientific development Co., Ltd., China). Stained polyacrylamide gels in GelDocTM XR + Imaging on an imaging system (Bio-RAD Laboratories Inc., USA). Dynamic Light Scattering (DLS) measurements were performed on a nano-particle size potentiostat (Malvern, uk). Transmission Electron Microscope (TEM) measurements were carried out on a JSM-6700F transmission electron microscope with an acceleration voltage of 200kV (JEOL, Japan). Others are commercially available unless otherwise specified.
TABLE 1 oligonucleotide sequences used in the examples
Figure BDA0003673759440000061
In table 1, bold letters indicate the binding arms and corresponding complementary bases on both sides of the catalytic core; italicized letters indicate the catalytic core; underlined letters indicate mismatched bases; nbp-L indicates the number of bases of the binding arm of the tether. The concentration of the oligonucleotide was determined from the UV absorbance at 260 nm and the extinction coefficient of the sequence. The lockchain consists of one object recognition domain and one closed domain with different lengths.
Example 1
According to the SARS-CoV-2 virus genome information (NCBI reference sequence: NC-045512.2) already published by NCBI database, two RNA gene fragments ORF1ab and N are selected from open reading frame and nucleocapsid as target chain T1 and target chain T2, then walking chain W, 3 bp-locked chain L1, 4 bp-locked chain L1, 5 bp-locked chain L1, 5 bp-locked chain L2, 6 bp-locked chain L2, 7 bp-locked chain L2 and track chain Tr are designed according to target chain T1 and T2, and the specific sequences are shown in Table 1. Then synthesized and purified by bio-engineering gmbh (shanghai, china).
The lockchain consists of one object recognition domain and one closed domain with different lengths.
Example 2
1. Preparation and storage of DNA and RNA solutions
Concentrated DNA stock solutions of the sequences described in Table 1 were prepared in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and diluted to working solution concentration with HEPES buffer (10mM HEPES, 300mM NaCl, pH 7.0).
The concentration method comprises the following steps: the nucleic acid sequence was dissolved in the indicated microliter amounts of TE buffer solution on the tube and the concentration of the concentrate was determined by UV absorption spectroscopy.
2. Selection of Lock chain L1 and Lock chain L2
mu.L of 10mM walking chain W and 1.50. mu.L of 10mM locked chain (nbp-L1, nbp-L2) were mixed in an annealing buffer (25mM Tris-acetate, 200mM NaCl, pH 8.0) in a total volume of 26.12. mu.L, respectively, and the mixture was heated to 95 ℃ for 2min and cooled to 25 ℃ to obtain an annealing mixture.
mu.L of 10mM orbital chain Tr and 1. mu.L of 600mM MgCl were added 2 Adding into annealing mixture, incubating at 25 deg.C for 10min, and subjecting the incubated product to polyacrylamide gel electrophoresis. To examine the displacement of the target sequence into the locked strand, 1.38. mu.L of DEPC-H was added 2 O, 26.12. mu.L of the annealing mixture were mixed with 1.5. mu.L of target chains T1 and T2, respectively, at a concentration of 10mM, incubated at 25 ℃ for 30min, and the incubated product and other products of the reaction were subjected to polyacrylamide gel electrophoresis, the results of which are shown in FIG. 2.
As can be seen from FIG. 2, the length of the locked strand is important for inactivation of the deoxyribozyme without a target and activation with a target.
Lanes 8-10 show that, compared to the traveling chain W, track chain Tr, locked chain 3bp-L1, 4bp-L1, 5bp-L1, and target chain T1 fragments of lanes 1-6, the three locked chains hybridized with the traveling chain W after incubation of the traveling chain W with the locked chains, whereas the addition of track chain Tr resulted in competitive hybridization with the locked chains to the traveling chain W.
Lanes 11-13 show that, compared to the locked strands 4bp-L1 and 5bp-L1, the locked strand 3bp-L1 did not block the walking strand W well, some of the track strands Tr could compete with the walking strand W for hybridization and cleavage, the intensity of the Tr band of the track strand in lane 11 was reduced, and a weak band with the same mobility as the cleavage product in lane 7 appeared below. Insufficient blocking of the walking chain W can cause the DNA walker to generate non-specific response when the target chain T1 does not exist, and high background and even false positive signals can be caused after trigger amplification, so that only 4bp-L1 and 5bp-L1 meet the requirements.
Lanes 14-16 show that the presence of target strand T1 should displace the locked strand and leave the deoxyribozyme single strand. Tests on 3bp-L1, 4bp-L1 and 5bp-L1 show that the band corresponding to the W-L1 complex gradually appears, and the band corresponding to the walking chain W gradually decreases in strength. Due to more base pairing between the walking strand W and the locked strand 5bp-L1, the formed duplex is more stable, resulting in limited displacement efficiency of the target strand T1, and such low deblocking efficiency reduces the sensitivity of the walker. It can be appreciated that subtle changes in base pairs can have a dramatic effect on the interactions between DNA strands. The locked strand was determined to be 4bp-L1, as a criterion for the discrimination between low background high specificity in the absence of target strand T1 and high efficiency of deblocking in the presence of target strand T1. Similarly, the 6bp-L2 can still effectively block the walking chain in the presence of the track chain Tr, and can also effectively replace the target chain T2 after being added, so that the locked chain is determined to be 6 bp-L2.
3. Logical response of the Lock chain 4bp-L1 and 6bp-L2
mu.L of traveling chain W with a concentration of 10mM, 1.50. mu.L of locked chain 4bp-L1 with a concentration of 10mM, and 1.50. mu.L of locked chain 6bp-L2 with a concentration of 10mM were mixed in 23.12. mu.L of annealing buffer to anneal, and a traveling chain W/locked chain L1/locked chain L2 complex was obtained. Then 3. mu.L of target strand T1 at a concentration of 5mM, 3. mu.L of target strand T2 at a concentration of 5mM, or 3. mu.L of target strands T1 and T2 at a concentration of 5mM are added to 2.88. mu.L of the complex of track chain Tr at a concentration of 10mM and walking chain W/locking chain L1/locking chain L2 at a concentration of 23.12. mu.L, respectively, and incubated at 25 ℃ for 30min, followed by 1. mu.L of MgCl at a concentration of 600mM 2 After incubation for 10min, the incubation product and other products of the reaction were subjected to polyacrylamide gel electrophoresis, and the results are shown in FIG. 3.
As can be seen from FIG. 3, lane 7 shows the state of the chain W and the orbital chains Tr and Mg 2+ Upon incubation together, the orbital chain Tr is cleaved into two short oligonucleotides (Tr1 and Tr2) with faster migration rates due to the hydrolysis of the substrate sequence by the dnazyme.
Lanes 8-9 show that the walking chain W has been completely blocked by the locked strands 4bp-L1 and 6bp-L2 even when Mg has been introduced 2+ The track chain Tr is not cut.
Lane 10 shows that target strand T1 specifically displaced lockstrand L1 from the walking strand W/lockstrand L1/lockstrand L2 complex, forming a walking strand W-lockstrand L2 duplex and a lockstrand L1-target strand T1 duplex.
Lane 11 shows that target strand T2 specifically replaces lockstrand L2 from the walking strand W/lockstrand L1/lockstrand L2 complex, forming a walking strand W-lockstrand L1 duplex and a lockstrand L2-target strand T2 duplex.
Lanes 12-13 show that neither of the orbital strands Tr is cleaved by the traveling strand W, either with locked strand L1 deblocked by target strand T1 alone, or with locked strand L2 deblocked by target strand T2 alone, in which case the deoxyribozyme is still inactive due to the blocking of the other hybrid arm of the traveling strand W. Only when both target strands L1 and L2 are present can the walking chain W be completely deblocked. The dnazyme then restored activity, cleaving the track chain Tr into two shorter Tr1 and Tr2 fragments. Thus, the double-blocked walking chain W can only bind to the orbital chain Tr in the presence of both target chains L1 AND L2, AND the substrate is subsequently hydrolyzed by deoxyribozymes, achieving an "AND" logic gate.
In conclusion, the strand W, the locked strand L1, the locked strand L2 and the orbital strand Tr designed by the invention ensure that the deoxyribozyme is still inactive in the presence of only one of the target strands T1 or T2, and can be deblocked to catalyze the hydrolysis of the substrate only in the presence of SARS-CoV-2 containing both target strands T1 and T2.
Example 3
1. The preparation method of the nano gold particles comprises the following steps:
10mL of 38.8mM sodium citrate aqueous solution and 100mL of 1mM HAuCl were prepared 4 An aqueous solution; adding HAuCl 4 The aqueous solution was heated to boiling and then the aqueous sodium citrate solution was added rapidly to the HAuCl with vigorous stirring 4 Reacting in water solution under boiling state for 10min, stirring for 15min after reaction, cooling to 25 deg.C, and filtering with 0.22 μm filter to obtain gold nanoparticles (AuNPs).
And adding a drop of nano gold particle solution on the carbon-coated copper grid, drying at room temperature, and preparing a sample for TEM representation. Characterization was performed on a JSM-6700F transmission electron microscope with an acceleration voltage of 200 kV.
The AuNPs of this example have UV-visible absorption spectra as shown in FIG. 4A, Transmission Electron Microscope (TEM) images as shown in FIG. 4B, and AuNP solutions as shown in FIG. 4C.
As can be seen from fig. 4A to C, the AuNPs were synthesized successfully, showed maximum absorbance at 520nm, were red, and had a uniform size distribution with an average size of 13 nm.
2. A preparation method of a DNA walker for SARS-CoV-2 detection comprises the following steps:
(1) uniformly mixing a walking chain W, a locked chain 4bp-L1 and a locked chain 6bp-L2 in an annealing buffer solution (25mM Tris-acetic acid, 200mM NaCl, pH 8.0) according to a molar ratio of 1:3:3, heating at 95 ℃ for 10min, and cooling to 25 ℃ to obtain a completely closed walking chain; mixing the completely closed walking chain and TCEP according to a molar ratio of 1:50, and incubating for 2h to obtain a thiolated completely closed walking chain;
(2) heating the track chain Tr at 95 ℃ for 2min to obtain an annealed track chain Tr;
(3) mixing AuNPs, a thiol-completely-closed walking chain and an annealed track chain Tr uniformly according to a molar ratio of 1:20:200, incubating at 4 ℃ in a dark place for 16h, continuously adding a NaCl solution at a time interval of 40min until the final concentration of NaCl is 0.2M, incubating at 4 ℃ in a dark place for 24h, centrifuging at 4 ℃ and 14000rpm for 30min to take precipitates, washing for 3 times by using a washing solution (25mM Tris-acetate, pH 8.0) to obtain a DNA walker (W/Tr/AuNP DNA walker) for SARS-CoV-2 detection, and finally placing the DNA walker in a Tris storage solution (25 mM-acetate, 100mM NaCl, pH 8.0) at a concentration of 60-80 nM in the dark place at 4 ℃.
The number and concentration of the track chain Tr on the W/Tr/AuNP DNA walker were determined by DTT displacement method, and a standard calibration curve was drawn based on the concentration of the fluorophore-labeled track chain Tr, as shown in FIG. 5.
As can be seen from FIG. 5, 23 hairpin orbital strands were conjugated to AuNP in the W/Tr/AuNP DNA walker.
Example 4
The DNA walker prepared in example 3 and the target strand T1+ T2 were placed in reaction buffer (25mM Tris-acetate, 225 mM NaCl, 20mM MgCl) 2 pH 8.0) at 25 ℃ for 3h, and then CaCl is added 2 ，CaCl 2 The final concentration in the buffer was 180mM, and visual observation was performed. The reactions were divided into 2 groups, with 3nM concentration of DNA walker in group 1, and target strand T1 and T2The concentrations were all 0 nM; the concentration of the DNA walker in group 2 was 3nM and the concentrations of target strand T1 and target strand T2 were 20nM, the results are shown in FIG. 6
As can be seen from FIG. 6E, when the W/Tr/AuNP DNA walker detects target strand T1 and target strand T2, the color of the solution was visually observed to change from red to purple. As can be seen from FIG. 6A, the maximum absorbance appears red-shifted, a new absorption band around 620nm appears, and the spectral change explains the color change and indicates the aggregation of the three-dimensional DNA walker, compared with the cases of the target strand T1 and the target strand T2. As can be seen from FIG. 6B, in the presence of both the target strand T1 and the target strand T2, the average hydrated diameter of the DNA walker as a whole increased from 68nm to 342 nm. As can be seen from fig. 6C, fluorescence significantly increased in the presence of both target strand T1 and target strand T2, as a result of the deblocking of walking strand W by target strand T1 and target strand T2 and the orbital strand walking and cleavage on the AuNP surface. As can be seen from FIG. 6D, the rate of cleavage of the hairpin track chain Tr by the walking chain W is higher than that by the straight track chain.
Example 5
1. SARS-CoV-2 virus gene fragments with gradient concentrations of 0, 2, 4, 8, 12 and 20nM were used as test samples, and the detection and UV absorption spectrometry were performed as described in example 4, and the results are shown in FIG. 7.
As can be seen from FIG. 7, with the increase of the concentration of the SARS-CoV-2 virus gene fragment, the color of the W/Tr/AuNP DNA walker reaction solution of the present invention gradually changes from red to purple and then to purple gray, thereby realizing the visual detection of SARS-CoV-2. As the concentration of SARS-CoV-2 virus gene fragment increases from 0 to 10nM, the absorbance ratio gradually increases and then reaches saturation until 20 nM; in the concentration range of 0 to 10nM, the value of A620/A520 and the concentration of SARS-CoV-2 virus gene fragment are in good linear relation, and the detection limit of the W/Tr/AuNP DNA walker is 1 nM.
2. As a sample to be tested, SARS-CoV-2 virus gene-free fragment (SARS-CoV-2 virus concentration: 0nM), SARS-CoV-2 virus gene fragment (SARS-CoV-2 virus concentration: 20nM) containing only target chain T1, SARS-CoV-2 virus gene fragment (SARS-CoV-2 virus concentration: 20nM) containing only target chain T2, and SARS-CoV-2 virus gene fragment (SARS-CoV-2 virus concentration: 20nM) were subjected to detection and ultraviolet absorption spectrometry in the same manner as described in example 5, and the results are shown in FIGS. 8 and 9, respectively.
As is clear from FIGS. 8 and 9, the W/Tr/AuNP DNA walker of the present invention has specificity for the SARS-CoV-2 virus gene fragment containing the target strand T1+ T2, and the reaction solution showed purple color only when the target strand T1+ T2 was present, while the reaction solution showed red color when the target strand T1 and T2 were absent and only the target strand T1 or T2 was present.
3. SARS-CoV-2 virus gene fragment (1bp-Mismatch-T1, Table 1, concentration 20nM) in which 1bp base Mismatch occurs in target strand T1, SARS-CoV-2 virus gene fragment (2bp-Mismatch-T1, Table 1, concentration 20nM) in which 2bp base Mismatch occurs in target strand T1, SARS-CoV-2 virus gene fragment (3bp-Mismatch-T1, Table 1, concentration 20nM) in which 3bp base Mismatch occurs in target strand T1, SARS-CoV-2 virus gene fragment (1bp-Mismatch-T2, Table 1, concentration 20nM) in which 1bp base Mismatch occurs in target strand T2, SARS-CoV-2 virus gene fragment (2bp-Mismatch-T2, Table 1, concentration 20nM) in which 2bp base Mismatch occurs in target strand T2, and SARS-CoV-2 virus gene fragment (1bp-Mismatch-T2, Table 1, concentration 20nM) in which 1 base Mismatch occurs in target strand T2, As a sample to be tested, SARS-CoV-2 virus gene fragment (3bp-Mismatch-T1, Table 1, concentration: 20nM) in which 3bp base Mismatch occurred in the target strand T2 and SARS-CoV-2 virus gene fragment (concentration: 20nM) were detected by the method described in example 5, and the results are shown in FIG. 10.
As can be seen from FIG. 10, the SARS-CoV-2 virus gene fragment with base mismatch in the sequence of the target chain T1 or T2 also shows red color, which indicates that the single target chain T1 or T2 cannot cause the color change of the W/Tr/AuNP DNA walker after base mismatch, thus increasing the detection accuracy and ensuring the detection reliability of the W/Tr/AuNP DNA walker.

Claims (10)

1. A DNA walker for SARS-CoV-2 detection, comprising a walking chain W, a locked chain L1, a locked chain L2, a track chain Tr, a target chain T1, a target chain T2 and gold nanoparticles;
the nucleotide sequence of the walking chain W is as follows: 5' -HS- (T) 42 TGGTTCAATCTGTCAATCTCTTCTCCGAGCCGGTCGAAATAGTCCATAACCTTTCCACA-3'；
The nucleotide sequence of the locked chain L1 is as follows: 5'-TGCGGTATGTGGAAAGGTTATGGACTA-3', respectively;
the nucleotide sequence of the locked chain L2 is as follows: 5'-AAGAGATTGACAGATTGAACCAGCTTGAG-3', respectively;
the nucleotide sequence of the track chain Tr is shown as follows; 5' -HS- (T) 6 GGCTGTGGACTAT/rA/GGAAGAGATTCAGCCCGCGTTTTTTTCGCG-6-Carboxyfluorescein(FAM)-3'；
The nucleotide sequence of the target chain T1 is as follows: 5'-CCATAACCTTTCCACATACCGCA-3', respectively;
the nucleotide sequence of the target chain T2 is as follows: 5'-CTCAAGCTGGTTCAATCTGTCAA-3' are provided.
2. The DNA walker for SARS-CoV-2 detection according to claim 1, wherein the gold nanoparticles are prepared by the following method:
sodium citrate aqueous solution with concentration of 38.8mM and HAuCl with concentration of 1mM are prepared 4 An aqueous solution; adding HAuCl 4 The aqueous solution was heated to boiling and then the aqueous sodium citrate solution was added to the HAuCl with stirring 4 And (3) reacting in the aqueous solution for 10min under a heating boiling state, stirring for 15min after the reaction is finished, cooling to 25 ℃, and filtering to obtain the gold nanoparticles (AuNPs).
3. A SARS-CoV-2 detection kit comprising the DNA walker of claim 1 and MgCl 2 And (3) solution.
4. The assay kit of claim 3, wherein the working concentration of the DNA walker in the kit is 3nM, MgCl 2 The working concentration of the solution was 180 mM.
5. The method for preparing a DNA walker for SARS-CoV-2 detection according to claim 1, comprising the steps of:
(1) uniformly mixing a walking chain W, a locked chain L1 and a locked chain L2 in an annealing buffer solution, heating at 95 ℃ for 10min, and cooling to 20-30 ℃ to obtain a completely closed walking chain; then incubating the completely closed walking chain and TCEP for 2h to obtain a sulfhydrylation completely closed walking chain;
(2) heating the track chain Tr at 95 ℃ for 10min to obtain an annealed track chain Tr;
(3) and (2) uniformly mixing AuNPs, the sulfhydrylation completely-closed walking chain and the annealed track chain Tr, incubating for 16h at 4 ℃ in a dark place, continuously adding a NaCl solution at a time interval of 40min until the final concentration of NaCl is 0.2M, incubating for 24h at 4 ℃ in a dark place, and performing centrifugal washing to obtain the DNA walker for SARS-CoV-2 detection.
6. The method according to claim 5, wherein in step (1), the molar ratio of the traveling chain W to the locked chain L1 to the locked chain L2 is 1:3: 3.
7. The process according to claim 5, wherein in step (1), the molar ratio of the fully blocked walking chains to TCEP is 1: 50.
8. The method according to claim 5, wherein in the step (3), the AuNPs, the thiolated-fully-blocked-travel chain, and the annealed orbital chain Tr are present in a molar ratio of 1:20: 200.
9. The method for detecting SARS-CoV-2 by using the DNA walker as claimed in claim 1, comprising the steps of:
adding a sample to be detected into a buffer solution with the final concentration of 3nM of a DNA walker, reacting for 2.5-3.5 h at 20-30 ℃, and adding CaCl 2 When the incubation liquid shows purple color, SARS-CoV-2 is contained in the sample to be tested.
10. The method of claim 9, wherein the CaCl is CaCl, CaCl-CoV-2, or CaCl-CoV 2 The final concentration in the buffer was 180 mM.
CN202210617332.9A 2022-06-01 2022-06-01 DNA walker for SARS-CoV-2 detection and its preparation method Pending CN114875180A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210617332.9A CN114875180A (en) 2022-06-01 2022-06-01 DNA walker for SARS-CoV-2 detection and its preparation method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210617332.9A CN114875180A (en) 2022-06-01 2022-06-01 DNA walker for SARS-CoV-2 detection and its preparation method

Publications (1)

Publication Number Publication Date
CN114875180A true CN114875180A (en) 2022-08-09

Family

ID=82679363

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210617332.9A Pending CN114875180A (en) 2022-06-01 2022-06-01 DNA walker for SARS-CoV-2 detection and its preparation method

Country Status (1)

Country Link
CN (1) CN114875180A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114214461A (en) * 2021-12-26 2022-03-22 南京大学 Isothermal HIV nucleic acid detection kit and detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180134549A1 (en) * 2016-11-15 2018-05-17 The Govenors Of The University Of Alberta Microrna initiated dnazyme motor operating in living cells
CN113512579A (en) * 2021-07-29 2021-10-19 山东大学 Fluorescent biosensor for detecting uracil DNA glycosylase and detection method and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180134549A1 (en) * 2016-11-15 2018-05-17 The Govenors Of The University Of Alberta Microrna initiated dnazyme motor operating in living cells
CN113512579A (en) * 2021-07-29 2021-10-19 山东大学 Fluorescent biosensor for detecting uracil DNA glycosylase and detection method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
陶秀丽;聂亚敏;袁若;: "DNA步行器的构建及其在生命分析的应用", 化学传感器, no. 02, 15 June 2019 (2019-06-15), pages 19 - 28 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114214461A (en) * 2021-12-26 2022-03-22 南京大学 Isothermal HIV nucleic acid detection kit and detection method
CN114214461B (en) * 2021-12-26 2024-03-26 南京大学 Isothermal HIV nucleic acid detection kit and detection method

Similar Documents

Publication Publication Date Title
Hu et al. Double-strand DNA-templated formation of copper nanoparticles as fluorescent probe for label free nuclease enzymedetection
Cao et al. Naked-eye sensitive detection of nuclease activity using positively-charged gold nanoparticles as colorimetric probes
Karami et al. Conventional PCR assisted single-component assembly of spherical nucleic acids for simple colorimetric detection of SARS-CoV-2
EP2167691B1 (en) Method for the simultaneous detection of multiple nucleic acid sequences in a sample
US20220251629A1 (en) Isothermal amplification components and processes
EP2616555B1 (en) Capture probes immobilizable via l-nucleotide tail
US11299771B2 (en) Enhanced DNA sensing via catalytic aggregation of gold nanoparticles by DNA hybridization chain reaction
EP3286329B1 (en) Method for the simultaneous detection of multiple nucleic acid sequences in a sample
Tian et al. Enhancing-effect of gold nanoparticles on DNA strand displacement amplifications and their application to an isothermal telomerase assay
US20110294125A1 (en) Colorimetric biosensor with allosteric dnazyme activation and rolling circle signal amplification
US20200255885A1 (en) Isothermal amplification components and processes
Yang et al. A label-free fluorescent probe based on DNA-templated silver nanoclusters and exonuclease III-assisted recycling amplification detection of nucleic acid
CN114875180A (en) DNA walker for SARS-CoV-2 detection and its preparation method
CN114875178B (en) SARS-CoV-2 detection system and method based on hybridization chain reaction
Ge et al. Colorimetric detection of viral RNA fragments based on an integrated logic-operated three-dimensional DNA walker
US9512470B2 (en) Method for the simultaneous detection of multiple nucleic acid sequences in a sample
Zeng et al. A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III-aided cycling amplification
Sadeghan et al. Fluorimetric detection of methylated DNA of Sept9 promoter by silver nanoclusters at intrastrand 6C-loop
CN114480592A (en) SNPs detection technology based on UDG mediated PCR, magnetic nano enrichment and strand displacement reaction
US11814689B2 (en) Nucleic acid detection using type III CRISPR complex
JP2003180374A (en) Method for detecting nucleic acid mutation by application of nucleic acid dissolution curve
CN117965687A (en) Amplification method of single-stranded DNA product and application thereof
CN117867172A (en) Amplification-free detection method and kit for target viruses
KR20220158149A (en) Method and apparatus for target nucleic acid detection by extracting total nucleic acid and isothermally amplifying
CN116377033A (en) Novel nucleic acid detection method based on CRISPR-Cas12

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination