CN116004709A - Instantaneous transformation method and application of spatholobus stem - Google Patents
Instantaneous transformation method and application of spatholobus stem Download PDFInfo
- Publication number
- CN116004709A CN116004709A CN202210906155.6A CN202210906155A CN116004709A CN 116004709 A CN116004709 A CN 116004709A CN 202210906155 A CN202210906155 A CN 202210906155A CN 116004709 A CN116004709 A CN 116004709A
- Authority
- CN
- China
- Prior art keywords
- spatholobus stem
- expression vector
- ssmyb106
- gene
- suberect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for instantaneously transforming spatholobus stem, which comprises the following steps: 1) Constructing an expression vector plasmid; 2) Transferring the expression vector plasmid into a competent cell of agrobacterium tumefaciens, and infecting petals of suberect spatholobus stem in full bloom stage by using bacterial liquid; 3) Shading the impregnated spatholobus stem flowers, and culturing overnight for 12-24h to complete instant transformation of the spatholobus stem. The invention also provides an application of the instantaneous transformation method of the spatholobus stem in researching the synthesis of the target gene regulation spatholobus stem active ingredient. The invention establishes an agrobacterium injection permeation mediated transient expression system suitable for the suberect spatholobus stem, can quickly, conveniently and efficiently obtain transient transformation materials, and is particularly beneficial to researching suberect spatholobus stem active ingredient synthesis related genes.
Description
Technical Field
The invention belongs to the field of biotechnology. More particularly, the invention relates to a method for instantaneous transformation of suberect spatholobus stem and application thereof.
Background
Caulis Spatholobi is derived from dried rattan of Paeonia ostii Wash Spatholobus suberectus Dunn of perennial woody plant, is one of commonly used traditional Chinese medicines, "Gui Shi Wei" dao Di medicinal materials, and the ancient book of the herb is recorded as "Santa Clausis for blood system", and is the main raw material of Chinese patent medicines such as JINJI Capsule, huahong tablet, etc., and the flavonoid component is the main active component. The whole genome map of the spatholobus stem is completed, and a foundation is provided for functional gene research. However, for perennial woody plants, genetic transformation systems are difficult to construct, and the efficiency of obtaining stable transgenic plants is low and the period is long, which hinders the deep research of the functional genes of woody plants. The aseptic tissue culture research of the spatholobus stem has not been successful for many years, and the construction of a stable genetic transformation system has not been broken through. Therefore, the establishment of a rapid, efficient and convenient gene function identification method is particularly important for the functional gene excavation of the spatholobus stem and the revealing of the molecular mechanism formed by the quality of medicinal materials.
Transient transformation is a rapid and effective method for researching the function of a target gene, and not only provides possibility for large-scale gene function screening. It has been used in leaves, roots, flowers and calli of various plants. At present, most of the transient transformation methods are mediated by agrobacterium, and the transient transformation effect is affected by dip-dyeing modes, dip-dyeing positions and the like. Therefore, the establishment of the instant transformation system of the spatholobus stem is necessary for the research of the functional genes of the spatholobus stem.
Disclosure of Invention
It is an object of the present invention to solve at least the above problems and to provide at least the advantages to be described later.
The invention aims to provide a method for instantaneously transforming spatholobus stem, which can realize the instantaneous transformation of a target gene in spatholobus stem flowers and is an effective method for rapidly researching the gene function of spatholobus stem.
To achieve these objects and other advantages and in accordance with the purpose of the invention, there is provided a method for transient transformation of spatholobus stem, comprising the steps of:
1) Constructing an expression vector plasmid;
2) Transferring the expression vector plasmid into a competent cell of agrobacterium tumefaciens, and infecting petals of suberect spatholobus stem in full bloom stage by using bacterial liquid;
3) Shading the impregnated spatholobus stem flowers, and culturing overnight for 12-24h to complete instant transformation of the spatholobus stem.
Preferably, the expression vector is an over-expression vector, and the spatholobus stem gene SsMYB106 is connected with a plasmid pBI121 vector to construct an over-expression vector plasmid pBI121-SsMYB106; the SsMYB106 gene of the spatholobus stem is shown in SEQ ID NO. 1.
Preferably, in step 1), the over-expression vector plasmid carries the CaMV35S promoter, the Kanamycin vector resistance and a reporter gene.
Preferably, the reporter gene is any one of beta-Glucuronidase, luciferase and fluorescent protein.
Preferably, in the step 2), the over-expression vector plasmid is transferred into competent cells of agrobacterium tumefaciens GV3101 by a liquid nitrogen freeze thawing method, and is identified by colony PCR to infect petals of suberect spatholobus stem in full bloom stage.
Preferably, in the step 2), the back of the petals is gently rubbed with a sterile syringe to form a fine wound, the bacteria liquid is slowly injected into the wound by using a needleless sterile syringe, and injection is performed on both sides of the petals, so that the petals after injection are semitransparent.
An application of instantaneous transformation method of caulis Spatholobi in researching synthesis of target gene regulation and control of active components of caulis Spatholobi.
The invention at least comprises the following beneficial effects: the invention establishes an agrobacterium injection permeation mediated transient expression system suitable for the suberect spatholobus stem, can quickly, conveniently and efficiently obtain transient transformation materials, and is particularly beneficial to researching suberect spatholobus stem active ingredient synthesis related genes. The method can obviously improve the content of total flavonoids in the material by constructing a target gene over-expression vector and transiently transforming the target gene over-expression vector into plants, and simultaneously obviously up-regulates PAL, CHI, 4CL and other gene expression on a flavone synthesis path by 10-70 times, which has important significance for revealing molecular mechanisms formed by the quality of the spatholobus stem, and simultaneously provides reference for researching related genes formed by the quality of other perennial woody medicinal materials.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
FIG. 1 is a graph showing the expression level of SsMYB106 gene in examples and comparative examples of the present invention;
FIG. 2 is a chart showing the analysis of flavone content in examples and comparative examples of the present invention.
Detailed Description
The present invention is described in further detail below with reference to the drawings to enable those skilled in the art to practice the invention by referring to the description.
It will be understood that terms, such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or groups thereof.
The experimental methods described in the following embodiments are conventional methods unless otherwise indicated, and the reagents and materials are commercially available.
< example >
1. Cloning of the caulis Spatholobi SsMYB106 Gene
The cDNA sequence (SEQ ID NO. 1) of the SsMYB106 gene of suberect spatholobus stem is obtained by the following steps:
1) RNA extraction: total RNA was extracted from fresh young leaves of Spatholobus suberectus Spatholobus stem using Trizol reagent (Invitrogen, USA) and pretreated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination; RNA integrity was analyzed by 1.5% agarose gel and purity and concentration of RNA were determined spectrophotometrically.
2) First strand cDNA Synthesis: the following reagents were added to a 0.2mL PCR tube: mu.L Total RNA, 1 mu. L Random Primer p (dN) 6 (100 pmol), 1 mu.L RNase-free ddH 2 O, after 5min of warm bath at 70 ℃, 2min of ice bath, and centrifuging for 3-5 s; adding the reagent: 2.0. Mu.L of 5 XFirst-Strand Buffer, 0.25. Mu. L Rnase inhibitor, 0.25. Mu. L Reverse Transcriptase, 0.5. Mu.L of 10mmol dNTPs, 10.0. Mu.L of Total volume, 60min at 42℃and 10min at 72 ℃.
3) Cloning of the genes: detection was performed on a PCR instrument (BBI, canada) using LA Taq (TaKaRa, DRR02 AG) reagents. Gene specific primers were designed and synthesized using Primer 5.0 software,
F:ATGGGGAGGCAACCCTG(SEQ ID NO.2)
R:CTAATGCCCCTCTTCCTTCATT(SEQ ID NO.3)
the PCR amplification procedure was: 95 ℃ for 5min;94℃for 30s,55℃for 30s,72℃for 30s,35 cycles; and at 72℃for 8min.
4) PCR electrophoresis and recovery: the PCR products were run on a 1% TAE agarose gel, and as a result, as shown in FIG. 1, the target fragment was recovered using a column type DNA gel recovery kit (Bio, B518131).
5) Ligation transformation: connecting the PCR purified product to a pUC18-T vector to obtain a pUC18-SsMYB106 vector, then converting the pUC18-SsMYB106 vector into 100 mu L competent cells, adding 10 mu L of connecting liquid, gently mixing, standing on ice for 30min, and carrying out heat shock in a 42 ℃ water bath for 60s; placing on ice for 10-15min; adding 400 mu L of LB culture medium, and culturing at 37 ℃ for 1h under shaking at 200-250 rpm; the bacteria were spread on ampicillin-containing plates previously coated with 20. Mu.L of 100mM IPTG and 100. Mu.L of 20mg/mL X-gal, and incubated overnight in an inverted position, after centrifugation at 4000rpm for 5min at room temperature.
6) Colony PCR and sequencing: PCR was performed using the universal primers on the pUC18-T vector. The PCR amplification procedure was: 3min at 95 ℃;94℃30s,55℃30s,72℃60s,25 cycles; and at 72℃for 10min. And after the sequencing verification of the PCR product is successful, the cDNA sequence of the SsMYB106 gene of the caulis spatholobi is obtained, and is shown as SEQ ID NO. 1.
2. Construction of suberect spatholobus Stem overexpression vector pBI121-SsMYB106
1) Double enzyme cutting: the pBI121 empty vector and pUC18-SsMYB106 vector were digested with EcoRI and HindIII restriction enzymes.
2) Product recovery connection: and (3) respectively recovering the pBI121 empty vector digestion products and pUC18-SsMYB106 vector digestion products by using a gel recovery kit, and connecting 2 recovered products by using T4 ligase to obtain the overexpression vector plasmid pBI121-SsMYB106. The over-expression vector plasmid pBI121-SsMYB106 carries a CaMV35S promoter, kanamycin vector resistance and a beta-Glucononidase reporter gene; the reporter gene may be a reporter gene such as luciferase or fluorescent protein.
3) Conversion: transferring the over-expression vector plasmid pBI121-SsMYB106 into competent cells of agrobacterium GV3101 by a liquid nitrogen freeze thawing method, inversely culturing the transformed agrobacterium overnight at 28 ℃ on LB solid medium containing 50mg/L kanamycin, picking single colony, and culturing in LB liquid medium containing 50mg/L kanamycin until the bacterial liquid OD is reached 600 Values up to 0.7; after colony PCR identification, agrobacterium containing the over-expression vector plasmid pBI121-SsMYB106 was obtained for transient transformation. Colony PCR primers were as follows:
F:GACCTGCAGGCATGCAAGCTTTGAGACTTTTCAACAAAGCG(SEQ ID NO.4)
R:CGATCGGGGAAATTCGAGCTCCTAATGCCCCTCTTCCTTCAT(SEQ ID NO.5)
3. transient transformation of pBI121-SsMYB106
1) Flowers in the full bloom stage on a spatholobus stem plant are selected, after slight wounds are rubbed out on the back surfaces of petals by a 1mL sterile injector, agrobacterium tumefaciens bacteria liquid containing an overexpression vector plasmid pBI121-SsMYB106 is slowly injected into the wounds by a 1mL needleless sterile injector, and injection is respectively carried out on two sides of the petals, so that the petals after injection are semitransparent.
2) The flowers on the treated spatholobus stem plants need to be subjected to shading treatment, and after overnight culture for 16 hours, samples are collected on the next day. At least 20 flowers were treated per inflorescence, and 3 different plants were treated separately for three biological replicates. Flowers treated with empty vector bacterial liquid were used as negative controls.
Comparative example 1 ]
The operation method of the embodiment is adopted, and the difference is that in the third step, the instantaneous conversion method is vacuum dip dyeing: picking flowers in the full bloom stage of the spatholobus stem, washing the flowers with sterile water, putting the flowers into a suction filtration bottle filled with agrobacterium tumefaciens bacterial liquid of an over-expression vector plasmid pBI121-SsmYB106, immersing the flowers into the bacterial liquid, carrying out vacuum infiltration and infection for 2h under the pressure of 0.08MPa, and wrapping the suction filtration bottle with tinfoil to carry out shading treatment. Each treatment was repeated three times with flowers treated with empty vector bacterial liquid as a control.
Comparative example 2 ]
The operation method of the embodiment is adopted, and the difference is that in the third step, the instantaneous conversion method is vacuum dip dyeing: picking caulis Spatholobi leaf, cleaning with sterile water, placing into a suction filtration bottle filled with bacterial liquid, immersing flowers into bacterial liquid, vacuum infiltration and infection for 2h under 0.08MPa, and packaging the suction filtration bottle with tinfoil for shading treatment. Three replicates of each treatment were run with empty vector bacterial liquid treated leaves as controls. Other steps are the same as in the examples.
< analysis of transient transformation results >
Identification of transient transformation Material
The results of staining the materials of the experimental groups in examples and comparative examples were analyzed by GUS histochemical staining, and the GUS transient expression rate was counted.
The GUS staining method for the treated spatholobus stem flowers comprises the following steps: preparing GUS dyeing working solution (biosharp), storing the prepared GUS dyeing working solution at-20deg.C in dark, placing caulis Spatholobi flower in a 1.5mL centrifuge tube, and adding the prepared GUS dyeing working solution to completely cover material; the tinfoil paper is wrapped and placed for 12 hours at normal temperature. The material is transferred into 70% alcohol for 3 times of decolorization until the negative control material is white, and blue spots positive to GUS dyeing are stable and do not fade in alcohol. Photographing the dyed spatholobus stem flowers under a stereoscopic microscope
GUS transient expression rate (100%) = (number of color development/number of detection) ×100%.
The GUS transient expression rates of the examples, the comparative example 1 and the comparative example 2 were counted to be 100%, 80% and 20%, respectively.
(II) SsMYB106 Gene expression analysis
The relative expression levels of SsMYB106 gene in the control group and the experimental group in examples and comparative examples were analyzed by qRT-PCR method. 18S was selected as the endogenous reference gene and specific primers for qRT-PCR were designed using Primer 5.0 software:
SsMYB106-F：CTCAATAAACAGGCAGCGTCTC(SEQ ID NO.6)
SsMYB106-R：GTCCCATAATGCTTCCACCAG(SEQ ID NO.7)
18S-F：CAACTCTAAAGGTCGTTTCCCA(SEQ ID NO.8)
18S-R：AGTGGCACCAGCGTCTACAA(SEQ ID NO.9)。
qRT-PCR is performed on the treated spatholobus stem flowers to detect the content of the target genes. The qRT-PCR method comprises the following steps:
1) RNA extraction: sample RNA was extracted using FastPure Universal Plant Total RNA Isolation Kit (Vazyme, RC 411);
2) Reverse transcription: total RNA 1. Mu.L, 4 XgDNA wind Mix 4. Mu.L and RNase-free ddH were added to ice-bath RNase-free PCR tubes using HiScript III RT SuperMix for qPCR (+gDNA wind) kit 2 O was fixed to a volume of 16. Mu.L. The mixture was gently stirred and mixed with a pipette, and the reaction mixture was incubated at 42℃for 2min. Then, 5X HiScript III qRT SuperMix. Mu.L was added thereto, and the mixture was gently stirred and mixed by pipetting. The reverse transcription reaction was performed according to the following conditions: 15min at 37℃and 5s at 85 ℃. The obtained product was stored at-20 ℃.
3) qRT-PCR: the detection was performed on a StepOne Plus fluorescent quantitative PCR instrument (ABI, usa) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711) quantitative PCR reagents. Primers specific for the target gene were designed and synthesized using Primer 5.0 software. The amplification procedure was: 95 ℃ for 30s;95℃10s,6℃ 30s,40 cycles.
By 2 -ΔΔCT The expression level of SsMYB106 gene in different treatments was calculated by the method, and the result is shown in FIG. 1.
The result shows that the expression quantity of SsMYB106 genes in the embodiment is 37.7 times that of the control, and the overexpression of the target gene SsMYB106 is realized. The expression level of SsMYB106 gene in comparative example 1 was 3.8 times that of the control, and the expression level of SsMYB106 gene in comparative example 2 was 2.3 times that of the control, which indicates that the expression level of the target gene was significantly higher than that of the vacuum permeation transient transformation method of comparative examples 1 and 2 using the injection permeation-mediated transient expression system of spatholobus stem flower in comparative example 1, and the spatholobus stem flower in comparative example 1 was also superior to the spatholobus stem leaf in comparative example 2.
(III) flavone content analysis
The SsMYB106 gene has the function of regulating and controlling the synthesis of flavone components according to the previous experiment. Therefore, the content of total flavonoids in the instant conversion material was measured by ultraviolet spectrophotometry using rutin as a reference substance, and the result is shown in FIG. 2. The results show that the flavone content in the examples is increased by 53.6% compared with the control, the SsMYB106 gene function is verified, and further the success of the agrobacterium suberect injection permeation-mediated transient expression system in the invention is demonstrated.
(IV) SsMYB106 Gene transient over-expression Regulation of flavone synthetic pathway Gene expression
Analysis of gene expression in the flavone biosynthesis pathway by qRT-PCR method shows that in the example, ssMYB106 gene is transiently over-expressed, so that the expression levels of PAL, CHI, 4CL and other genes on the flavone biosynthesis pathway are obviously up-regulated, and the functions of the SsMYB106 gene are further analyzed respectively 14.1 times, 69.5 times and 47.7 times of those of the control.
Although embodiments of the present invention have been disclosed above, it is not limited to the details and embodiments shown and described, it is well suited to various fields of use for which the invention would be readily apparent to those skilled in the art, and accordingly, the invention is not limited to the specific details and illustrations shown and described herein, without departing from the general concepts defined in the claims and their equivalents.
Claims (7)
1. The instantaneous spatholobus stem transformation method is characterized by comprising the following steps of:
1) Constructing an expression vector plasmid;
2) Transferring the expression vector plasmid into a competent cell of agrobacterium tumefaciens, and infecting petals of suberect spatholobus stem in full bloom stage by using bacterial liquid;
3) Shading the impregnated spatholobus stem flowers, and culturing overnight for 12-24h to complete instant transformation of the spatholobus stem.
2. The instantaneous transformation method of suberect spatholobus stem according to claim 1, wherein the expression vector is an over-expression vector, and suberect spatholobus stem gene SsMYB106 is connected with a plasmid pBI121 vector to construct an over-expression vector plasmid pBI121-SsMYB106; the SsMYB106 gene of the spatholobus stem is shown in SEQ ID NO. 1.
3. The method according to claim 1, wherein in step 1), the overexpression vector plasmid carries a CaMV35S promoter, a Kanamycin vector resistance and a reporter gene.
4. The method for transient transformation of suberect spatholobus stem according to claim 3, wherein the reporter gene is any one of beta-Glucuronidase, luciferase and fluorescent protein.
5. The instantaneous transformation method of suberect spatholobus stem according to claim 1, wherein in the step 2), the overexpression vector plasmid is transferred into competent cells of agrobacterium tumefaciens GV3101 by a liquid nitrogen freeze thawing method, and the competent petals of suberect spatholobus stem are infected by colony PCR identification.
6. The instantaneous transformation method of suberect spatholobus stem according to claim 1, wherein in the step 2), a sterile injector is used for lightly rubbing a fine wound on the back surface of petals, a needleless sterile injector is used for slowly injecting bacteria liquid into the wound, and injection is respectively carried out on two sides of the petals, so that the petals after injection are semitransparent.
7. Use of the instant transformation method of spatholobus stem according to any of claims 1-6 for researching the synthesis of active ingredients of target gene regulation spatholobus stem.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210906155.6A CN116004709A (en) | 2022-07-29 | 2022-07-29 | Instantaneous transformation method and application of spatholobus stem |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210906155.6A CN116004709A (en) | 2022-07-29 | 2022-07-29 | Instantaneous transformation method and application of spatholobus stem |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116004709A true CN116004709A (en) | 2023-04-25 |
Family
ID=86030664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210906155.6A Pending CN116004709A (en) | 2022-07-29 | 2022-07-29 | Instantaneous transformation method and application of spatholobus stem |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116004709A (en) |
-
2022
- 2022-07-29 CN CN202210906155.6A patent/CN116004709A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112029774B (en) | Chaperonin for enhancing plant phloem RNP signal communication and application | |
| CN114736915B (en) | Verticillium dahliae VdNRPS2 gene antipathogen target gene fragment and interference vector and application thereof | |
| CN113105533B (en) | Phytophthora camphora effector protein Avh49 and application thereof | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN111979251B (en) | Sequoia intermedia ThSHR3 gene for promoting plant growth and application thereof | |
| CN116375837A (en) | Application of PgNAC72 in regulation and control of ginsenoside biosynthesis | |
| CN110029117B (en) | Flavonol synthetase gene SmFLS and application thereof, and flavonol synthetase | |
| CN116904506A (en) | Lycium ruthenicum LrANT1 gene and application of coded protein thereof | |
| CN116004709A (en) | Instantaneous transformation method and application of spatholobus stem | |
| CN114854703B (en) | Flavone synthase I/flavanone-3-hydroxylase and application thereof in field of flavonoid compound synthesis | |
| CN114214332B (en) | Tianmu rehmannia anthocyanin related gene RcMYB1 and application thereof | |
| CN113801887B (en) | Rhizoctonia solani fat gene silencing segment Rslipa and application thereof | |
| CN112195178B (en) | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof | |
| CN111500595A (en) | Ephedra sinica gene CeDREB1 and application thereof | |
| CN116004711B (en) | Rhizoma acori graminei rhizome gene silencing system based on VIGS and construction method thereof | |
| CN114350675B (en) | LuNAC gene for regulating and controlling synthesis of flax secondary wall and application thereof | |
| CN116655762B (en) | Konjac AaCaM gene, protein coded by same and application thereof | |
| CN116410989B (en) | Virus-induced pseudo-ginseng PDS gene silencing system and application | |
| CN116375829B (en) | Application of Osmanthus fragrans OfWRKY36 gene in enhancement of synthesis of plant dihydro-beta-ionone | |
| CN117551655B (en) | Hybrid tulip tree low temperature resistant gene CBFs and application thereof | |
| CN112980842B (en) | Non-coding nucleotide sequence and application thereof in improving expression level of exogenous gene | |
| CN116426566A (en) | Instantaneous over-expression method of rape genes | |
| CN116515899A (en) | Blue cornflower gene silencing method based on VIGS | |
| CN118291530A (en) | Golden-silk-chrysanthemum CmFNS gene MIR-VIGS silencing system, construction method and application thereof | |
| CN115927372A (en) | MYB transcription factor SsMYB114 gene of caulis spatholobi and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |