CN110846315B - Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells - Google Patents

Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells Download PDF

Info

Publication number
CN110846315B
CN110846315B CN201911079405.8A CN201911079405A CN110846315B CN 110846315 B CN110846315 B CN 110846315B CN 201911079405 A CN201911079405 A CN 201911079405A CN 110846315 B CN110846315 B CN 110846315B
Authority
CN
China
Prior art keywords
endothelial cells
human umbilical
umbilical vein
vein endothelial
xloc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911079405.8A
Other languages
Chinese (zh)
Other versions
CN110846315A (en
Inventor
袁晓龙
王希龙
张豪
潘金春
李加琪
龚宝勇
张哲�
高洪彬
唐龙龙
谭伟江
李丽莹
梁十
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Guangdong Laboratory Animals Monitoring Institute
Original Assignee
South China Agricultural University
Guangdong Laboratory Animals Monitoring Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University, Guangdong Laboratory Animals Monitoring Institute filed Critical South China Agricultural University
Priority to CN201911079405.8A priority Critical patent/CN110846315B/en
Publication of CN110846315A publication Critical patent/CN110846315A/en
Application granted granted Critical
Publication of CN110846315B publication Critical patent/CN110846315B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/069—Vascular Endothelial cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/65—MicroRNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Vascular Medicine (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells. The invention detects the overexpression vector and silencing reagent lncRNA XLOC _102237Silencer which exogenously synthesize lncRNA XLOC _102237 by genetic engineering technology, detects the proliferation and apoptosis conditions of human umbilical vein endothelial cells after overexpression/silencing lncRNA XLOC _102237, and the result shows that lncRNA XLOC _102237 can participate in inhibiting the proliferation of human umbilical vein endothelial cells, promoting the apoptosis of human umbilical vein endothelial cells and inhibiting the formation of endothelial cell external tubules, further shows that lncRNA XLOC _102237 can inhibit angiogenesis by inhibiting the proliferation of human umbilical vein endothelial cells.

Description

Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells
Technical Field
The invention belongs to the technical field of cell engineering and genetic engineering, and particularly relates to long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells.
Background
Angiogenesis (Angiogenesis) refers to the development of new blood vessels from existing capillaries or postcapillary veins, and mainly comprises: the degradation of blood vessel basement membrane during activation, the activation, proliferation and migration of blood vessel endothelial cells and the reconstruction of new blood vessels and blood vessel networks are complex processes involving various molecules of various cells, which depend on the delicate regulation of gene expression and also require various factors to participate together. Angiogenesis is a complex process of the coordination of a pro-angiogenic factor and an inhibitory factor, and normally, the two are in equilibrium, and once the equilibrium is broken, the vascular system is activated, so that the angiogenesis is excessive or the vascular system is inhibited to degenerate the blood vessel.
Human Umbilical Vein Endothelial Cells (HUVECs) are specialized epithelial Cells consisting of a layer of flattened Cells that form the inner wall of a blood vessel. Endothelial cells have a variety of biological functions including angiogenesis, arteriosclerosis, control of vasoconstriction and dilation, and the like. The endothelial cells have the potential of stem cells, can be transmitted for 50-60 generations theoretically, and have very important relation with angiogenesis, namely the self-proliferation capacity of the endothelial cells can directly influence the angiogenesis, so the endothelial cells are ideal cells for researching the formation of blood vessels.
Long non-coding RNA (lncRNA) is a type of non-coding RNA with a length of more than 200 nt. Research shows that lncRNA is widely involved in biological processes, can be involved in gene expression regulation from an apparent modification level, a transcription level and a post-transcription level, and further plays an important role in the processes of proliferation, differentiation, survival and transfer of cells. However, no report about the regulation of the expression change of lncRNA XLOC _102237 on the function of human umbilical vein endothelial cells is available at home and abroad at present.
Disclosure of Invention
The primary objective of the present invention is to overcome the disadvantages and drawbacks of the prior art and to provide a long non-coding RNA XLOC _ 102237.
Another object of the invention is to provide a silencing agent that inhibits the function of lncRNA XLOC _ 102237.
Still another objective of the invention is to provide the application of the long-chain non-coding RNA XLOC _102237 or the silencing agent for inhibiting the function of lncRNA XLOC _102237 in human umbilical vein endothelial cells. The expression level of lncRNA XLOC _102237 in human umbilical vein endothelial cells is changed by a genetic engineering technology, and the application of the lncRNA XLOC _102237 in regulating and controlling the proliferation, apoptosis and angiogenesis of the human umbilical vein endothelial cells is determined.
The purpose of the invention is realized by the following technical scheme:
a long non-coding RNA XLOC _102237(lncRNA XLOC _102237) having a nucleotide sequence set forth in SEQ ID NO: 1 is shown.
A silencing agent for inhibiting the function of the long non-coding RNA XLOC _102237 is lncRNA XLOC _102237Silencer, and the nucleotide sequence of the silencing agent is shown as follows (SEQ ID NO: 2):
TAATCTCATCCTAGGAATTTGCCATCAAAGTTCAAAGTCTAGGTCATAAGGATGAAAAGGAATTACGTGCATGCACACTTATTCTCCGTGAAGCTCATCCCTTTCAGGATGGATTTA。
a recombinant expression vector comprising said long non-coding RNA XLOC _ 102237.
A recombinant cell, wherein the recombinant expression vector or the silencing agent for inhibiting the function of the long-chain non-coding RNA XLOC _102237 is transfected into a human umbilical vein endothelial cell.
The application of the long-chain non-coding RNA XLOC _102237 or the silencing agent for inhibiting the function of the long-chain non-coding RNA XLOC _102237 in human umbilical vein endothelial cells is in an in vitro environment.
The lncRNA XLOC _102237 inhibits the proliferation of human umbilical vein endothelial cells, promotes the apoptosis of the human umbilical vein endothelial cells, and inhibits the human umbilical vein endothelial cells from forming external tubules, and the lncRNA XLOC _102237 participates in the angiogenesis process by regulating the functions of the human umbilical vein endothelial cells.
The inhibition of the proliferation of human umbilical vein endothelial cells, the promotion of the apoptosis of the human umbilical vein endothelial cells and the inhibition of the formation of external tubules of the human umbilical vein endothelial cells are realized by adding exogenous long-chain non-coding RNA XLOC _ 102237.
The addition of exogenous long-chain non-coding RNA XLOC _102237 is realized by the following steps: the long-chain non-coding RNA XLOC _102237 is connected to pcDNA3.1(-) vector to construct a super-expression vector of the long-chain non-coding RNA XLOC _102237, and then the super-expression vector is transfected into human umbilical vein endothelial cells.
The overexpression vector of the long-chain non-coding RNA XLOC _102237 is preferably constructed by the following method: carrying out PCR amplification by taking human umbilical vein endothelial cell cDNA as a template and taking lncRNA-F and lncRNA-R as primers to obtain lncRNA XLOC _ 102237; then XbaI and XhoI enzyme are used for double enzyme digestion, and the mixture is recycled and connected to a pcDNA3.1(-) vector to obtain a super expression vector of the long-chain non-coding RNA XLOC _ 102237; wherein the nucleotide sequences of lncRNA-F and lncRNA-R are shown as follows:
lncRNA-F：CTAGTCTAGACTAGCGGTTTGCAATTAGGAGATGTTAG；
lncRNA-R：CCGCTCGAGCGGCTCATTTATCTTCACTGGAGGTAAG。
the silencing reagent for inhibiting the function of the long-chain non-coding RNA XLOC _102237 promotes the proliferation of human umbilical vein endothelial cells, inhibits the apoptosis of the human umbilical vein endothelial cells and promotes the human umbilical vein endothelial cells to form in-vitro tubules.
The promotion of the proliferation of the human umbilical vein endothelial cells, the inhibition of the apoptosis of the human umbilical vein endothelial cells and the promotion of the formation of the external tubules of the human umbilical vein endothelial cells are realized by transferring exogenous lncRNA XLOC _102237Silencer, namely, lncRNA XLOC _102237Silencer is directly transfected into the human umbilical vein endothelial cells.
The long-chain non-coding RNA XLOC _102237 is applied to the preparation of medicines for inhibiting the proliferation of human umbilical vein endothelial cells, promoting the apoptosis of the human umbilical vein endothelial cells and/or inhibiting the formation of external tubules of the human umbilical vein endothelial cells.
The medicine contains a sequence of long-chain non-coding RNA XLOC _102237 and/or contains a recombinant expression vector.
The recombinant expression vector contains a sequence of long-chain non-coding RNA XLOC _102237, and can express long-chain non-coding RNA XLOC _102237 in human umbilical vein endothelial cells; preferably, the construction is carried out by the following method: carrying out PCR amplification by taking human umbilical vein endothelial cell cDNA as a template and taking lncRNA-F and lncRNA-R as primers to obtain lncRNA XLOC _ 102237; then XbaI and XhoI enzymes are used for double enzyme digestion, and the product is recovered and connected to a pcDNA3.1(-) vector to obtain a recombinant expression vector; wherein the nucleotide sequences of lncRNA-F and lncRNA-R are shown as follows:
lncRNA-F：CTAGTCTAGACTAGCGGTTTGCAATTAGGAGATGTTAG；
lncRNA-R：CCGCTCGAGCGGCTCATTTATCTTCACTGGAGGTAAG。
the silencing reagent for inhibiting the function of the long-chain non-coding RNA XLOC _102237 is applied to the preparation of medicaments for promoting the proliferation of human umbilical vein endothelial cells, inhibiting the apoptosis of the human umbilical vein endothelial cells and/or promoting the human umbilical vein endothelial cells to form in-vitro tubules.
The medicine contains a sequence of lncRNA XLOC _102237Silencer, and can inhibit the expression of long-chain non-coding RNA XLOC _102237 in human umbilical vein endothelial cells.
The verification results of the invention are as follows:
1. according to the invention, the proliferation condition of the human umbilical vein endothelial cells is detected by an EdU method, and the proliferation rate of the human umbilical vein endothelial cells is remarkably reduced (P <0.01) compared with a control group (pcDNA3.1) after the lncRNA XLOC _102237 is over-expressed (figure 1). After silencing lncRNA XLOC _102237, the proliferation rate of human umbilical vein endothelial cells was very significantly increased (P <0.01) compared to the control (NC) (fig. 2).
2. The apoptosis condition of the human umbilical vein endothelial cells is detected by an Annexin V-FITC/PI technology, and the apoptosis rate of the human umbilical vein endothelial cells is remarkably increased (P is less than 0.01) compared with a control group (pcDNA3.1) after the lncRNA XLOC _102237 is over-expressed (figure 3). After silencing lncRNA XLOC _102237, the proliferation rate of human umbilical vein endothelial cells was significantly decreased (P <0.05) compared to the control group (NC) (fig. 4).
3. In the invention, Matrigel is used as a carrier to simulate in vitro tubule formation, and the tube formation number of human umbilical vein endothelial cells is remarkably reduced (P <0.01) compared with that of a control group (Blank) after the lncRNA XLOC _102237 is over-expressed (FIG. 5). After silencing lncRNA XLOC _102237, the tube formation number of human umbilical vein endothelial cells was very significantly increased (P <0.01) compared to the Blank control (Blank) (fig. 6).
The invention takes lncRNA XLOC _102237(SEQ ID NO: 1) as a research object, adopts a molecular cell biology method to research the application of the lncRNA XLOC _102237 in human umbilical vein endothelial cells, and proves the effect of lncRNA XLOC _102237 on the human umbilical vein endothelial cells for the first time. The lncRNA XLOC _102237 is proved to be capable of participating in inhibiting the proliferation of human umbilical vein endothelial cells, promoting the apoptosis of the human umbilical vein endothelial cells and inhibiting the formation of endothelial cell in vitro tubules by over-expressing and silencing lncRNA XLOC _102237, and further shows that lncRNA XLOC _102237 can inhibit angiogenesis by inhibiting the proliferation of the human umbilical vein endothelial cells.
Compared with the prior art, the invention has the following advantages and effects:
the invention detects the overexpression vector and the silencing reagent which are exogenously synthesized into lncRNA XLOC _102237 by the genetic engineering technology, detects the proliferation and apoptosis conditions of human umbilical vein endothelial cells after overexpression/silencing of lncRNA XLOC _102237, and is a molecular mechanism accumulation material for lncRNA to regulate and control the human umbilical vein endothelial cells. Meanwhile, the results of the invention show that lncRNA XLOC _102237 inhibits the formation of endothelial cells in vitro tubules, and further indicate that lncRNA XLOC _102237 can inhibit the neogenesis of blood vessels by inhibiting the proliferation of endothelial cells of human umbilical veins.
Drawings
FIG. 1 is a graph showing the result of EdU method detecting the regulation of human umbilical vein endothelial cell proliferation after overexpression of lncRNA XLOC _ 102237.
FIG. 2 is a graph showing the result of EdU method detecting the regulation of human umbilical vein endothelial cell proliferation after silencing lncRNA XLOC _ 102237.
FIG. 3 is a graph showing the results of the Annexin V-FITC method for detecting the apoptosis of human umbilical vein endothelial cells after overexpression of lncRNA XLOC _ 102237.
FIG. 4 is a graph showing the results of the Annexin V-FITC method for detecting the regulation of human umbilical vein endothelial cell apoptosis after the silencing of IncRNA XLOC _ 102237.
FIG. 5 is a graph of matrigel vascularization assay results of human umbilical vein endothelial cell vascularization after overexpression of lncRNA XLOC _ 102237.
FIG. 6 is a graph of matrigel vascularization assay results of in vitro vascularization of human umbilical vein endothelial cells following silencing of lncRNA XLOC _ 102237.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto. It should be understood that the embodiments described in this specification are only for the purpose of illustrating the invention and are not to be construed as limiting the invention, and the parameters, proportions and the like of the embodiments may be suitably selected without materially affecting the results. The examples are all reagents and process steps conventional in the art, except where specifically indicated.
The base sequence related by the invention is shown as SEQ ID NO: the long-chain non-coding RNA shown in 1 is an lncRNA which is discovered for the first time by constructing a heart stalk model of a miniature pig, performing high-throughput sequencing on RAN and analyzing biological information, wherein a human genome also contains the long-chain non-coding RNA, the full-length sequence is 1018bp, and the long-chain non-coding RNA is named as lncRNA XLOC _102237, and the sequence is shown as follows:
lncRNA XLOC_102237(SEQ ID NO：1)：
GGGAACUCCAAAACUUUCUAUUCUUAUGUUUUAAGAAAGAUCACACGGUUUGCAAUUAGGAGAUGUUAGUUUAAUUUCUUUUCUACCCCUGGUCACUGUGAUAGUGGAGAGAUCACUAACCAAUAACUCUAGGACCCAUCUGCUAAAUAAGGAUAAUCUCAUCCUAGGAAUUACGUGCAUGCACACAGAGGUACCUUGAGUAUUUGGGAAGGAUGGUGCCAUCAAAGUUCAAAGUAUAUUGAUUAUAAUUUGCUUUCUUAUUCUCCGUGAAGCUCAGAGCCUAUUAUAGGCAUUUUAUACACAGUUUCCCUCUCUUGUGUGGUUGGCAAGUCUGGCCAUAAAGCAUCUGGAGGAAAAACCCAGAGAUGCUGAGGGCCGUGAGUCUCAGUUCCACCUCUUUUUACUCCUUAGCUUCUUCAAGAGUCAGUUGCGUUUUGGCAUUCCCAUUGUGGCACAGUGGAAACGAAUCUGACUAGGAACCAUGAGGUUUCAGGUUCGAUCCCUGAUCUUGCUUGGUAGGUUAAGGAUCCUGCAUUGCCAUGCUCUAUGAUGUAGGUCUCAGAUGUGGCUUGGAUCCAGCAUUGCUGUGGCUGUGGUGUAGACCAGCGAGCGCUACAGCUCCAAUUCGACUCCUAGCCAGGGAACCUCCAUGUGCUGCGGGUACAGUCCUUAAAAAAAAAAAAAAAAAAAAAAAAGAGUCAGUUGUGCUUCUUUGGUACGGGGGAGGAGUGCCAUUCUAAUUAGAAGAAAAUGAUGUCCUUUGGAAAAUUACCUACAUGCUAAACAGCAGUAAUGAGGAACCCUGUUCCAGCCUCCCUUUCAGGAUGGAUUUAUUGGUUUGAGGCCUUCCUAGGUCAUAAGGAUGAAAAGGCCGCUCAGGAACAGCACAGGUGAUUUAGCUUAAGUUGGUGCCCAGGAACUUAGAGGCUGCUCUCUGUCUUACCUCCAGUGAAGAUAAAUGAGGUAAAGGAGUAGACAUAUUGAAUUCUGAAAUAGAAAAAGGAAGAGGAGUACAGGG。
EXAMPLE 1 cellular RNA extraction and reverse transcription
RNA extraction of human umbilical vein endothelial cells (purchased from ScienCell) the following procedure was followed according to the instructions of TRIzol of Takara:
(1) culturing human umbilical vein endothelial cells to proper density, discarding culture medium, washing cells twice with PBS, and washing every 10cm21mL of TRIzol is directly added into the bottom area of the cell culture plate;
(2) standing on ice for 10min to fully lyse the tissue/cells, centrifuging at 4 ℃ and 12000rpm for 5min, discarding the precipitate, and taking the supernatant into a new 1.5mL RNase-free tube;
(3) adding 200 mu L chloroform (1 mL of TRIzol) and shaking vigorously for 15-30 s, standing on ice for 15min, and centrifuging at 12000rpm at 4 ℃ for 15 min;
(4) absorbing the upper aqueous phase and placing the upper aqueous phase in a new 1.5mL RNase-free EP tube;
(5) adding 0.5mL of isopropanol (every 1mL of TRIzol), gently inverting and mixing, standing on ice for 10min, and centrifuging at 12000rpm at 4 ℃ for 10 min;
(6) discarding the supernatant, placing at room temperature, adding 1mL of 75% (v/v) ethanol-DEPC (per 1mL of TRIzol) along the tube wall to wash RNA, centrifuging at 12000rpm at 4 ℃ for 5min, and discarding the supernatant;
(7) vacuum drying for 5-10 min, and taking care to avoid excessive drying of RNA precipitate;
(8) DEPC water was added to dissolve the RNA pellet.
First Strand cDNA Synthesis was performed with reference to SuperScriptTM First-Strand Synthesis System for RT-PCR kit from Thermo.
Example 2 construction of a overexpression vector of lncRNAXLOC _102237
(1) The sequence of lncRNA XLOC _102237 was found to be free of both XbaI and XhoI restriction sites by analysis using DNMAN software, whereas XbaI and XhoI restriction sites were present in pcDNA3.1(-) vector (available from Invitrogen).
(2) Primer5.0 software designed lncRNA XLOC _102237 primers with XbaI and XhoI cleavage site sequences added to its upstream and downstream primers, respectively. Wherein the primer sequence is as follows (5 '-3'):
lncRNA-F：CTAGTCTAGACTAGCGGTTTGCAATTAGGAGATGTTAG；
lncRNA-R：CCGCTCGAGCGGCTCATTTATCTTCACTGGAGGTAAG。
(3) using human umbilical vein endothelial cell cDNA (obtained by the method of example 1) as a template, the cDNA with the full length of lncRNA XLOC _102237 obtained by PCR amplification is subjected to gel recovery and purification, double digestion, recovery, connection with pcDNA3.1(-) vector, transformation, screening, sequencing and identification, and then endotoxin-free plasmid (the endotoxin-free plasmid miniprep kit is purchased from Magen) is extracted and named pcDNA3.1-lncRNA XLOC _ 102237.
EXAMPLE 3 culture of human umbilical vein endothelial cells
(1) Placing a cryopreserved tube filled with human umbilical vein endothelial cells (purchased from ScienCell) taken out of a liquid nitrogen tank in a 37 ℃ water bath to rapidly melt the cryopreserved tube;
(2) transferring the cells into a centrifuge tube, centrifuging at room temperature at 1000rpm for 5min, and pouring off the supernatant;
(3) adding preheated PBS for cleaning, centrifuging and pouring out the PBS;
(4) preparing an ECM complete medium: 93% w/w) endothelial cell culture medium ECM (purchased from ScienCell corporation) + 5% (w/w) FBS (fetal bovine serum) + 1% (w/w) endothelial cell growth supplement ECGS (purchased from ScienCell corporation) + 1% (w/w) diabody;
(5) adding ECM to suspend the cells in a full culture medium, and inoculating the cells into a culture flask; the mixture was cultured by standing in a 5% CO2 incubator at 37 ℃.
The double-resistant is penicillin and streptomycin.
Example 4 seeding and transfection of human umbilical vein endothelial cells
(1) When the density of human umbilical vein endothelial cells reaches about 90%, pouring out the culture medium, and washing the cells for 2 times by using preheated PBS;
(2) adding 0.25% trypsin for digestion for 5min, observing most cells floating under a microscope, and immediately adding an equal amount of ECM complete culture medium (the configuration method is the same as the step (4) of the example 2) to terminate digestion;
(3) blowing down the parietal cells by using a gun head, uniformly blowing, transferring the cell suspension into a centrifuge tube, centrifuging at 1000rpm for 5min, and pouring out the supernatant;
(4) adding PBS to clean for 2 times, centrifuging at 1000rpm for 5 min;
(5) gently resuspending the cell pellet with ECM complete medium, uniformly distributing into each well, supplementing volume with ECM complete medium, gently shaking, and culturing in an incubator;
(6) observing the cell state after about 24 hours, and preparing for transfection when the confluence degree of the cells reaches about 75-90%;
(7) transfection method Invitrogen
Figure GDA0002963274330000071
3000 kit instructions; each set was set to 3 replicates;
(8) the transfected cells were placed at 37 ℃ in 5% CO2Continuously culturing in an incubator;
(9) and after 24-48 h of transfection, observing the cell state, and collecting the cells after good growth.
Example 5 human umbilical vein endothelial cell proliferation assay
The experiment for detecting Cell proliferation by the EdU method in the invention refers to Cell-Light of Ruibo Biotech Co., Ltd, Guangzhou CityTMEdU Apollo 567 In vitro Kit. The method comprises the following specific steps (taking a 48-hole plate as an example):
(1) diluting the EdU solution with endothelial cell culture medium ECM (ECM complete medium, prepared in the same manner as in step (4) of example 2) at a volume ratio of 1000:1 to prepare an appropriate amount of 50. mu.M EdU medium;
(2) adding 200 mu L of 50 mu M EdU culture medium into each hole, incubating for 2h, and removing the culture medium;
(3) washing cells with 200 μ L PBS per well for 5min for 2 times by decolorizing and shaking table;
(4) adding 100 μ L of cell fixing solution (PBS containing 4% paraformaldehyde) into each well, incubating at room temperature for 30min, and discarding the waste solution;
(5) adding 100 mu L of glycine with the concentration of 2mg/mL into each hole, and removing the glycine solution after incubating for 5min by a decoloring shaker;
(6) adding 200 μ L PBS into each well, washing for 5min by a decoloring shaker, and discarding the PBS;
(7) incubating 200 μ L of penetrant (0.5% (v/v) Triton X in PBS) per well in a decolorization shaker for 10min, and washing with PBS for 5 min;
(8) adding 200 mu L of 1 XApollo staining reaction solution into each hole, incubating for 30min at room temperature in a dark place, and removing the staining reaction solution;
(9) adding 200 μ L of penetrant (0.5% (v/v) Triton X PBS) into each well, washing for 10min for 2 times by decolorizing shaker, and discarding penetrant;
(10) diluting the reagent F by deionized water according to the volume ratio of 100:1, preparing a proper amount of 1 × Hoechst3342 reaction solution, and storing in the dark;
(11) adding 200 μ L of 1 × Hoechst3342 reaction solution (Hoechst) into each well, incubating at room temperature in dark for 30min, and removing the staining reaction solution;
(12) washing 2 times by adding 200 μ L PBS per well;
(13) adding 200 mu L PBS into each hole for storage;
(14) after the staining was completed, a photograph was taken with a fluorescence microscope.
Example 6 human umbilical vein endothelial cell apoptosis assay
The invention uses Annexin V-FITC/PI technology to detect Apoptosis, and the specific operation steps are as follows according to the specification of FITC Annexin V Apoptosis Detection Kit with PI Kit of Guangzhou Korea Biotechnology Limited company:
(1) placing the cell culture plate at room temperature, slightly rinsing cells in the culture plate by using PBS, and removing the PBS;
(2) adding 0.25% trypsin for digestion for 5min, observing most cells under a microscope, immediately adding an equivalent amount of stop solution (ECM complete culture medium; the preparation method is the same as the step (4) of the example 2) to stop digestion;
(3) cells were collected by centrifugation at 1000rpm for 5min, the supernatant was discarded, and the cells were washed twice with pre-cooled PBS. Adjusting the number of cells per tube to be (0.2-1.0) × 106500 μ L of 1 × Annexin V Buffer was added to gently resuspend the cells;
(4) adding 5 μ L Annexin V-FITC and 5 μ L propidium iodide staining solution, and mixing gently;
(5) after incubation for 15min at room temperature in the dark, flow cytometry analysis was carried out immediately.
Example 7 tubule formation experiment
(1) Placing the Matrigel in a refrigerator at 4 ℃ for overnight melting, and placing a 48-hole plate and a gun head in the refrigerator at 4 ℃ for precooling overnight;
(2) adding 100 mu of LMatrigel matrigel to a 48-well plate, ensuring that the gel completely covers the bottom of the well, avoiding bubbles generated in the adding process, and operating on ice;
(3) incubating at 37 ℃ for 1 h;
(4) digesting human umbilical vein endothelial cells to ensure that each hole has 2 to 3 ten thousand cells;
(5) incubating for 2-8 h at 37 ℃, observing at any time, finishing photographing within 10h, and calculating the number of complete lumens.
Analysis of results
1. And (4) recovering the frozen human umbilical vein endothelial cells and carrying out subculture. The invention exogenously synthesizes lncRNA XLOC _102237 overexpression vector (pcDNA3.1-lncRNA XLOC _102237) and silencing reagent (lncRNA XLOC _102237Silencer) by gene engineering technology, transfects the overexpression vector to human umbilical vein endothelial cells, and detects the proliferation condition of the human umbilical vein endothelial cells by referring to an EdU kit instruction after 24 hours. As a result of detection, the proliferation rate of human umbilical vein endothelial cells is extremely remarkably reduced (P <0.01) compared with that of a control group (pcDNA3.1(-)) after the lncRNA XLOC _102237 is over-expressed (FIG. 1), and the proliferation rate of human umbilical vein endothelial cells is extremely remarkably increased (P <0.01) compared with that of the control group (NC) after the lncRNA XLOC _102237 is silenced (FIG. 2).
The silencing reagent lncRNA XLOC _102237Silencer was synthesized by Ribo Biotech, Inc., Guangzhou, with the following sequence (SEQ ID NO: 2) (the same applies below):
TAATCTCATCCTAGGAATTTGCCATCAAAGTTCAAAGTCTAGGTCATAAGGATGAAAAGGAATTACGTGCATGCACACTTATTCTCCGTGAAGCTCATCCCTTTCAGGATGGATTTA。
2. and (4) recovering the frozen human umbilical vein endothelial cells and carrying out subculture. The invention exogenously synthesizes lncRNA XLOC _102237 overexpression vector (pcDNA3.1-lncRNA XLOC _102237) and silencing reagent (lncRNA XLOC _102237Silencer) by gene engineering technology, transfects the overexpression vector and the silencing reagent to human umbilical vein endothelial cells, and detects the Apoptosis condition of the human umbilical vein endothelial cells after 48 hours by referring to FITC Annexin V Apoptosis Detection Kit with PI specification. The test results show that after the lncRNA XLOC _102237 is over-expressed, the apoptosis rate of the human umbilical vein endothelial cells is greatly increased (P <0.01) compared with that of a control group (pcDNA3.1 (-)))) (FIG. 3), and after the lncRNA XLOC _102237 is silenced, the proliferation rate of the human umbilical vein endothelial cells is significantly reduced (P <0.05) compared with that of a control group (NC) (synthesized by Ruibo Biotechnology, Inc., Guangzhou) (FIG. 4).
3. And (4) recovering the frozen human umbilical vein endothelial cells and carrying out subculture. The invention exogenously synthesizes lncRNA XLOC _102237 overexpression vector (pcDNA3.1-lncRNA XLOC _102237) and silencing reagent (lncRNA XLOC _102237Silencer) by gene engineering technology, and transfects the overexpression vector and the silencing reagent to human umbilical vein endothelial cells. The tube formation of human umbilical vein endothelial cells was tested by simulating in vitro tubule formation with Matrigel as a carrier, and it was found that the tube formation of human umbilical vein endothelial cells was significantly reduced (P <0.01) compared to the Blank control (Blank) after overexpression of lncRNA XLOC _102237 (FIG. 5). After silencing lncRNA XLOC _102237, the tube formation number of human umbilical vein endothelial cells was very significantly increased (P <0.01) compared to the Blank control (Blank) (fig. 6).
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
Guangdong province laboratory animal monitoring station
<120> long non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1018
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> lncRNA XLOC_102237
<400> 1
gggaacucca aaacuuucua uucuuauguu uuaagaaaga ucacacgguu ugcaauuagg 60
agauguuagu uuaauuucuu uucuaccccu ggucacugug auaguggaga gaucacuaac 120
caauaacucu aggacccauc ugcuaaauaa ggauaaucuc auccuaggaa uuacgugcau 180
gcacacagag guaccuugag uauuugggaa ggauggugcc aucaaaguuc aaaguauauu 240
gauuauaauu ugcuuucuua uucuccguga agcucagagc cuauuauagg cauuuuauac 300
acaguuuccc ucucuugugu gguuggcaag ucuggccaua aagcaucugg aggaaaaacc 360
cagagaugcu gagggccgug agucucaguu ccaccucuuu uuacuccuua gcuucuucaa 420
gagucaguug cguuuuggca uucccauugu ggcacagugg aaacgaaucu gacuaggaac 480
caugagguuu cagguucgau cccugaucuu gcuugguagg uuaaggaucc ugcauugcca 540
ugcucuauga uguaggucuc agauguggcu uggauccagc auugcugugg cuguggugua 600
gaccagcgag cgcuacagcu ccaauucgac uccuagccag ggaaccucca ugugcugcgg 660
guacaguccu uaaaaaaaaa aaaaaaaaaa aaaaagaguc aguugugcuu cuuugguacg 720
ggggaggagu gccauucuaa uuagaagaaa augauguccu uuggaaaauu accuacaugc 780
uaaacagcag uaaugaggaa cccuguucca gccucccuuu caggauggau uuauugguuu 840
gaggccuucc uaggucauaa ggaugaaaag gccgcucagg aacagcacag gugauuuagc 900
uuaaguuggu gcccaggaac uuagaggcug cucucugucu uaccuccagu gaagauaaau 960
gagguaaagg aguagacaua uugaauucug aaauagaaaa aggaagagga guacaggg 1018
<210> 2
<211> 117
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> lncRNA XLOC_102237 Silencer
<400> 2
taatctcatc ctaggaattt gccatcaaag ttcaaagtct aggtcataag gatgaaaagg 60
aattacgtgc atgcacactt attctccgtg aagctcatcc ctttcaggat ggattta 117
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> lncRNA-F
<400> 3
ctagtctaga ctagcggttt gcaattagga gatgttag 38
<210> 4
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> lncRNA-R
<400> 4
ccgctcgagc ggctcattta tcttcactgg aggtaag 37

Claims (10)

1. A long non-coding RNA XLOC _102237, characterized by: the nucleotide sequence is shown as SEQ ID NO: 1 is shown.
2. A silencing agent that inhibits the function of long non-coding RNA XLOC _102237 of claim 1, wherein: the silencing reagent is lncRNA XLOC _102237Silencer, and the nucleotide sequence of the silencing reagent is shown in SEQ ID NO: 2, respectively.
3. A recombinant expression vector comprising the cDNA sequence of long non-coding RNA XLOC _102237 of claim 1.
4. A recombinant cell, wherein: to transfect the recombinant expression vector of claim 3 or the silencing agent of claim 2 into human umbilical vein endothelial cells.
5. The use of the long non-coding RNA XLOC _102237 of claim 1 or the silencing agent of claim 2 that inhibits the function of long non-coding RNA XLOC _102237 in human umbilical vein endothelial cells, wherein:
the environment of the application is an in vitro environment;
the long-chain non-coding RNA XLOC _102237 inhibits the proliferation of human umbilical vein endothelial cells, promotes the apoptosis of the human umbilical vein endothelial cells and inhibits the human umbilical vein endothelial cells from forming external tubules;
the silencing reagent for inhibiting the function of the long-chain non-coding RNA XLOC _102237 promotes the proliferation of human umbilical vein endothelial cells, inhibits the apoptosis of the human umbilical vein endothelial cells and promotes the human umbilical vein endothelial cells to form in-vitro tubules.
6. Use according to claim 5, characterized in that:
the inhibition of the proliferation of human umbilical vein endothelial cells, the promotion of the apoptosis of the human umbilical vein endothelial cells and the inhibition of the formation of external tubules of the human umbilical vein endothelial cells are realized by adding exogenous long-chain non-coding RNA XLOC _ 102237;
the promotion of the proliferation of the human umbilical vein endothelial cells, the inhibition of the apoptosis of the human umbilical vein endothelial cells and the promotion of the human umbilical vein endothelial cells to form in vitro tubules is realized by transferring exogenous lncRNA XLOC-102237 Silenecer.
7. The use of the long non-coding RNA XLOC _102237 of claim 1 in the manufacture of a medicament for inhibiting proliferation of human umbilical vein endothelial cells, promoting apoptosis of human umbilical vein endothelial cells, and/or inhibiting formation of tubules in vitro by human umbilical vein endothelial cells.
8. Use according to claim 7, characterized in that:
the medicine contains a sequence of long-chain non-coding RNA XLOC _102237 and/or contains a recombinant expression vector;
the recombinant expression vector contains a cDNA sequence of long-chain non-coding RNA XLOC _ 102237.
9. The use of the silencing agent of claim 2 for inhibiting the function of long-chain non-coding RNA XLOC _102237 in the preparation of a medicament for promoting proliferation of human umbilical vein endothelial cells, inhibiting apoptosis of human umbilical vein endothelial cells, and/or promoting formation of small tubes in vitro by human umbilical vein endothelial cells.
10. Use according to claim 9, characterized in that:
the medicine contains the sequence of lncRNA XLOC-102237 Silencer.
CN201911079405.8A 2019-11-07 2019-11-07 Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells Active CN110846315B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911079405.8A CN110846315B (en) 2019-11-07 2019-11-07 Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911079405.8A CN110846315B (en) 2019-11-07 2019-11-07 Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells

Publications (2)

Publication Number Publication Date
CN110846315A CN110846315A (en) 2020-02-28
CN110846315B true CN110846315B (en) 2021-07-02

Family

ID=69599666

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911079405.8A Active CN110846315B (en) 2019-11-07 2019-11-07 Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells

Country Status (1)

Country Link
CN (1) CN110846315B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110384800B (en) * 2019-07-19 2021-06-08 广东省实验动物监测所 Application of LncRNA XLOC _075168 in preparation of medicine for promoting angiogenesis
CN114958849B (en) * 2022-05-26 2023-10-27 华南农业大学 Application of lncRNACACF to miR-520b-3p adsorption in regulation of human umbilical vein endothelial cell cycle

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110384800A (en) * 2019-07-19 2019-10-29 广东省实验动物监测所 Application of the LncRNA XLOC_075168 in the drug that preparation promotes angiogenesis
CN110403954A (en) * 2019-07-19 2019-11-05 广东省实验动物监测所 Application of the inhibitor of LncRNA XLOC_110286 in the drug that preparation promotes angiogenesis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110384800A (en) * 2019-07-19 2019-10-29 广东省实验动物监测所 Application of the LncRNA XLOC_075168 in the drug that preparation promotes angiogenesis
CN110403954A (en) * 2019-07-19 2019-11-05 广东省实验动物监测所 Application of the inhibitor of LncRNA XLOC_110286 in the drug that preparation promotes angiogenesis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Genbank Accession：NC_000007.14;Genbank database;《Genbank database》;20190909;第150403258-150403605位 *
Transcriptional analysis of long non-coding RNAs in facet joint osteoarthritis.;chu chen et al.;《RSC Advances》;20181001;第8卷(第59期);33695-33701 *

Also Published As

Publication number Publication date
CN110846315A (en) 2020-02-28

Similar Documents

Publication Publication Date Title
CN110403954B (en) Application of LncRNA XLOC _110286 inhibitor in preparation of medicine for promoting angiogenesis
CN110384800B (en) Application of LncRNA XLOC _075168 in preparation of medicine for promoting angiogenesis
AU2006327073B2 (en) In vitro expansion of postpartum derived cells in roller bottles
CN110846315B (en) Long-chain non-coding RNA XLOC _102237 and application thereof in human umbilical vein endothelial cells
CN111154763B (en) Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function
CN110484614B (en) Application of LncRNA XLOC _057528 inhibitor in preparation of medicine for promoting angiogenesis
CN108642054A (en) Reduce immunogenicity sgRNA, low immunogenicity dressing and preparation method thereof
CN106480037A (en) A kind of long non-coding RNA and the application in diagnosis preeclampsia and target drug treatment is prepared
CN109182562B (en) miRNA apla-mir-25-42 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof
CN107663539A (en) Circular rna circ PTGR1 purposes
CN110846313B (en) Long-chain non-coding RNA XLOC _025806 and application thereof in human umbilical vein endothelial cells
Wu et al. The influence of bubble size on chondrogenic differentiation of adipose-derived stem cells in gelatin microbubble scaffolds
CN114432452A (en) Application of RNA Hsa _ circ _0063865 inhibitor in preparation of anti-esophageal squamous cell carcinoma drug
CN112813033A (en) Insulin and interleukin-10 double-gene modified reprogramming mesenchymal stem cell and preparation method and application thereof
WO2022213704A1 (en) High-migration mesenchymal stem cell, and preparation method therefor and application thereof
CN108913695B (en) Application of ZEB1 in human heart fibroblast
CN105602989B (en) A kind of recombinant vector and its application in preparation or screening Tamiflu
CN113069548B (en) Reagent for cardiac revascularization
CN105624159B (en) A kind of siRNA and its application for people&#39;s EDIL3 gene
CN108659108B (en) NAC transcription factor related to hardening of golden pear fruit tops
CN114958849B (en) Application of lncRNACACF to miR-520b-3p adsorption in regulation of human umbilical vein endothelial cell cycle
CN111118007A (en) Long non-coding RNA and application thereof in diagnosis/treatment of cervical cancer
CN114177298B (en) Application of ADAR1 as medicine for treating pulmonary hypertension disease
CN112280859B (en) Breast cancer marker and application thereof
CN115094090B (en) Cell modified by specific heparan sulfate modified enzyme gene, construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant