CN115998875A - Application of METTL5 as tumor immunotherapy targeting site - Google Patents

Abstract

The application relates to the technical field of tumor medicaments, in particular to application of METTL5 serving as a tumor immunotherapy targeting point. The base sequence of METTL5 is shown in SEQ ID No. 1; wherein, METTL5 is a brand new RNAm6A methyltransferase, closely related to ribosome translation function, and METTL5 can regulate the translation of tumor immunity key regulatory factor IL-27; therefore, METTL5 is used as a tumor immunotherapy targeting point, and the expression of METTL5 related genes or encoding proteins is inhibited in a targeted manner, so that the anti-tumor immunity of an organism can be effectively stimulated, the METTL5 becomes a targeting point capable of enhancing the response rate of tumor immunotherapy, and the METTL5 is used as a tumor therapy target point and has a wide application prospect in the anti-tumor immunotherapy.

Description

Application of METTL5 as tumor immunotherapy targeting site

Technical Field

The application belongs to the technical field of tumor medicaments, and particularly relates to application of METTL5 serving as a tumor immunotherapy targeting point.

Background

Tumors refer to new organisms formed by local tissue cell proliferation under the action of various tumorigenic factors, because the new organisms are often in the form of occupying massive protrusions, also called neoplasms. Tumors fall into two broad categories, benign tumors and malignant tumors. Malignant tumors can be classified into carcinoma and sarcoma, and carcinoma refers to malignant tumors derived from epithelial tissues. Sarcoma refers to mesenchymal tissue, including fibrous connective tissue, fat, muscle, vascular, bone, cartilage tissue, and the like.

Treatment of malignant tumors has been a worldwide problem, and in recent years, prognosis of tumor patients has been improved to some extent with the advent of tumor immunotherapy. Tumor immunotherapy is to utilize the immune system of human body to resist tumor and eliminate tumor cells, so as to achieve the purpose of treating tumor, and especially, the immune checkpoint inhibitors aiming at PD-1 and PD-L1 show good effects in tumor patients, and the survival time of partial patients is prolonged. However, tumor immunotherapy faces a long-felt challenge, namely: at present, less than 30% of tumor patients respond to immunotherapy, and the effect of tumor immunotherapy is not ideal for most cancer patients, so that development of new immunotherapy targets has important significance for further improving prognosis of tumor patients.

CD8 ⁺ T cells and NK cells are cytotoxic immune cells that exert an anti-tumor immune effect by directly killing tumor cells. Studies show that infiltration of T cells and NK cells in solid tumors is positively related to prognosis of patients and is a key factor affecting tumor immunotherapy effect. Whereas tumor cells allow for infiltration of CD8 by endogenous regulation ⁺ T-cell and NK-cell depletion and inhibition of their activation, thereby destroying CD8 ⁺ T cells and NK cells exert potent anti-tumor immune defenses. Thus, modulation of CD8 in tumors was sought ⁺ The novel genes activated by T cells and NK cells can provide a novel target point for the immunotherapy of tumors, thereby being beneficial to preparing tumor immunotherapy medicaments for use.

Disclosure of Invention

The application aims to provide application of METTL5 as a tumor immunotherapy targeting point, and aims to solve the problem that a novel gene target for improving tumor immunotherapy effect is lacking in the prior art, so that preparation and use of tumor immunotherapy medicaments are affected.

In order to achieve the purposes of the application, the technical scheme adopted by the application is as follows:

in a first aspect, the present application provides the use of METTL5 as a targeting site for tumor immunotherapy, the base sequence of METTL5 being shown in SEQ ID No. 1.

Further, the application includes: METTL5 is used as a tumor immunotherapy target spot for preparing a medicine for preventing or treating tumors.

Further, the medicament includes an accelerator for tumor immunotherapy.

Further, the application includes: METTL5 is used as a tumor immunotherapy target for activating cytotoxic immune cells in immunotherapy.

Further, the mechanism of using METTL5 as a tumor immunotherapy target for immunotherapy is: by inhibiting METTL5 expression, translation of IL-27 factor is down-regulated, and cytotoxic immune cells are activated to act.

Further, the medicament also includes cytokines; wherein the cytokine comprises at least one of FasL, TNF alpha, IFN gamma and IFN beta.

In a second aspect, the present application provides the use of an agent that inhibits METTL5 expression or activity in the manufacture of a medicament for tumour immunotherapy.

Further, the drug comprises at least one of a drug for inhibiting the growth of tumor cells, a drug for improving the killing power of tumor cells, a drug for prolonging the survival time of a tumor organism, and a drug for increasing the presentation of surface antigens of tumor cells.

In a third aspect, the present application provides the use of METTL5 deleted tumor cells in the manufacture of a medicament for tumor immunotherapy.

In a fourth aspect, the present application provides a combination of a therapeutic agent for tumor immunotherapy, the combination comprising an agent that inhibits expression of the METTL5 gene, inhibits expression of the METTL5 protein, or reduces activity of the METTL5 protein, and a cytokine.

Further, the medicament also comprises pharmaceutically acceptable auxiliary materials.

METTL5 provided in the first aspect of the present application as tumor immunotherapy targetingPoint application, METTL5 is a completely novel RNA m ⁶ A methyltransferase, involved in catalyzing m at position A1832 on 18S rRNA ⁶ The A formation, 18S A1832 site is located in the compiling center of ribosome and is closely related to the normal functioning of the ribosome. Through proteomic analysis, METTL5 was found to be able to control translation of tumor immunity key regulator IL-27; therefore, METTL5 is used as a tumor immunotherapy targeting point, and the expression of METTL5 related genes or encoding proteins is inhibited in a targeted manner, so that the anti-tumor immunity of an organism can be effectively stimulated, the METTL5 becomes a targeting point capable of enhancing the response rate of tumor immunotherapy, and the METTL5 is used as a tumor therapy target point and has a wide application prospect in the anti-tumor immunotherapy.

The agent for inhibiting the expression or activity of METTL5 provided by the second aspect of the application has a wide application prospect in preparing medicines for tumor immunotherapy because the agent for inhibiting the expression or activity of METTL5 can effectively excite the anti-tumor immunity of organisms, so that the METTL5 becomes a target site capable of enhancing the response rate of tumor immunotherapy.

The application of the METTL 5-deleted tumor cells in preparing the tumor immunotherapy medicaments is beneficial to the preparation of medicaments applied to tumor immunotherapy because the METTL 5-deleted tumor cells can inhibit the expression of METTL 5-related genes or encoding proteins and can effectively excite the anti-tumor immunity of organisms.

The fourth aspect of the present application provides a combination for tumor immunotherapy, the combination comprising an agent that inhibits expression of the METTL5 gene, inhibits expression of the METTL5 protein, or reduces activity of the METTL5 protein, and a cytokine; by inhibiting expression of METTL5 related genes or encoding proteins, the anti-tumor immunity of the organism is effectively stimulated, and the tumor immunotherapy effect is improved.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following description will briefly introduce the drawings that are needed in the embodiments or the description of the prior art, it is obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic representation of the modification of nucleic acids by the sgRNA targeting mouse Mettl5 locus and the deletion of Mettl5 provided in the examples of the present application;

FIG. 2 is a graph of whole proteomic analysis of wild-type and Mettl5 knockout cell lines using quantitative mass spectrometry as provided in the examples of the present application;

FIG. 3 is a graph of tumor growth and final tumor gravimetric analysis following subcutaneous injection of Mettl5 deleted and wild type B16-F10 tumor cells in C57BL/6N mice provided in the examples of the present application;

FIG. 4 is a graph of tumor growth and final tumor gravimetric analysis of Mettl5 deleted and wild type B16-F10 tumor cells provided in the examples of the present application after subcutaneous injection in C57BL/6N mice in combination with PD-1 treatment;

FIG. 5 is a schematic representation of the immunohistochemical analysis of CD8 in day 20 tumor cells after subcutaneous inoculation of Mettl5 deletion and wild type B16-F10 tumor cells in C57BL/6N mice as provided in the examples of the present application ⁺ T cell infiltration analysis;

FIG. 6 is a graph of analysis of immune cell infiltration in vivo on day 20 after subcutaneous inoculation of Mettl5 deletion and wild type B16-F10 tumor cells in C57BL/6N mice as provided in the examples of the present application.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved by the present application more clear, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application.

In this application, the term "and/or" describes an association relationship of an association object, which means that there may be three relationships, for example, a and/or B may mean: a alone, a and B together, and B alone. Wherein A, B may be singular or plural. The character "/" generally indicates that the context-dependent object is an "or" relationship.

In the present application, "at least one" means one or more, and "a plurality" means two or more. "at least one of" or the like means any combination of these items, including any combination of single item(s) or plural items(s). For example, "at least one (individual) of a, b, or c," or "at least one (individual) of a, b, and c," may each represent: a, b, c, a-b (i.e., a and b), a-c, b-c, or a-b-c, wherein a, b, c may be single or multiple, respectively.

It should be understood that, in various embodiments of the present application, the sequence number of each process does not mean that the sequence of execution is sequential, and some or all of the steps may be executed in parallel or sequentially, where the execution sequence of each process should be determined by its functions and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

The terminology used in the embodiments of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in this application in the examples and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

The weights of the relevant components mentioned in the embodiments of the present application may refer not only to specific contents of the components, but also to the proportional relationship between the weights of the components, and thus, any ratio of the contents of the relevant components according to the embodiments of the present application may be enlarged or reduced within the scope disclosed in the embodiments of the present application. Specifically, the mass in the specification of the embodiment of the present application may be a mass unit well known in the chemical industry field such as μ g, mg, g, kg.

The terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated for distinguishing between objects such as substances from each other. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature.

In a first aspect, the embodiments of the present application provide an application of METTL5 as a targeting site for tumor immunotherapy, wherein the base sequence of the METTL5 is shown in SEQ ID No. 1.

The application of the METTL5 provided by the first aspect of the embodiment of the application as a tumor immunotherapy targeting point, wherein the METTL5 is a brand-new RNA m6A methyltransferase, participates in catalyzing the formation of m6A at the A1832 site on 18S rRNA, and the 18S A1832 site is positioned in the compiling center of ribosome and closely related to the ribosome translation function, and the METTL5 is found to be capable of controlling the translation of a tumor immunity key regulatory factor IL-27 through proteomic analysis; therefore, METTL5 is used as a tumor immunotherapy targeting point, and the expression of METTL5 related genes or encoding proteins is inhibited in a targeted manner, so that the anti-tumor immunity of an organism can be effectively stimulated, the METTL5 becomes a targeting point capable of enhancing the response rate of tumor immunotherapy, and the METTL5 is used as a tumor therapy target point and has a wide application prospect in the anti-tumor immunotherapy.

In some embodiments, the base sequence of METTL5 is as shown in SEQ ID No.1, SEQ ID No.1 specifically:

gtacttccggcactgcggggagggaccgcgaggaccagctagaggcatacgagtgctttcctggagcgtctgggttcc

acgggcggcgatccccgcgaggctcgtgggatcccctcgctgagtcctaaatagtctgtccccgaccctccaccccacc

cccaccctgcaccgctggggagtttcgggttaggtagacttccctgcagctcccgtgctgtgaagccccaggagcccaa

actttaaaatacagagaaaacgatgaagaagttaaagcttaaggaactagagagtcgcctgcaagaagtggatggattcg

aaaagcccaagttacttctagaacagtatcccaccaggccgcacattgcagcatgcatgctttatacaatccataacacata

cgatgacattgaaaacaaagcggttgcagatctaggatgtggctgtggagtacttagcatcggagcggcaatgctagga

gcagggttgtgtgttggatttgacatagatgaagatgcactggaaatatttaataagaatgtggaagagtttgagctaacaa

atgttgatatgattcagtgtgatgtgtactcattatctaacagaatgtccaagttatttgatacagtaattatgaatcctccctttg

ggaccaaaaataataaagggacagatatggcttttctgaagactgctttgggaatggcaagaacagcagtatattctttaca

caagtcctcaactagggaacatattcaaaagaaagctgctgaatggaaagtcaagatagaaattattgcagagcttcgata

tgatctaccagcattatacaactttcataaaaagaaatctgtggacatcgaagtggacctaattcgcttttctttttaaaagcttctgaagacaaaaagcagcttaaaatctaactaaggaataaaaacactgcttactaaataaactacttgtctctagca。

in some embodiments, the use of METTL5 as a tumor immunotherapy targeting site, during which the killing of tumor cells by combined immune checkpoint therapy is increased, including the killing of tumor cells by cytokines or cytokine combinations and the killing of tumor cells by immune cells; wherein, the immune cells comprise CTL, TH, NK and other tumor killing cells, and the cytokines comprise FasL, TNF alpha, IFN gamma or IFN beta; cytokine combinations include two or more of FasL, TNF alpha, IFN gamma and IFN beta.

In some embodiments, the use of METTL5 as a targeting site for tumor immunotherapy can be beneficial for inhibiting tumor cell growth by targeting METTL 5. Inhibiting tumor cell growth includes promoting apoptosis of tumor cells, inhibiting tumor cell neoplasia, and tumor cell clearance by the immune system.

In some embodiments, the application comprises: METTL5 is used as a tumor immunotherapy target spot for preparing a medicine for preventing or treating tumors. Because METTL5 is used as a tumor immunotherapy target point, the development of medicaments related to tumor immunotherapy can be promoted, the developed medicaments for preventing or treating tumors can influence the global mRNA translation by inhibiting the expression of METTL5, so that the anti-tumor immunity of organisms is effectively stimulated, the METTL5 becomes a target site capable of enhancing the response rate of tumor immunotherapy, and the METTL5 is used as a tumor therapy target point and has wide application prospect in the anti-tumor immunotherapy.

In some embodiments, the medicament includes an accelerator for tumor immunotherapy. In a specific use process, the medicament for preventing or treating tumor prepared by taking METTL5 as a tumor immunotherapy target spot can be used as an accelerator together with other tumor immunotherapy medicaments so as to improve the effect of tumor immunotherapy.

In some embodiments, the application comprises: METTL5 is used as a tumor immunotherapy target for activating cytotoxic immune cells in immunotherapy.

In some embodiments, the mechanism for immunotherapy with METTL5 as a tumor immunotherapy target is: by inhibiting METTL5 gene expression, translation of IL-27 factor is down-regulated, and cytotoxic immune cells are activated to act.

In some embodiments, the cytotoxic immune cells include NK cells, CD8 ⁺ At least one of the T cells.

In some embodiments, the dosage form of the medicament is selected from at least one of a tablet, a capsule, a granule, a pill, an injection, a suspension, a dispersion, a syrup. However, the dosage form of the medicament of the invention is not limited to this, and other dosage forms which can be realized are within the protection scope of the invention.

In some embodiments, the medicament further comprises a medicament auxiliary material, and pharmaceutically acceptable medicament auxiliary materials are added into the medicament to ensure the preparation and clinical application of the prepared medicament. In some embodiments, the pharmaceutical excipients are selected from at least one of diluents, wetting agents, binders, lubricants, colorants, coating agents. In some embodiments, the weight and volume of the medicament are enhanced primarily by the addition of diluents to facilitate shaping and dosing, in preferred embodiments of the invention the diluents are selected from, but not limited to, at least one of starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, microcrystalline cellulose. In some embodiments, the material can be moistened to create a viscosity of sufficient strength to facilitate granulation by the addition of a humectant, which in preferred embodiments of the present invention is selected from, but is not limited to, at least one of water, ethanol, glycerin. In some embodiments, the non-tacky or less tacky material is agglomerated and bound into particles by the addition of a binder, which in preferred embodiments of the present invention is selected from, but not limited to, at least one of Hypromellose (HPMC), povidone (PVP), starch slurry, syrup. In some embodiments, the coating agent and coloring agent are added to improve tablet appearance, increase drug stability, mask bad drug odors, and change the appearance of the particles; in a preferred embodiment of the present invention, the coating agent is selected from at least one of, but not limited to, acrylic resin, hypromellose, povidone, cellulose acetate; the colorant is selected from, but not limited to, at least one of titanium dioxide, sunset yellow, methylene blue.

In some embodiments, the tumor includes a primary tumor and a metastasis.

In some embodiments, the tumor comprises a malignant cancer such as melanoma, breast cancer, liver cancer, colon cancer, lung cancer, and the like.

In a second aspect, embodiments of the present application provide the use of an agent that inhibits METTL5 expression or activity in the manufacture of a medicament for tumor immunotherapy.

The agent for inhibiting the expression or activity of METTL5 provided by the second aspect of the embodiment of the application has a wide application prospect in preparing medicines for tumor immunotherapy because the agent for inhibiting the expression or activity of METTL5 can effectively excite the anti-tumor immunity of organisms, so that the METTL5 becomes a target site capable of enhancing the response rate of tumor immunotherapy.

In some embodiments, the drug comprises at least one of a drug that inhibits growth of tumor cells, a drug that increases killing of tumor cells, a drug that prolongs survival of the tumor body, a drug that increases presentation of tumor cell surface antigens.

In a third aspect, embodiments of the present application provide for the use of METTL5 deleted tumor cells in the preparation of a medicament for tumor immunotherapy.

The application of the METTL 5-deleted tumor cells in preparation of the tumor immunotherapy medicament provided by the third aspect of the application is beneficial to the preparation of the medicament applied to the tumor immunotherapy because the METTL 5-deleted tumor cells can inhibit the expression of METTL 5-related genes or encoding proteins and can effectively excite the anti-tumor immunity of organisms.

In a fourth aspect, embodiments of the present application provide a medicament for immunotherapy of tumors, which is a medicament that inhibits the expression of the METTL5 gene, inhibits the expression of the METTL5 protein, or reduces the activity of the METTL5 protein.

The fourth aspect of the embodiments of the present application provides a combination drug for tumor immunotherapy, the combination drug comprising a drug that inhibits expression of a METTL5 gene, inhibits expression of a METTL5 protein, or reduces activity of a METTL5 protein, and a cytokine; by inhibiting expression of METTL5 related genes or encoding proteins, the anti-tumor immunity of the organism is effectively stimulated, and the tumor immunotherapy effect is improved.

In some embodiments, inhibiting expression of a METTL5 gene is by gene editing to cause a base insertion mutation, a base deletion mutation, a nonsensical base mutation, or a whole gene loss of the METTL5 gene.

In some embodiments, the agent that inhibits expression of the METTL5 gene comprises an RNA molecule that interferes with the METTL5 gene.

In some embodiments, the agent that inhibits expression of a METTL5 protein or loses activity of a METTL5 protein comprises a METTL5 protein antibody or a small molecule inhibitor of a METTL5 protein.

In some embodiments, the cytokine includes FasL, TNF alpha, IFN gamma or IFN beta; cytokine combinations include two or more of FasL, TNF alpha, IFN gamma and IFN beta.

In some embodiments, the medicament further comprises pharmaceutically acceptable auxiliary materials, and pharmaceutically acceptable auxiliary materials are added into the medicament to ensure the preparation and clinical application of the prepared medicament. In some embodiments, the pharmaceutical excipients are selected from at least one of diluents, wetting agents, binders, lubricants, colorants, coating agents. In some embodiments, the weight and volume of the medicament are enhanced primarily by the addition of diluents to facilitate shaping and dosing, in preferred embodiments of the invention the diluents are selected from, but not limited to, at least one of starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, microcrystalline cellulose. In some embodiments, the material can be moistened to create a viscosity of sufficient strength to facilitate granulation by the addition of a humectant, which in preferred embodiments of the present invention is selected from, but is not limited to, at least one of water, ethanol, glycerin. In some embodiments, the non-tacky or less tacky material is agglomerated and bound into particles by the addition of a binder, which in preferred embodiments of the present invention is selected from, but not limited to, at least one of Hypromellose (HPMC), povidone (PVP), starch slurry, syrup. In some embodiments, the coating agent and coloring agent are added to improve tablet appearance, increase drug stability, mask bad drug odors, and change the appearance of the particles; in a preferred embodiment of the present invention, the coating agent is selected from at least one of, but not limited to, acrylic resin, hypromellose, povidone, cellulose acetate; the colorant is selected from, but not limited to, at least one of titanium dioxide, sunset yellow, methylene blue.

The following description is made with reference to specific embodiments.

Example 1

Construction of B16-F10 (murine melanoma cells) and 4T1 (murine breast cancer cells) cell lines knocked out of Mettl5 and detection of changes in apparent modification of RNA in Mettl5 deleted and wild-type B16-F10 cells; and whole proteome quantitative analysis was performed on wild type and Mettl5 knockout cell lines using protein mass spectrometry.

The specific experimental steps are as follows:

1. plasmids of interest for Cas9 and Mettl5 sgrnas were transiently loaded in B16-F10 and 4T1 cells, respectively, using CRISPR-Cas9 technology.

1.1. The method comprises the steps of designing a sgRNA sequence, wherein the coding sequences of the sgRNAs are sgRNA1 and sgRNA2, the sequence of the sgRNA1 is shown as SEQ ID No.2, and the sequence of the sgRNA2 is shown as SEQ ID No. 3:

sgRNA1 is shown as SEQ. ID No.2, and is: AGCATCGGAGCGGCAATGCT.

sgRNA2 is shown as SEQ ID No.3, and is: CCCTTTGGGACCAAAAATAA.

1.2. In vitro culture of B16-F10 and 4T1 cell lines, cells were followed 4X 10 in advance ⁵ Inoculating the cells/well into 6-well plate cell culture plate at 37deg.C with 5% CO ₂ Culturing in incubator overnight, and performing transient rotation after the cells are completely adhered and the confluence is about 70%, wherein the reaction system is as followsThe steps are as follows in Table 1:

TABLE 1

1.3. Flow sorting

1) After 48 hours, confirming that the cell transfection is successful through a fluorescence microscope;

2) Simultaneously digesting the transfected cells and untreated cells into single cell suspension, centrifuging at 1000rpm for 5min at room temperature, removing pancreatin from the supernatant after centrifugation, re-suspending the cells with 300 mu L of complete medium and transferring to a flow tube;

3) Spreading a complete culture medium containing 2% of double antibodies to a 96-well plate, placing cells and the 96-well plate on ice, and transferring to a flow cell room;

4) Single cells were sorted into 96-well plates by FACS Aria (instrument model) according to instrument instructions;

5) After sorting, the culture was continued at 37℃in a 5% CO2 incubator until monoclonal formation.

1.4. Preliminary identification of monoclonal cell gene editing

1) The editing region is designed to identify primers Mettl 5F and Mettl 5R, wherein the sequence of Mettl 5F is shown as SEQ ID No.4, and the sequence of Mettl 5R is shown as SEQ ID No. 5:

Mettl5 F(SEQ.ID No.4)：ATGCATGCTTTATACAATC。

Mettl5 R(SEQ.ID No.5)：AAAATGACAACCCAGATCAC。

2) Lysing the monoclonal cells to obtain a genome:

40. Mu.L of NaOH (50 mM) -EDTA solution was added, and after boiling at 98℃for 8min, 40. Mu.L of Tris-HC (50 mM) was added for neutralization, and after shaking and mixing, centrifugation was performed, followed by amplification of specific sequences by PCR with 1. Mu.L of the lysate, the reaction system and conditions were as shown in Table 2 below:

TABLE 2

3) First generation sequencing of PCR products

1.5. Selecting successfully edited monoclonal identified by first sequencing, further perfecting TA cloning to ensure that sister chromosomes are edited, and reacting the following steps:

1) The reaction system is shown in Table 3,

TABLE 3 Table 3

2) Add 5. Mu.L (equal) of Solution I;

3) Reacting for 30min at 16 ℃;

4) The whole amount (10. Mu.L) was added to 50. Mu.L Top10 competent cells and left on ice for 30min;

5) Heating at 42deg.C for 45 seconds, and standing in ice for 1min;

6) Adding 500 mu L of antibiotic-free culture medium, and culturing at 37 ℃ for 60min in a shaking way;

7) Culturing on an L-agar plate culture medium containing Amp to form single colony;

8) 20 monoclonal colonies were picked, amplified using the PCR method (systems, conditions as above) and sequenced.

2. The change in apparent modification of RNA in wild type and Mettl5 knockout cells was detected by liquid chromatography-tandem mass spectrometry.

2.1. Total RNA extraction

1) Adherent cells: the medium was discarded and the cells were washed once with PBS buffer every 5-10X 10 ⁶ Adding 1mL of Trizol reagent into each cell, and placing on ice for 5min;

2) Adding 0.2 volume of chloroform (0.2 mL), mixing completely, incubating on ice for 1-5min, separating phase of the solution, centrifuging at 12,000g at 4 deg.C for 10min, and collecting upper water phase (0.5 mL);

3) Adding equal volume of isopropanol (0.5 mL) into the supernatant, fully mixing, centrifuging at 12,000g and 4 ℃ for 10min, and allowing a small amount of RNA precipitate to be seen at the bottom of the tube; discarding the supernatant;

4) Immediately adding 1mL of 75% ethanol, reversely and uniformly mixing for a plurality of times, washing the precipitate, centrifuging at 12,000g for 5min at 4 ℃, and discarding the supernatant;

5) The nozzle was opened and air-dried for 5-10min to volatilize the residual liquid, and the pellet was dissolved with 20. Mu.L DEPC.

RNA cleavage

1) The RNA was cleaved into single bases with enzymes, and the reaction system was as follows in Table 4:

TABLE 4 Table 4

Nuclease P1	1μL
		Phosphatase enzyme	1μL
10x phosphatase buffer	2μL
		RNA	200ng
ddH2O	up to 20μL

2) Culturing overnight at 37deg.C;

3) Diluting the sample to 100 mu L and centrifuging at 12,000g for 1min to obtain a supernatant to the upper sampling tube;

4) Loading 5 μl of the solution into a liquid chromatograph-tandem mass spectrometer (LC-MS/MS, agilent 6410 QQQ triple quadrupole mass spectrometer);

nucleosides were quantified by using retention times of 282.1-150.1 (m 6A) and 268-136 (A) and mass transitions of nucleosides to alkali ions.

Example 2

Female SPF-grade nude mice, C57BL/6N and Balb/C mice are taken as experimental objects, a tumor-bearing mouse model is constructed by using Mettl5 deletion and wild type B16-F10 and 4T1 tumor cells, and combined with PD-1 immunotherapy, and tumor growth, final tumor weight and tumor anatomy are detected, wherein the specific experimental steps are as follows:

1. subcutaneously vaccinating C57BL/6N mice with Mettl5 deleted and wild type B16-F10 tumor cells, each mouse was subcutaneously injected 2.5X10 ⁵ A cell;

2. tumor volume was measured starting on day 11 and measured every 2 days, calculated from subcutaneous inoculation as day 0;

3. tumor-bearing mice were euthanized (cervical) by day 20, tumors were blunt-isolated with surgical scissors (sterile) such as ophthalmic scissors, and final tumor weights were measured and tumor body sizes recorded.

4. Subcutaneously vaccinating C57BL/6N mice with Mettl5 deleted and wild type B16-F10 tumor cells, each mouse was subcutaneously injected 2.5X10 ⁵ A cell;

5. 100 ug/PD-1 was injected from subcutaneous inoculation at days 4, 7, 10, 13, 16, and tumor volumes were measured starting at day 10, once every 2 days; in tumor volume of over 2000mm ² For mortality criteria, mice survival was recorded for each group.

6. Mettl5 deletion and wild type 4T1 tumor cells were inoculated subcutaneously in Balb/c mice, each injected subcutaneously 5X 10 ⁵ A cell;

7. 100 ug/PD-1 was injected from subcutaneous inoculation at days 4, 7, 10 and tumor volumes were measured starting at day 7, once every 2 days; in tumor volume of over 2000mm ² For mortality criteria, mice survival was recorded for each group.

Example 3

A mouse tumor-bearing model was constructed according to the method of example 2, and the spleen and tumor in vivo immune cell infiltration of experimental mice was detected by immunohistochemistry and flow analysis. The experimental procedure was as follows:

1. the tumor body tissue is taken for immunohistochemistry, and the specific steps are as follows:

1.1. euthanizing (removing neck) tumor-bearing mice, and performing blunt separation on tumors by using surgical scissors (asepsis) such as ophthalmic scissors;

1.2. the isolated tumors were placed in HBSS solution (sterile) and the tumors were weighed and recorded; then placing in 4% paraformaldehyde solution;

1.3. flushing: after the 4% paraformaldehyde solution is fixed for 24 hours, taking out the material from the fixing solution, washing the material in 70% alcohol for several times, and adding a few drops of ammonia water into the alcohol until the yellow color is washed;

1.4. dehydrating: 70% alcohol, 80% alcohol, 90% alcohol, 95% alcohol, absolute alcohol I and absolute alcohol II;

1.5. and (3) transparency: absolute ethanol and xylene solution (1:1) →xylene I→xylene II;

1.6. wax dipping: the whole process of wax dipping should be carried out in a constant temperature device, and the constant temperature box is adjusted to 58 ℃. The mixed solution (1:1) of dimethylbenzene and paraffin, paraffin I and paraffin II are thoroughly immersed, otherwise, the residual transparent agent in the tissues can cause difficulty in the slicing process and influence the quality of the slices;

1.7. embedding: injecting melted paraffin into the box, placing the waxed tissue block into the box to quickly cool and harden the wax block, and storing the tissue block in the wax block for a long time

1.8. Slicing: after the embedded tissue block is corrected, cutting the tissue block into paraffin tapes with the diameter of 5-7 mu m by using a slicing machine;

1.9. sticking: spreading the tissue paraffin tape in warm water at 50 ℃, then fishing the tissue paraffin tape with a glass slide which is treated by 1% hydrogen chloride solution, and sticking the tissue paraffin tape on the glass slide;

1.10. baking slices: baking the bonded glass slide in an incubator at about 35 ℃ for 2-3 hours;

1.11. dewaxing: the paraffin sections were placed in a 67℃oven, dried for 2 hours, dewaxed to water, rinsed three times with PBS pH7.4 for 3min (3X 3');

1.12. antigen retrieval: taking a certain amount of pH=6.0 citrate buffer solution, adding the citrate buffer solution into a microwave box, heating the solution to boiling by microwaves, placing the dewaxed and hydrated tissue slices on a high-temperature-resistant plastic slice frame, placing the tissue slices into the boiled buffer solution, performing medium-grade microwave treatment for 10min, taking out the microwave box, naturally cooling water, taking out a slide from the buffer solution, washing the slide twice by distilled water, and then washing the slide 2 multiplied by 3' by PBS;

1.13. removing PBS, adding 1 drop of corresponding primary antibody (corresponding dilution) to each slice, and incubating for 2 hours at room temperature;

PBS rinse 3X 5'. The PBS was removed, and 1 drop of polymer enhancer (reagent A) was added to each slice and incubated at room temperature for 20min. PBS rinse 3 x 3';

1.15. the PBS was removed, and 1 drop of enzyme-labeled anti-mouse/rabbit polymer (reagent B) was added to each slice and incubated for 30min at room temperature. PBS rinse 3 x 5';

1.16. removing PBS liquid, adding 1 drop of freshly prepared DAB liquid into each slice, and observing for 5min under a microscope;

1.17. hematoxylin counterstain, 0.1% HCl differentiation, tap water washing, bluing, slicing, gradient alcohol dehydration drying, xylene transparency, neutral gum sealing, airing and observation.

2. The tumor body tissue and spleen are taken for flow analysis, and the specific steps are as follows:

2.1. euthanizing (removing neck) tumor-bearing mice, and performing blunt separation on tumors by using surgical scissors (asepsis) such as ophthalmic scissors;

2.2. the isolated tumors were placed in HBSS solution (sterile) and the tumors were weighed and recorded;

2.3. cutting tumor tissues stored in the HBSS solution into tiny tissue particles (1 mm-3 mm) by using a sterile surgical scissors;

2.4. adding corresponding collagenase IV type solution to digest at 37 ℃ for about 30-45 min;

2.5. filtering and grinding the digested tumor tissue by using a 100 mu M cell sieve, and adding 5 times of volume of PBS to terminate the collagenase IV type solution;

2.6. centrifuging the tumor suspension with the digestion stopped at 4 ℃ and 400g for 5min to obtain a cell precipitate;

2.7. lysing the cell pellet with erythrocyte lysate, re-suspending with 4mL ACK solution, lysing for 4min, and then adding 5 volumes of PBS for termination;

2.8. centrifuging the tumor suspension of which the lysis of erythrocytes is stopped at 4 ℃ and 400g for 5min to obtain a cell precipitate;

2.9. a corresponding volume of PBS (containing 0.5% BSA) was added to the tumor size (mass) for resuspension and counting;

2.10. transferring 1X 106-1X 107 cells to a flow cell tube, and centrifuging at 4 ℃ for 400g and 5min to obtain cell sediment;

2.11. resuspension each tumor sample with 50 μl of the formulated antibody blocking solution (containing dead living dye Zombie) for 10-15min;

2.12. adding 50 mu L of prepared antibody mixed staining solution into each tumor sample, wherein the total staining system is 100 mu L, and the staining time is 30-45 min;

2.13. adding 2mL of PBS (containing 0.5% BSA) for staining termination, and centrifuging at 4 ℃ for 400g and 5min to obtain cell sediment;

2.14.2mL of PBS (containing 0.5% BSA) was resuspended, and centrifuged at 400g at 4℃for 5min to obtain a cell pellet;

2.15.500. Mu.L of PBS (0.5% BSA) solution resuspended cell pellet for flow analysis.

Analysis of Properties and description of results

FIG. 1 is the experimental results of example 1, showing that m of RNA in cells of Mettl5 KO1 and KO2 ¹ The A modification was reduced, indicating that the B16-F10 (mouse melanoma cells) and 4T1 (mouse breast cancer cells) cell lines were successfully constructed to knock out Mettl 5.

FIG. 2 is the experimental results of example 1, showing that IL-27 protein levels were significantly altered after Mettl5 knockout, indicating that Mettl5 may affect tumor immune microenvironment by modulating IL-27 expression.

FIG. 3 is a graph showing the experimental results of example 2, showing that B16-F10 tumor cells with Mettl5 deletion grew more slowly subcutaneously in C57BL/6N mice than wild-type B16-F10 tumor cells, suggesting that Mettl5 deletion may delay tumor cell growth in an in vivo environment.

FIG. 4 shows the experimental results of example 2, wherein the effect of B16-F10 tumor cells deleted in Mettl5 combined with PD-1 is better than that of B16-F10 tumor cells alone in tumor-bearing model, suggesting that inhibition of METTL5 can enhance tumor immunotherapy response rate; and the effect was verified in 4T1 tumors.

FIG. 5 is a graph showing the experimental results of example 3, immunohistochemical results showing the in vivo CD8 deletion of Mettl5 after 20 days post-subcutaneous inoculation of C57BL/6N mice with Mettl5 deleted and wild type B16-F10 tumor cells ⁺ Increased T cell infiltration, suggesting that inhibition of METTL5 may enhance CD8 ⁺ Infiltration in T cell tumor to enhance tumor killing effect; and the effect was verified in 4T1 tumors.

FIG. 6 is a graph showing the results of the experiment of example 3, and the results of the flow assay show that C57BL/6N mice were subcutaneously vaccinated with Mettl5 deletion and with in vivo CD8 from wild type B16-F10 tumor cells at day 20 post-tumor cell mass ⁺ T, NK cell infiltration is increased, suggesting that inhibition of METTL5 can enhance intratumoral infiltration of cytotoxic immune cells, enhancing tumor killing.

In conclusion, the application of METTL5 as tumor immunotherapy targeting point provided by the application, METTL5 is a brand new RNAm ⁶ A methyltransferase, involved in catalyzing m at position A1832 on 18S rRNA ⁶ A is formed, a 18S A1832 site is positioned in the compiling center of a ribosome, is related to the functioning of the ribosome, and is found through proteomic analysis that METTL5 can regulate the translation of a tumor immunity key regulatory factor IL-27; therefore, METTL5 is used as a tumor immunotherapy targeting point, and the expression of METTL5 related genes or encoding proteins is inhibited in a targeted manner, so that the anti-tumor immunity of an organism can be effectively stimulated, the METTL5 becomes a targeting point capable of enhancing the response rate of tumor immunotherapy, and the METTL5 is used as a tumor therapy target point and has a wide application prospect in the anti-tumor immunotherapy.

The foregoing description of the preferred embodiments of the present application is not intended to be limiting, but is intended to cover any and all modifications, equivalents, and alternatives falling within the spirit and principles of the present application.

Claims (10)

1. The application of METTL5 as a tumor immunotherapy targeting site, wherein the base sequence of the METTL5 is shown as SEQ ID No. 1.
2. 2. The use of METTL5 of claim 1, as a tumor immunotherapy targeting site, comprising: the METTL5 is used as a tumor immunotherapy target point for preparing a medicine for preventing or treating tumors.
3. 3. Use of METTL5 as claimed in claim 2 as a target site for tumour immunotherapy, wherein said medicament comprises an accelerator for tumour immunotherapy.
4. 4. The use of METTL5 of claim 1, as a tumor immunotherapy targeting site, comprising: activating cytotoxic immune cells in immunotherapy by taking the METTL5 as a tumor immunotherapy target; wherein, the mechanism for using the METTL5 as a tumor immunotherapy target for immunotherapy is as follows: by inhibiting METTL5 expression, the translation of a tumor immunity key regulator IL-27 is down-regulated, and cytotoxic immune cells are activated to perform the action.
5. 5. The use of METTL5 of claim 2, wherein said medicament further comprises a cytokine as a tumor immunotherapy targeting site; wherein the cytokine comprises at least one of FasL, TNF alpha, IFN gamma and IFN beta.
6. 6. The use of an agent that inhibits METTL5 expression or activity in the manufacture of a medicament for tumour immunotherapy.
7. 7. The use of claim 6, wherein the medicament comprises at least one of a medicament that inhibits growth of tumor cells, a medicament that increases killing of tumor cells, a medicament that increases survival time of a tumor body, a medicament that increases presentation of a tumor cell surface antigen.
8. 8. Use of METTL 5-deficient tumor cells in the preparation of a medicament for tumor immunotherapy.
9. 9. A combination for use in tumor immunotherapy, said combination comprising an agent that inhibits the expression of the METTL5 gene, inhibits the expression of the METTL5 protein, or reduces the activity of the METTL5 protein, and a cytokine.
10. 10. The medicament of claim 9, further comprising a pharmaceutically acceptable excipient.

Images