CN115992135A - LncRNA IFA and application thereof in porcine ovarian granulosa cells - Google Patents

Abstract

The invention discloses lncRNA IFA and application thereof in porcine ovarian granulosa cells. According to the invention, the open reading frame of the lncRNA IFA is predicted, the protein coding capacity is detected by constructing a carrier for verifying the protein coded by the lncRNA IFA, and the proliferation, apoptosis ratio, cell activity and cell cycle process of the porcine ovarian granulosa cells are detected after the lncRNA IFA is overexpressed and interfered, so that the lncRNA IFA can promote the proliferation of the ovarian granulosa cells, inhibit the apoptosis, improve the activity of the ovarian granulosa cells, accelerate the cell cycle process of the granulosa cells, and accumulate materials for the research on the proliferation apoptosis regulation mechanism of the ovarian granulosa cells.

Description

LncRNA IFA and application thereof in porcine ovarian granulosa cells

Technical Field

The invention belongs to the technical fields of cell engineering and genetic engineering, and particularly relates to lncRNA IFA and application thereof in porcine ovarian granulosa cells.

Background

LncRNA generally refers to endogenous cellular RNA molecules that are more than 200 nucleotides in length linked, and can be classified into five categories, sense lncRNA (Sense lncRNA), antisense LncRNA (Antisense lncRNA), intron lncRNA (Intronic lncRNA), bidirectional lncRNA (Divergent lncRNA), and intergenic lncRNA (Intergenic lncRNA), based on the anatomical nature of the gene locus of LncRNA.

According to the current research data, the mode of action of lncRNA is largely divided into four types:

1. signal (Signal): lncRNA has the function of directly regulating and controlling the transcription of downstream genes, and can be used as a signal transduction molecule to participate in the transduction of a special signal path.

2. Bait (Decoys): lncRNA can be used as a molecular blocking agent to combine with DNA binding protein so as to block the action of the protein molecule; or the molecular sponge serving as microRNA through a ceRNA mechanism can block the inhibition of the microRNA on downstream target mRNA.

3. Scaffold (scanfo): lncRNA serves as a medium, and a plurality of protein molecules are combined simultaneously to form a protein-lncRNA complex, so that information integration and communication between different signal paths are realized.

4. Guide (Guide): lncRNA binds to a protein molecule (e.g., a transcription factor) and directs it to a specific DNA sequence, promoting the protein to exert its effect.

Currently, there have been a number of studies showing that lncRNA can be involved in the regulation of cell proliferation, apoptosis, migration and differentiation through different modes of action.

Oocytes, granulosa cells and membranous cells constitute the major structure of follicles. During follicular development, the morphological changes most pronounced in follicular development are characterized by proliferation of granulosa cells and formation of follicular cavities. In the primordial follicle stage, the oocyte is wrapped by a single layer of flat granulosa cells, the granulosa cells gradually proliferate to a plurality of layers along with the development of the follicle, the morphology is changed from flat to columnar, and the cumulus granulosa cells wrapping the oocyte and the wall layer granulosa cells clung to the inner wall of the follicle are formed before the follicle is mature and ovulated. In addition, a great deal of research has generally suggested that follicular development, ovulation process and proliferation and differentiation of granulosa cells are closely related, and excessive apoptosis of granulosa cells causes follicular locking.

Disclosure of Invention

To solve the problems, the primary objective of the present invention is to provide a long-chain non-coding RNA.

Another object of the invention is to provide the use of the long non-coding RNA described above in porcine ovarian granulosa cells.

In order to achieve the above object, the present invention adopts the following technical scheme:

a long non-coding RNA designated lncRNA IFA, having a nucleotide sequence as set forth in seq id NO: 1.

The long-chain non-coding RNA related biological material is any one or a combination of more of the following biological materials:

1) A DNA molecule encoding the long non-coding RNA;

2) An expression cassette comprising the DNA molecule of 1);

3) A recombinant vector comprising the DNA molecule described in 1), or a recombinant vector comprising the expression cassette described in 2);

4) A small interfering RNA fragment that inhibits expression of the long non-coding RNA;

5) A recombinant cell comprising the DNA molecule of 1), or a recombinant cell comprising the expression cassette of 2), or a recombinant cell comprising the recombinant vector of 3), or a recombinant cell comprising the small interfering RNA fragment of 4).

Further, the DNA molecule of 1) is prepared by: extracting RNA of the porcine ovary granulosa cells, reversely transcribing the RNA into cDNA, and carrying out PCR amplification by taking the cDNA as a template to obtain the target fragment.

Further, the primers used for PCR amplification are as follows:

lncRNA IFA F：5’-GGCGATGCCTGGGTACATGG-3’；

lncRNA IFA R：5’-GAGACCGCGTCCACTCCGCC-3’。

further, the recombinant vector in 3) is prepared by the following method: the DNA molecule was ligated to pcDNA3.1 vector digested with restriction enzymes BamHI and XbaI to give a recombinant vector.

Further, the small interfering RNA fragments of 4) have the targeting sequence: 5'-TGACCTGGGCGACGTAGCA-3'.

The long-chain non-coding RNA or the biological material related to the long-chain non-coding RNA is applied to porcine ovarian granulosa cells, and in vitro environment, the long-chain non-coding RNA positively regulates any one or more functional phenotypes in cell proliferation, apoptosis, cell activity and cell cycle progression.

Further, increasing exogenous lncRNA IFA, promoting cell proliferation, inhibiting apoptosis, increasing cell activity, and/or accelerating cell cycle progression; inhibiting lncRNA IFA expression, inhibiting cell proliferation, promoting apoptosis, reducing cell activity, and/or blocking cell cycle progression.

The application of the long-chain non-coding RNA or DNA molecule or the expression cassette or the recombinant vector in the preparation of medicaments is characterized in that the medicaments are any one or a combination of more of the following medicaments:

i, a drug for promoting proliferation of porcine ovary granulosa cells;

II, a drug for inhibiting apoptosis of porcine ovary granular cells;

III, a drug for improving the activity of porcine ovary granular cells;

IV, accelerating the cell cycle process of the porcine ovary granular cells;

v. a medicine for promoting follicular development.

LncRNA IFA (Inhibitor of Follicular Atresia, temporarily named) is LncRNA obtained by RNA-seq against porcine ovarian granulosa cells, with a nucleotide sequence as set forth in seq id NO:1, it may play an important role in the proliferation, apoptosis, and regulation of ovarian granulosa cells.

The invention firstly determines the total sequence of the lncRNA IFA and whether the lncRNA IFA has the capacity of encoding protein or not through genetic engineering and cell engineering technology, and further determines the application of the lncRNA IFA in the ovarian granulosa cell proliferation and apoptosis regulation.

The verification result of the invention is as follows:

1. the invention obtains the full-length sequence of the lncRNA IFA through a 5'/3' RACE experiment (a in figure 1); the bioinformatics website (CPC 2.0) prediction showed that lncRNA IFA did not have protein encoding capability (b in fig. 1); analysis of the lncRNA IFA sequence by the ORF finder tool of the NCBI website found that 3 ORFs were present in the sequence (c in fig. 1).

2. The present invention detects by plasmid transfection and fluorescence imaging that green fluorescence can be detected in granulosa cells transfected with pcDNA3.1-EGFP plasmid, whereas green fluorescence cannot be detected in granulosa cells transfected with pcDNA3.1, pcDNA3.1-Mut EGFP and pcDNA3.1-ORF+mut EGFP plasmids (FIG. 2 b).

3. According to the invention, through an EdU (5-ethyl-2' -deoxyuretine) experiment, under an in vitro environment, the over-expression of the lncRNA IFA can promote the proliferation of ovarian granulosa cells (P < 0.01), and the interference of the lncRNA IFA can inhibit the proliferation of the ovarian granulosa cells (P < 0.05) (figure 3).

4. The invention proves that under the in vitro environment, the cell activity of the ovarian granulosa cells after the lncRNA IFA is over-expressed is obviously enhanced (P < 0.01), and the cell activity of the ovarian granulosa cells after the lncRNA IFA is interfered is obviously inhibited (P < 0.01) (b in fig. 4).

5. According to the invention, through Flow Cytometry (FCM) experiments, under an in vitro environment, the over-expression of the lncRNA IFA can obviously inhibit apoptosis of ovarian granulosa cells (P < 0.01), accelerate cell cycle progress of the ovarian granulosa cells (P < 0.05), obviously reduce apoptosis rate of the ovarian granulosa cells (P < 0.001) after interference of the lncRNA IFA, and obviously inhibit the cell cycle progress (P < 0.01) (a in fig. 5 and 4).

Compared with the prior art, the invention has the following advantages and effects:

the invention takes a newly discovered long-chain non-coding RNA (ribonucleic acid) IFA as a research object, adopts a molecular cell biology method, firstly amplifies the whole sequence of the IFA, and proves that the IFA does not have the capability of coding protein; subsequently, the influence of the lncRNA IFA on the proliferation, apoptosis, cell activity and cell cycle of the ovarian granulosa cells is studied, and the lncRNA IFA is proved to be capable of promoting the proliferation and inhibiting the apoptosis of the ovarian granulosa cells, enhancing the cell activity of the ovarian granulosa cells and accelerating the cell cycle process of the ovarian granulosa cells.

Drawings

FIG. 1 is a 5'/3' RACE of lncRNA IFA and an open reading frame, protein coding potential prediction result graph; wherein a is a 5'/3' RACE product gel electrophoresis result, b is NCBI ORF finder open reading frame prediction result, and c is CPC 2.0 website prediction result;

FIG. 2 is a diagram of verification of the encoding ability of the lncRNA IFA protein; a is a structural schematic diagram of a protein coding capacity verification vector, and b is a green fluorescent acquisition photograph of the granulosa cells transfected with four vectors;

FIG. 3 is a graph showing the results and analysis of EdU detection of cell proliferation;

FIG. 4 is a graph showing cell cycle and cell activity assays; wherein a is a cell cycle detection result and an analysis chart, and b is a CCK8 detection cell activity result and an analysis chart;

FIG. 5 shows the results of apoptosis detection and analysis.

Detailed Description

The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto. It should be understood that the embodiments described in this specification are only for explaining the present invention, and are not intended to limit the present invention, and parameters, proportions, etc. of the embodiments may be selected according to the circumstances without materially affecting the results. The examples are, unless otherwise indicated, all the reagents and method steps conventional in the art. The reagents and starting materials used in the present invention are commercially available unless otherwise specified.

Example 1: construction of lncRNA IFA overexpression vector

The BioEdit software analysis found that there were no BamH I and Xba I restriction sites in the lncRNA IFA sequence, whereas BamH I and Xba I restriction sites were present in the pcDNA3.1 vector (available from Invitrogen, cat. V79020) sequence. The full-length sequence primer of lncRNA IFA was designed by NCBI primer blast on-line tool, and BamHI and Xba I cleavage site sequences were added to its upstream and downstream primer sequences (lncRNA IFA F:5'-GGCGATGCCTGGGTACATGG-3' (SEQ ID NO. 12); lncRNA IFA R:5'-GAGACCGCGTCCACTCCGCC-3' (SEQ ID NO. 13)), respectively. Extracting RNA of a porcine ovary granular cell line, carrying out reverse transcription to obtain a cDNA library, amplifying a target fragment (the sequence of which is shown as SEQ ID NO. 1) by using the cDNA as a template, purifying and recovering, carrying out double enzyme digestion, connecting to a pcDNA3.1 vector, converting, screening, extracting an endotoxin-free plasmid after sequencing and identifying correctly (a small amount of endotoxin-free plasmid extraction kit is purchased from Magen company), and obtaining a recombinant vector named pcDNA3.1-lncRNA IFA.

The sequence of lncRNA IFA used in the present invention (SEQ ID No. 1):

GGCGATGCCTGGGTACATGGTGGTGCCACCCGACAGCACCGTGTTGGCGTAGAGGTCCTTGCGGATGTCGACGTCGCACTTCATGATGGAGTTGAAGGTAGTTTCGTGGATGCCGCAGGATTCCATGCCCAGGAAGGAGGGCTGGAAGAGCGCCTCGGGGCAGCGGAAGCGCTCGTTGCCGATGGTGATGACCTGGCCGTCGGGCAGCTCGTAGCTCTTCTCCAGGGAGGAGGAGGACGCGGCAGTGGCCATCTCCTGCTCGAAGTCCAGGGCGACGTAGCACAGCTTCTCCTTGATGTCCCGCACGATCTCCCGCTCGGCCGTGGTGGTGAAGCTGTAGCCCCGCTCCGTCAGGATCTTCATGAGGTAGTCGGTGTGGTGCCAGATCTTCTCCATGTCGTCCCAGTTGGTGACGATGCCGTGCTCGATGGGGTACTTGAGGGTCAGGATGCCTCTCTTGCTCTGGGCCTCGTCCCCCACGTAGGAGTCCTTCTGGCCCATGCCCACCATCACGCCCTGGTGTCGGGGGCGCCCCACGATGGAGGGGAAGACGGCCCGGGGAGCATCGTCGCCCGCAAAGCCGGCCTTGCACATGCCGGAGCCGTTGTCGACCACGAGCGCAGCAATATCGTCATCCATGGCGAACTGGTAGCGGTGTAGACCGGCGGCGAAGGCGGAGCGGCAAGGGCGAGGGGCCTGTGCTGGCGGAGTGGACGCGGTCTC。

example 2: prediction of lncRNA IFA protein coding Capacity and ORF

The protein coding capacity of lncRNA IFA was predicted online using CPC 2.0 bioinformatics website, and the open reading frames present in the lncRNA IFA sequence were predicted online using ORF finder tools through NCBI website.

CPC 2.0：http://cpc2.gao-lab.org/

NCBIORF finder：https://www.ncbi.nlm.nih.gov/orffinder/。

ORF sequence of lncRNA IFA used in the present invention:

ORF1(SEQ ID NO.2)：

ATGTCGACGTCGCACTTCATGATGGAGTTGAAGGTAGTTTCGTGGATGCCGCAGGATTCCATGCCCAGGAAGGAGGGCTGGAAGAGCGCCTCGGGGCAGCGGAAGCGCTCGTTGCCGATGGTGATGACCTGGCCGTCGGGCAGCTCGTAG

ORF2(SEQ ID NO.3)：

ATGTCGTCCCAGTTGGTGACGATGCCGTGCTCGATGGGGTACTTGAGGGTCAGGATGCCTCTCTTGCTCTGGGCCTCGTCCCCCACGTAG

ORF3(SEQ ID NO.4)：

ATGCCCACCATCACGCCCTGGTGTCGGGGGCGCCCCACGATGGAGGGGAAGACGGCCCGGGGAGCATCGTCGCCCGCAAAGCCGGCCTTGCACATGCCGGAGCCGTTGTCGACCACGAGCGCAGCAATATCGTCATCCATGGCGAACTGGTAG

example 3: constructing a vector for verifying the encoding capacity of the lncRNA IFA protein

Deleting an initiation codon (ATG) in an Enhanced Green Fluorescent Protein (EGFP) sequence, and naming the EGFP sequence after deleting the ATG as EGFP Mut; deletion of the stop codon (TAG) in the open reading frame sequence of the lncRNA IFA the resulting combined sequence was designated ORF+EGFP Mut (EGFP, EGFP Mut, ORF+EGFP Mut were synthesized by Guangzhou Kogyo Biotechnology Co., ltd.) before ligation of the open reading frame sequence after deletion of TAG to the EGFP Mut sequence.

The distribution of cleavage sites in EGFP, EGFP Mut, ORF+EGFP Mut sequences was analyzed using BioEdit software, and Nhe I and Hind III were selected as cleavage sites for constructing lncRNA IFA protein encoding verification vectors in combination with pcDNA3.1 vector maps.

The BioEdit software analysis found that the EGFP, EGFP Mut and ORF+EGFP Mut sequences were analyzed without cleavage sites for both Nhe I and Hind III restriction enzymes, whereas the pcDNA3.1 vector (available from Invitrogen, cat. No. V79020) had Nhe I and Hind III cleavage sites. Primers for amplifying EGFP, EGFP Mut and ORF+EGFP Mut sequences were designed using NCBI primer blast on-line tool, and Nhe I and Hind III cleavage site sequences were added upstream and downstream, respectively. The target fragment is amplified by PCR, and then endotoxin-free plasmids (a small amount of endotoxin-free plasmid extraction kit is purchased from Magen company) are extracted after the target fragment is purified and recovered, subjected to double enzyme digestion, connected with pcDNA3.1 vector, transformed, screened and sequenced and identified correctly, and the obtained plasmids are named pcDNA3.1-EGFP, pcDNA3.1-EGFP Mut and pcDNA3.1-ORF+EGFP Mut respectively.

Primer information for amplifying EGFP, EGFP Mut and ORF+EGFP Mut sequences are as follows:

EGFP-F：5’-GCTAGCATGGTGAGCAAGGGCGAGGA-3’(SEQ ID NO.5)；

EGFP-R：5’-AAGCTTTTACTTGTACAGCTCGTCCA-3’(SEQ ID NO.6)；

EGFP Mut-F：5’-GCTAGCGTGAGCAAGGGCGAGGAGCT-3’(SEQ ID NO.7)；

EGFP Mut-R：5’-AAGCTTTTACTTGTACAGCTCGTCCA-3’(SEQ ID NO.8)；

ORF+EGFP Mut-F：5’-GCTAGCATGTCGACGTCGCACTTCAT-3’(SEQ ID NO.9)；

ORF+EGFP Mut-R：5’-AAGCTTTTACTTGTACAGCTCGTCCA -3’(SEQ ID NO.10)。

example 4: culture of ovarian granulosa cells

(1) Collecting pig ovary tissue collected in slaughterhouse, placing in PBS or physiological saline containing 1% (w/w) double antibody, and rapidly taking back to laboratory on ice;

(2) The collected ovaries are quickly transferred into an ultra-clean workbench after being washed 3 times by PBS or normal saline (containing 1% (w/w) double antibody) in a sterile culture room, and a 1mL sterile disposable injector is used for shallow insertion into ovaries to absorb follicular fluid;

(3) Placing the sucked follicular fluid into a centrifuge tube containing a proper amount of DMEM culture medium, and centrifuging at 800rpm at room temperature for 5min;

(4) Discarding the supernatant, re-suspending with DMEM medium, centrifuging, and repeatedly cleaning the cells for 2 times; preparing a DMEM complete medium: 89% (w/w) high-sugar DMEM medium+10% (w/w) FBS+1% (w/w) diabody;

(5) Resuspension cells with complete medium, inoculating to 75mL flask; placed at 37 ℃ and 5% CO ₂ And (5) standing and culturing in an incubator.

The double antibodies are penicillin and streptomycin.

Example 5: inoculation and transfection of ovarian granulosa cells

(1) When the confluence of the porcine ovary granular cells reaches about 70-90%, the culture medium is discarded, and the cells are washed 3 times by preheated PBS;

(2) Adding 0.25% trypsin for digestion, placing in an incubator for about 3min, observing most cells floating under a microscope, immediately adding an equivalent stop solution (DMEM complete medium; for stopping digestion);

(3) Washing with PBS for 2 times, and centrifuging at 800rpm for 5min;

(4) Gently resuspending the cell pellet with complete medium, uniformly dividing into each well, supplementing volume with complete medium, gently shaking, and culturing in incubator;

(5) Observing the state of the porcine ovary granular cells for about 24 hours, and preparing for transfection when the cell confluence reaches about 70-90%;

(6) Transfection procedure was performed as per Invitrogen corporation

3000 kit instructions; setting 3 replicates for each group;

(7) Transfected cells were placed at 37℃with 5% CO ₂ Continuously culturing in an incubator;

(8) Cells were collected 2h4 or 48h after transfection depending on the experimental purpose.

Example 6: RNA extraction and reverse transcription

The total RNA extraction of the cells is described in the following steps according to the TRIzol operation instruction of Takara company:

(1) Grinding the porcine ovary tissue by liquid nitrogen, adding 1mL TRIzol according to the tissue amount of 50-100 mg, and repeatedly blowing for several times; total RNA was extracted from adherent porcine ovary granulosa cells at a rate of 10cm each ² Direct addition of cell culture plate bottom area1mL TRIzol was added;

(2) Standing on ice for 10min to fully lyse tissues/cells, centrifuging at 12000rpm for 5min, removing precipitate, and sucking supernatant into a new 1.5mL RNase-free tube;

(3) Adding 200 mu L chloroform (1 mL TRIzol) into the mixture, shaking the mixture vigorously for 15 to 30s, standing the mixture on ice for 15min, and centrifuging the mixture at a temperature of 12000rpm for 15min at a temperature of 4 ℃;

(4) The upper aqueous phase was aspirated and placed in a fresh 1.5mL RNase-freeEP tube;

(5) Adding 500uL isopropanol (1 mL TRIzol), mixing, standing on ice for 10min, and centrifuging at 12000rpm at 4deg.C for 10min;

(6) The supernatant was discarded and left at room temperature, 1mL of 75% ethanol-DEPC water was added along the tube wall to wash the RNA, and the supernatant was discarded after centrifugation at 12000rpm at 4℃for 5min;

(7) Vacuum drying for 5-10 min, taking care to avoid excessive drying of RNA precipitation;

(8) DEPC water was added to dissolve RNA precipitate.

mRNA reverse transcription was performed with reference to the PrimeScriptTM RT Master Mix (Perfect Real Time) cDNA reverse transcription kit from TaKaRa.

Example 7: ovarian granulosa cell proliferation assay

Proliferation of granulosa cells was detected by the EdU method, and the procedure was carried out with reference to the Cell-Light EdU Apollo 567In vitro Kit instruction (48 well Cell culture plate for example):

(1) Adding 150 mu L of EdU culture medium with the concentration of 50 mu M into a cell culture plate, placing the cell culture plate into a cell culture box for incubation for 2 hours, discarding the culture medium, and washing the cells for 2 times by PBS;

(2) 150. Mu.L/well of cell fixative (80% acetone in PBS) was added and incubated at room temperature for 30min, and the fixative was discarded. Cells were washed 2 times with PBS;

(3) Permeabilizing the cells with 150. Mu.L/well permeabilizer (PBS containing 0.5% Triton X) for 3min, and washing the cells 3 times with PBS;

(4) 1 XApollo staining reaction solution of 150. Mu.L/well was added, incubated at room temperature for 30min in the dark, and the staining reaction solution was discarded. Washing with PBS (phosphate buffer solution) decolorized shaker for 6 times, each time for 5min;

(5) Adding 150 mu L/hole DAPI staining solution, incubating for 30min at room temperature in dark place, discarding the staining reaction solution, and adding 150 mu L/hole PBS for cleaning for 3 times;

(6) After the completion of staining, a photograph was taken with a fluorescence microscope.

Example 8: ovarian granulosa cell apoptosis detection

The granulosa apoptosis detection is carried out by referring to the instruction book of an Annexin V-FITC/PI double-dyeing apoptosis detection kit:

(1) Placing the cell culture plate at room temperature, slightly washing cells in the culture plate with PBS, and discarding the PBS;

(2) Adding pancreatin to digest cells, placing into an incubator for about 3min, observing that most cells float under a microscope, immediately adding an equivalent amount of stopping solution (complete culture medium) to stop digestion;

(3) Centrifuging at 1000xg for 5min, collecting cells, discarding supernatant, and washing the cells twice with precooled PBS; the cell number of each tube is regulated to be 0.2 to 1.0x10 ⁶ 400. Mu.L of 1 Xbinding Buffer was added to resuspend cells;

(4) Sequentially adding 5 mu L of FITC-Annexin V into each tube of the sample, and carrying out light-shielding reaction at room temperature for 15min;

(5) Sequentially adding 10 mu L of PI, gently mixing, and performing light-shielding reaction at 4 ℃ for 5min;

(6) Immediately after completion of the reaction, the reaction was analyzed by flow cytometry.

Example 9: ovarian granulosa cell activity assay

Granulosa cell activity assays were performed with reference to the Biosharp company Cell Counting Kit-8 kit instructions (96 well cell culture plates for example):

(1) The medium in the cell culture plate was aspirated and the cells were rinsed with PBS, which was discarded

(2) Diluting the CCK8 solution with complete medium to a final concentration of 10%;

(3) Adding 100 mu L of 10% CCK8 solution into each hole, and placing the culture plate into an incubator for incubation for 1-4h;

(4) After incubation, the CCK8 solution was aspirated and absorbance at 450nm was measured using an microplate reader.

Example 10: ovarian granulosa cell cycle assay

Granulosa cell activity assays were performed with reference to the specification PI/RNase Staining Buffer by kemel:

(1) Placing the cell culture plate at room temperature, slightly washing cells in the culture plate with PBS, and discarding the PBS;

(2) Adding pancreatin to digest cells, placing in an incubator for about 3min, observing most cells under a microscope to float, immediately adding an equivalent amount of stop solution (complete culture medium) to stop digestion;

(3) Centrifuging at 1000xg for 5min, collecting cells, discarding supernatant, and washing the cells twice with precooled PBS;

(4) Adding 0.5 ml of PI/RNase Staining Buffer into each tube of cell sample, slowly and fully suspending cell sediment, and carrying out light-shielding warm bath at 37 ℃ for 30min;

(5) Immediately after completion of the reaction, the reaction was analyzed by flow cytometry.

Analysis of results

1. Protein coding capacity and open reading frame of lncRNA IFA were predicted on-line through CPC 2.0 and NCBI ORF finder bioinformatics website. The predicted results showed that lncRNA IFA did not have the ability to encode a protein, but that there were 3 open reading frames in its sequence (b and c in fig. 1).

2. Three plasmids, pcDNA3.1-EGFP Mut, pcDNA3.1-ORF+EGFP Mut, were transfected into ovarian granulosa cells, and after 24h, photographed using a fluorescence camera. The results showed that green fluorescence could be detected in the granulosa cells transfected with pcDNA3.1-EGFP plasmid, whereas the granulosa cells transfected with pcDNA3.1, pcDNA3.1-Mut EGFP and pcDNA3.1-ORF+mut EGFP plasmids could not (FIG. 2 b). The above experimental results demonstrate that the open reading frame in the lncRNA IFA sequence is not translatable within ovarian granulosa cells.

3. pcDNA3.1-lncRNA IFA and si-lncRNA IFA were transfected into ovarian granulosa cells, respectively, and granulosa cell activity was detected after 12h, 24h, 36h, 48h of transfection. The results showed that the granulosa cell activity of the transfected pcdna3.1-lncRNA IFA was significantly increased (P < 0.001) and the granulosa cell activity of the transfected si-lncRNA IFA was significantly decreased (P < 0.01) compared to the control group (b in fig. 4). The present study herein determines that lncRNA IFA has a promoting effect on ovarian granulosa cell activity.

Small interfering RNA fragment targeting sequence (si-LncRNA IFA): 5'-TGACCTGGGCGACGTAGCA-3' (SEQ ID NO. 11).

The small interfering RNA fragments are synthesized by Sharpo biotechnology limited company in Guangzhou city; control NC was from Sharp Biotechnology Inc. of Guangzhou, inc., as follows (NC is a common negative control product for this company).

4. pcDNA3.1-lncRNAIFA and si-lncRNAIFA were transfected into ovarian granulosa cells, respectively, cells were collected 48h after transfection, and changes in apoptosis rate and cell cycle progression of ovarian granulosa cells were detected by flow cytometry. The results showed that the granulosa apoptosis rate of pcdna3.1-lncRNA IFA transfected was significantly reduced (P < 0.001) and the S-phase cell rate was significantly increased (P < 0.05) compared to the control group; whereas the granulosa apoptosis rate of transfected si-lncRNA IFA was significantly increased (P < 0.001), the S-phase cell rate was significantly decreased (P < 0.01) (fig. 5, fig. 4 a). Indicating that lncRNA IFA can inhibit apoptosis of ovarian granulosa cells and accelerate cell cycle progression.

5. The proliferation rate of granulosa cells was examined 24h after transfection of pcdna3.1-lncRNA IFA and si-lncRNA IFA, respectively, in ovarian granulosa cells, and the results showed that the proliferation rate of granulosa cells transfected with pcdna3.1-lncRNA IFA was significantly increased (P < 0.001) and the proliferation rate of granulosa cells transfected with si-lncRNA IFA was significantly decreased (P < 0.05) compared to the control group (fig. 3). Indicating that lncRNA IFA can promote proliferation of ovarian granulosa cells.

The embodiments described above are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the embodiments described above, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principles of the present invention should be made in the equivalent manner, and are included in the scope of the present invention.

Claims (8)

1. A long non-coding RNA, characterized in that: named lncRNA IFA, the nucleotide sequence of which is as set forth in seq id NO: 1.

2. The long-chain non-coding RNA-associated biological material of claim 1, wherein: is any one or a combination of the following biological materials:

1) A DNA molecule encoding the long non-coding RNA;

2) An expression cassette comprising the DNA molecule of 1);

3) A recombinant vector comprising the DNA molecule described in 1), or a recombinant vector comprising the expression cassette described in 2);

4) A small interfering RNA fragment that inhibits expression of the long non-coding RNA;

5) A recombinant cell comprising the DNA molecule of 1), or a recombinant cell comprising the expression cassette of 2), or a recombinant cell comprising the recombinant vector of 3), or a recombinant cell comprising the small interfering RNA fragment of 4).

3. The long-chain non-coding RNA-associated biological material of claim 2, wherein:

1) The DNA molecule is prepared by the following steps: extracting RNA of porcine ovary granulosa cells, reversely transcribing the RNA into cDNA, and carrying out PCR amplification by taking the cDNA as a template to obtain a target fragment;

the primers used for PCR amplification are as follows:

lncRNA IFA F：5’-GGCGATGCCTGGGTACATGG-3’；

lncRNA IFA R：5’-GAGACCGCGTCCACTCCGCC-3’。

4. the long-chain non-coding RNA-associated biological material of claim 2, wherein:

3) The recombinant vector is prepared by the following steps: the DNA molecule was ligated to pcDNA3.1 vector digested with restriction enzymes BamHI and XbaI to give a recombinant vector.

5. The long-chain non-coding RNA-associated biological material of claim 2, wherein:

4) The targeting sequence of the small interfering RNA fragment is as follows: 5'-TGACCTGGGCGACGTAGCA-3'.

6. Use of the long non-coding RNA of claim 1 or the long non-coding RNA-associated biomaterial of any one of claims 2-5 in porcine ovarian granulosa cells, characterized in that: in an in vitro environment, the long-chain non-coding RNA positively regulates any one or more functional phenotypes of cell proliferation, cell apoptosis, cell activity and cell cycle progression.

7. The use according to claim 6, characterized in that:

increasing exogenous lncRNA IFA, promoting cell proliferation, inhibiting apoptosis, increasing cell activity, and/or accelerating cell cycle progression; inhibiting lncRNA IFA expression, inhibiting cell proliferation, promoting apoptosis, reducing cell activity, and/or blocking cell cycle progression.

8. Use of a long non-coding RNA as claimed in claim 1 or a DNA molecule or an expression cassette or a recombinant vector as claimed in any one of claims 2 to 4 for the preparation of a medicament, characterized in that: the medicine is any one or a combination of the following medicines:

i, a drug for promoting proliferation of porcine ovary granulosa cells;

II, a drug for inhibiting apoptosis of porcine ovary granular cells;

III, a drug for improving the activity of porcine ovary granular cells;

IV, accelerating the cell cycle process of the porcine ovary granular cells;

v. a medicine for promoting follicular development.

Images