CN115974987A - Single-chain circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and application thereof - Google Patents

Abstract

The invention discloses a single-chain circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and application thereof, belonging to the technical field of vaccines. The invention screens the antigen epitopes of GyH VP1, VP2 and VP3 proteins by an online biological information analysis server, uses a Linker to connect the antigen epitopes to construct a multi-epitope vaccine GyMEV, and obtains the nucleotide sequence of the GyMEV through reverse translation and codon optimization. An antigen polypeptide GyMEV nucleotide sequence is cloned into a plasmid vector pMD19-T through artificial synthesis, a seamless cloning technology is utilized to directionally clone into a linearized adenovirus vector to obtain a recombinant adenovirus plasmid rAd5-GyMEV, and the recombinant plasmid is transfected into HEK293 cells to obtain a recombinant multi-epitope adenovirus vector vaccine GyMEV. The result shows that the GyMEV can stimulate the immune response of the organism more effectively and has stronger protection. The vaccine also has the safety of subunit vaccine, can adopt various immunization modes, and can stimulate the all-round immune response of organisms, thereby having wide development and application prospects.

Description

Single-chain circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and application thereof

Technical Field

The invention relates to the technical field of vaccines, in particular to a single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and application thereof.

Background

Infectious viral provential gastritis (TVP) is an infectious disease with swollen glandular stomach, dysplasia and low feed conversion rate, and brings great harm to poultry industry in China, but the pathogenic cause of the infectious disease is not determined yet. Based on this background, plum root et al isolated a novel virus GyV from sick chicken with chicken infectious viral proventriculitis by Pacbio third generation sequencing and replicated TVP using pure culture GyV. Further research confirms that GyV is one of pathogens causing chicken infectious proventriculitis, and simultaneously causes symptoms such as chicken anemia and immunosuppression (separation identification and pathogenesis research of chicken infectious proventriculitis related virus-circovirus type 3, doctor academic papers of Shandong university of agriculture). In addition, gyV can spread and infect mice across species, cause symptoms such as anemia and enteritis of the mice, is a potential human and animal co-disease virus, and harms public health and safety. By genetic evolution analysis, in 2021, krabberger et al changed the name of circovirus type 3 (Gyrovirus 3, gyv3) to circovirus type 1 (Gyrovirus homsal, gyH) based on the similarity of gene structures and the species found.

Since GyH is the first identified novel single-stranded circular DNA virus in proventriculitis chickens (GenBank accession number MG366592, the virus origin name "Gyrovirus GyV 3"), there is currently a lack of effective prevention and control measures against GyH 1.

The vaccine is an effective means for preventing and controlling virus infection, but researches on GyH virus vaccine are rarely reported, in order to obtain the vaccine with strong immunogenicity and good effect, gu Meiyu prepares subunit vaccine and DNA vaccine, 90 th to 463 th amino acids of VP1 are selected for expression to prepare the subunit vaccine, and the 90 th to 463 th amino acids of VP1 and VP2 are expressed in series through flexible amino acid linker to prepare the subunit vaccine; pEGFP-VP1 eukaryotic expression plasmid is constructed and used for the inoculation of chicken flock DNA vaccine. The results show that: the immunogenicity and immunoprotection of subunit vaccines are superior to DNA vaccines; VP1 _90-463 Subunit vaccines are superior to VP1 _90-463 The VP2 subunit vaccine shows that VP1+ VP2 does not achieve better effect. Since the above studies only relate to the epitope regions of VP1 and VP2 proteins of GyH virus, a vaccine against GyH virus needs to be studied more intensively.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide a single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and application thereof.

In order to realize the purpose, the invention adopts the following technical scheme:

in a first aspect of the present invention, there is provided an epitope polypeptide of single-stranded circular DNA virus GyH, comprising:

(1) CD8 of GyH virus VP1 protein, VP2 protein and VP3 protein ⁺ A T cell epitope region;

(2) CD4 of GyH virus VP1 protein, VP2 protein and VP3 protein ⁺ A T cell epitope region;

(3) B cell epitope regions of the VP1, VP2, and VP3 proteins of GyH virus;

(4) Connecting a arm Linker;

the CD8 ⁺ The T cell epitope region is selected from one of amino acid sequences shown in SEQ ID NO.9-SEQ ID NO.16A segment or a plurality of segments;

the CD4 ⁺ The T cell epitope region is selected from one or more of amino acid sequences shown in SEQ ID NO.17-SEQ ID NO. 24;

the B cell epitope region is selected from one or more of amino acid sequences shown in SEQ ID NO.25-SEQ ID NO. 36.

Preferably, the Linker arm Linker has the sequence AAY, GPGPG and/or KK.

Preferably, the amino acid sequence of the epitope polypeptide is shown as SEQ ID NO.4, and specifically comprises the following steps:

note: the hatched area in the sequence is the Linker arm Linker.

In a second aspect of the present invention, there is provided a gene encoding the above-mentioned epitope polypeptide.

Preferably, the nucleotide sequence of the coding gene is shown as SEQ ID NO.8.

In a third aspect of the present invention, a biomaterial containing the above-mentioned encoding gene of the epitope polypeptide is provided, wherein the biomaterial is a recombinant expression vector, an expression cassette, a recombinant bacterium or a host cell.

The fourth aspect of the invention provides the application of the epitope polypeptide or the encoding gene of the epitope polypeptide in preparing a vaccine for preventing GyH virus infection.

Preferably, the vaccine is in the form of an adenoviral vector vaccine, a subunit vaccine or a DNA vaccine; more preferably, the vaccine is in the form of an adenoviral vector vaccine.

The fifth aspect of the invention provides a single-chain circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine, which is constructed by the following method:

inserting the encoding gene of the epitope polypeptide into an adenovirus vector to construct a recombinant plasmid; and packaging and processing to obtain the recombinant multi-epitope adenovirus vector vaccine with immunogenicity.

Preferably, the adenovirus vector is a human type 5 replication-defective adenovirus.

The sixth aspect of the invention provides an application of the single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine in preparation of a medicament for preventing or treating GyH infection.

The invention has the beneficial effects that:

(1) The invention develops the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV for the first time based on the adenovirus vector, and because the human type 5 adenovirus is not popular in chickens, the vaccine of the invention is not affected by the pre-stored adenovirus antibody in chickens;

(2) The adenovirus vector vaccine has good safety, does not need to add an adjuvant, can adopt immune approaches such as muscle immunity or oral immunity and the like, and has good market competitiveness.

(3) The novel GyH1 prophylactic vaccine of the invention not only has originality, but also has better immunogenicity and feasibility, and can induce and generate high-level specific antibody reaction and cell reaction in chicken bodies by single intramuscular injection.

(4) The invention prepares GyH1 preventive vaccine based on human replication defective 5 adenovirus vector, and is expected to obtain a vaccine product which has the advantages of simple preparation, low cost, good safety, no need of adding adjuvant and wide application prospect.

Drawings

FIG. 1 is a secondary structure diagram of antigen polypeptide A, B, C and multi-epitope vaccine GyMEV constructed by the present invention;

FIG. 2 is a three-level structure diagram of an antigen polypeptide multi-epitope vaccine GyMEV constructed by the invention;

FIG. 3 is the molecular dynamics diagram of the antigen polypeptide multi-epitope vaccine GyMEV constructed by the invention;

FIG. 4 is a fluorescent microscope observation result graph of seven days after HEK293 cells are infected by recombinant multi-epitope adenovirus plasmids;

FIG. 5 is a diagram of rapid titration method for detecting virus titer of a candidate strain of a quantitative recombinant multi-epitope adenovirus vector vaccine;

FIG. 6 is a graph showing the growth and growth of antibodies in each group of chickens in clinical experiments;

FIG. 7 is a graph showing immunogenicity of groups of chickens in clinical trials;

FIG. 8 is a chart of the population weight detection of groups of chickens in a clinical trial;

FIG. 9 is a section of pathological tissues of chicken groups in clinical experiments.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As mentioned above, there are few reports on the study of GyH virus vaccine, and the existing study only relates to epitope region of VP1 and VP2 proteins of GyH virus, so that there is a need for further intensive study on the vaccine of GyH virus.

Based on the above, the invention provides the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV of the single-stranded circular DNA virus GyH1 and the application thereof, which can stimulate the immune protection reaction of an organism to GyH more effectively. The recombinant adenovirus vaccine has the safety of subunit vaccine and can stimulate the body to have all-round immune response in a plurality of immune modes within a period of time, thereby having wide development and application prospects.

In the invention, replication-defective adenovirus vector vaccines can be constructed by modifying the human adenovirus 5, and the invention has the following advantages: 1) After the adenovirus infects the cell, the genome can enter the cell nucleus, so the exogenous antigen carried by the adenovirus vector can stimulate the organism to generate stronger T cell and antibody response through the endogenous protein processing way; 2) The modified replication-defective adenovirus has good safety; 3) The adenovirus genome is not integrated into the host genome, and has no hereditary carcinogenicity; 4) The adenovirus has infectivity on various cells, and is beneficial to the expression and the presentation of antigen protein; 5) The adenovirus vector can be loaded with a foreign gene with the maximum length of 8 kb; 6) The timeliness of the adenovirus vector for expressing the exogenous gene in vivo is longer; 7) The amplification and purification process of the adenovirus is mature, and virus particles with higher titer can be obtained; 8) The human type 5 adenovirus does not have the influence on the pre-existing immunity of the vector in the chicken flocks, and is beneficial to the maximization of the vaccine immune effect.

In a preferred embodiment, the kit further comprises a Linker, and the sequence of the Linker is AAY, GPGPG and/or KK.

In a preferred embodiment, the adenoviral vector is a human type 5 replication-defective adenovirus.

The invention provides a preparation method of a recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV, which comprises the following steps:

1) Screening the antigen epitopes of GyH VP1, VP2 and VP3 proteins by an online biological information analysis server, and connecting the antigen epitopes by a Linker to construct GyMEV;

2) Further verifying the rationality and stability of the GyMEV by an online protein analysis server, and then obtaining a nucleotide sequence of the GyMEV through reverse translation and codon optimization;

3) Inserting the nucleotide sequence of GyMEV into an adenovirus vector plasmid to construct a recombinant adenovirus plasmid;

4) After enzyme digestion linearization, the recombinant plasmid is transfected into adenovirus packaging cells, and then cultured until 80% of the cells have obvious cytopathic effect;

5) Collecting cells, crushing the cells by adopting a repeated freeze thawing mode, and centrifugally collecting supernate;

6) Infecting adenovirus packaging cells with the supernatant, and culturing until the cells change from adherent to suspension state;

7) Performing repeated amplification culture according to the steps 5) and 6), collecting cells, crushing and centrifuging supernate;

8) And (3) purifying the recombinant adenovirus by taking the supernatant to obtain purified virus liquid, wherein the virus liquid is the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV.

In a preferred embodiment, the packaging cell is an adherent cell line or a suspension cell line that can support replication-defective adenovirus propagation.

In a preferred embodiment, the adenovirus packaging cell is an adherent HEK293 cell line.

In a preferred embodiment, the adenovirus purification protocol is cesium chloride density gradient centrifugation.

In the embodiment of the invention, the vaccine takes the human type 5 replication-defective adenovirus as a vector and carries the codon-optimized GyMEV, has good immunogenicity in chicken bodies, can induce organisms to generate strong cellular and humoral immune responses in a short time, and can be used for preparing the vaccine.

The dosage form of the circovirus type 1 vaccine is not particularly limited, and preferably comprises an injection, a nasal drop or a spray, and the injection is taken as an example in the examples, but the invention cannot be regarded as the full protection scope of the invention.

In conclusion, on the basis of finding a pathogenic mechanism between GyH1 and infectious proventriculitis for the first time, gyH is taken as a research object, the inventor of the invention obtains the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV with a good prevention effect, and the vaccine has no side effect, can cause a high antibody titer and has a good immune effect on GyH, and can be widely applied to the immunoprophylaxis work of GyH.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples and comparative examples of the present invention are conventional in the art and are commercially available. The experimental procedures, for which no detailed conditions are indicated, were carried out according to the usual experimental procedures or according to the instructions recommended by the supplier.

Wherein: human type 5 replication-defective adenovirus was purchased from Takara-Baori physicians and technology, inc.

Example 1 construction of antigen polypeptide A, B, C and Multi-epitope vaccine gyMEV

Screening of GyH1 epitope

The VP1, VP2, and VP3 amino acid sequences of GyH virus were obtained from the GyH sequence disclosed in GenBank accession number MG 366592. Predicting nonamers of conserved sequences of VP1 and, VP2 and VP3 proteins using NetCTL v1.2 server, generating nonamers with threshold higher than 0.5 for IEDB server predictionCD8 ⁺ T cell epitopes and MHC-I binding alleles. Predicting CD4 using IEDB server ⁺ T cell epitopes and MHC-II binding alleles. B-cell epitopes were predicted using the ABpred server. Further screening by Vaxijen v1.2 and IEDB Server evaluation of antigenicity and immunogenicity (antigenicity score greater than 0.5, and immunogenicity greater than 0.01, considered as a valid epitope) a total of 8 CD8 were screened ⁺ T cell epitope, 8 CD4 ⁺ T cell epitopes and 12B cell epitopes, with the following results:

table 1: CD8 ⁺ T cell epitopes and MHC-I binding alleles

Table 2: CD4 ⁺ T cell epitopes and MHC-II binding alleles

Table 3: b cell epitopes

2. Construction of epitope polypeptides A, B and C and multi-epitope vaccine GyMEV

Linking 8 CDs 8 with Linker1 ⁺ The epitope of the T cell is obtained to obtain the epitope polypeptide A, and the amino acid sequence of the epitope polypeptide A is SEQ ID NO.1.

Linking 8 CDs 4 with Linker2 ⁺ T cell epitope to obtain antigen epitope polypeptide B, and the amino acid sequence of the antigen epitope polypeptide B is SEQ ID NO.2.

Linker3 is adopted to connect 12B cell epitopes to obtain antigen epitope polypeptide C, and the amino acid sequence of the antigen epitope polypeptide C is SEQ ID NO.3.

The epitope polypeptide A, B is connected with C to obtain the multi-epitope vaccine GyMEV, and the amino acid sequence of the multi-epitope vaccine is SEQ ID NO.4.

Specifically, in this embodiment, it is preferable that the Linker1 has a sequence of AAY, the Linker2 has a sequence of GPGPG, and the Linker3 has a sequence of KK.

3. Detection of antigenicity, allergenicity and physicochemical Properties

Antigenicity was verified using the Vaxijen server and Allertop v2.0 server. The physical and chemical properties were predicted by using Protparam server, where antigenic polypeptide A is likely to be an allergen, antigenic polypeptide B has relatively low antigenicity, antigenic polypeptide C has too short half-life, and multiple epitope vaccine GyMEV has excellent indexes, as shown in Table 4

Table 4: detection of allergenicity and physicochemical properties of epitope polypeptide A, B, C and multi-epitope vaccine gyMEV

Note: antigenicity greater than 0.5 is satisfactory, instability index less than 40 is stable protein, otherwise unstable protein. An average water content of less than 0 indicates hydrophilicity and greater than 0 indicates hydrophobicity.

4. Two and three level structure prediction

The results are shown in fig. 1, using the psicred server to predict the secondary structure and the trRosetta server to predict the tertiary structure.

FIG. 1A shows the secondary structure of antigenic polypeptide A, with random coil (41/93, 44.08%) as the primary, followed by α -helix (38/93, 40.86%) and β -sheet (14/93, 15.06%).

FIG. 1B shows the secondary structure of antigenic polypeptide B, with random coil (93/155, 60%) as the major, followed by β -sheet (50/155, 32.25%) and α -helix (12/155,7.75%).

FIG. 1C shows the secondary structure of antigen polypeptide C, with random coil (134/214, 62.62%) as the primary, followed by β -sheet (72/214, 33.64%) and α -helix (8/214,3.74%).

FIG. 1D shows the multi-epitope vaccine gyMEV secondary structure, with random coil (288/469, 61.41%) as the main, followed by β -sheet (119/469, 25.38%) and α -helix (62/469, 13.21%),

the prediction result of the tertiary structure is shown in figure 2, the secondary and tertiary structures of the antigen polypeptide A, B, C and the GyMEV can be mutually matched, and the model reasonableness is high.

5. Molecular dynamics detection

The molecular dynamics of the antigen polypeptide GyMEV were analyzed using an iMODS server, and deformation analysis showed minimal deformation in the composite structure, as shown in fig. 3A; factor B is proportional to Root Mean Square (RMS), indicating stability of the antigenic polypeptide complex, as shown in figure 3B; FIG. 3C shows a covariance matrix between residue pairs, where red, white, and blue represent correlated motion, uncorrelated motion, and anti-correlated motion, respectively; FIG. 3D shows a model of the elastic network of the antigenic polypeptide, with darker grey indicating higher protein rigidity in certain regions. The conclusion shows that the constructed antigen polypeptide GyMEV has better stability.

6. Reverse translation and codon optimization

The JCAT server is used for carrying out reverse translation and optimizing codons, and the antigen polypeptide A obtains a nucleotide sequence with the length of 279bp, which is SEQ ID NO.5. The antigen polypeptide B obtains a nucleotide sequence with the length of 465bp, which is SEQ ID NO.6. The antigen polypeptide C obtains a nucleotide sequence with the length of 642bp, which is SEQ ID NO.7. The polyepitope vaccine GyMEV obtains a nucleotide sequence with the length of 1407bp, which is SEQ ID NO.8.

Example 2 preparation of recombinant adenovirus vector vaccines rAd5-A, rAd-B, rAd-C and rAd5-GyMEV

1. Artificially synthesizing target fragment

The antigenic polypeptides A, B, C and gyMEV nucleotide sequences obtained in example 1 were artificially synthesized into plasmid pMD19-T, respectively, to construct plasmids pMD19-A, pMD-B, pMD-C and pMD19-gyMEV.

2. Construction of recombinant adenovirus plasmid

By utilizing an In-Fusion technology, cloning plasmids containing the nucleotide sequences of the antigen polypeptide A, B, C and GyMEV are directionally inserted into an adenovirus vector (shown In table 5), competent escherichia coli cells are cotransformed, positive colonies are screened, bacteria are selected, bacteria are shaken, and the plasmids are greatly extracted to obtain recombinant adenovirus plasmids rAd5-A, rAd5-B, rAd-C and rAd5-GyMEV.

Table 5: in-Fusion system

3. Preparation of recombinant multi-epitope adenovirus vector vaccine

Digestion of recombinant adenovirus plasmid rAd5-A, rAd-B, rAd-C and rAd5-GyMEV

Before the recombinant adenovirus is packaged, the recombinant plasmid must be digested by PacI (see table 6), exposing Inverted Terminal Repeats (ITRs) located at both ends of the adenovirus genome, and releasing the adenovirus genome from the plasmid backbone.

Table 6:50 μ L PacI digestion System

1) Mixing the following reagents in a sterile 1.5 ml microcentrifuge tube;

2) Blowing and beating the mixed content and performing short-time centrifugation in a micro centrifuge;

3) Incubate at 37 ℃ for 10min. The completion of the PacI digestion was confirmed by analysis on a 1% agarose gel. The plasmid portion of the recombinant pAdeno5 vector will migrate at 3kb, while the adenovirus genome will not enter the gel, but will remain at the top of the channel;

4) Add 60ul 1X TE Buffer and 100ul phenol: chloroform: isoamyl alcohol (25;

5) Centrifuging in a high speed centrifuge at-4 deg.C 14000rmp for 5min;

6) Carefully transfer the top aqueous layer to a clean sterile 1.5 ml microcentrifuge tube;

7) Gently turn with 400. Mu.l 95% ethanol, 25. Mu.l ammonium acetate and 1. Mu.l sucrose (20 mg/ml);

8) Centrifuging in a high speed centrifuge at-4 deg.C 14000rmp for 5min;

9) The supernatant was removed and discarded, and 300 μ l 70% ethanol was added for washing;

10 Centrifugation in a high speed centrifuge at-4 ℃ 14000rmp for 2min, the supernatant carefully aspirated;

11 Air-dry the particles at room temperature for about 15min, add 10. Mu.l of TE Buffer to dissolve the DNA, and store at-20 ℃.

Transfection of linearized recombinant adenovirus plasmids into HEK293 cells

12-24 hours before transfection, at 12X10 per 60mm plate (about 100 cells/mm square) ⁶ Density of individual cells plates HEK293 cells were cultured. For best results, cells should fuse 50-70% prior to transfection, assume a flat morphology, and adhere well to the plate.

Each 60mm plate was transfected with 15. Mu.l of Pca 1-digested rAd5-X DNA. Calcium phosphate transfection method using calcium phosphate mammalian transfection kit (Cat) large plasmids into HEK293 cells (see table 7).

Table 7:600 μ L calcium phosphate transfection System

1) Incubating the mixture at room temperature for 5-15min;

2) Slowly dropping 600 mul of the mixed solution into the culture medium;

3) Moving the cell bottle back and forth to uniformly distribute the transfection mixed solution;

4) 5% CO at 37 ℃% ₂ Culturing for 8-10h in an incubator;

5) Removing the medium mixture containing calcium phosphate, and washing the cells with the medium;

6) Addition of 5ml of fresh medium, 37 ℃,5% CO ₂ Culturing in an incubator for one week;

7) Observing the fluorescence signal intensity 24-72 h after transfection (as shown in fig. 4), blowing cells after one week when cytopathic effect (CPE) appears, and transferring the suspension to a sterile 15ml conical centrifuge tube;

8) 3000rmp,5min, centrifuging to collect cells, discarding supernatant, and adding 2ml of PBS to resuspend cells;

9) Freezing the cells at-80 deg.C for 40min, taking out the cells, placing in 37 deg.C water bath for 5min, and repeatedly freezing and thawing for 3 times;

10 12000rmp,2min, centrifuging, collecting supernatant, storing at-80 deg.C.

Example 3: identification and titer determination of recombinant adenovirus vector vaccines rAd5-A, rAd-B, rAd-C and rAd5-GyMEV

1. Identification of recombinant epitope adenovirus vector vaccine and virus titer determination

1) Cells grown at a density of 80% or more were plated on 12-well plates

2) Dilution of P2-generation virus 10 in duplicate using PBS as diluent ^-2 —10 ^-6 。

3) Add 100. Mu.l of virus dilution per well.

4).37℃，5％CO ₂ Culturing in an incubator for 48h.

5) Add 1ml of iced 100% methanol and let stand at-20 ℃ for 10min.

6) Methanol was discarded, BSA 1ml,3min was added, PBS +1%, and washed three times.

7) With PBS 1:1000 dilution primary antibody (Mouse Anti-Hexon).

8) Add 500. Mu.l primary antibody per well and incubate for 1h at 37 ℃.

9) Discard primary antibody, add PBS +1% BSA 1ml,3min, wash three times.

10 With PBS 1: the secondary antibody (Rat Anti-Mouse) was diluted 1500.

11 Discard secondary antibody, add PBS +1% BSA 1ml,3min, wash three times.

12 500ul DAB working solution (10 XDAB:1Xstable persidase =1:10 Incubate for 10min at room temperature).

13 Observing the number of positive cells (black/brown) in each hole under a microscope, wherein the result is shown in figure 5, figure 5A is recombinant adenovirus vector vaccine rAd5-A, figure 5B is recombinant adenovirus vector vaccine rAd5-B, figure 5C is recombinant adenovirus vector vaccine rAd5-C, and figure 5D is recombinant adenovirus vector vaccine rAd5-GyMEV.

14 Calculating virus titer)

The formula: ifu = (number of positive cells × cell culture plate bottom area (cm) ² ) /(Virus volume (ml) × dilution factor)

According to the formula, the virus titer of rAd5-A, rAd-B, rAd-C and rAd5-GyMEV is respectively calculated to be 1.08 multiplied by 10 ⁸ ifu/ml、1.27×10 ⁸ ifu/ml、1.15×10 ⁸ ifu/ml and 1.29X 10 ⁸ ifu/ml。

Example 4 clinical applications of recombinant adenovirus vector vaccines rAd5-A, rAd-B, rAd-C and rAd5-GyMEV

Detoxification protection of GyH1

SPF1 day old chicks were purchased from dennsys poultry science ltd and classified into 5 groups by category. The first immunization is carried out on SPF chickens 7 days old, the second immunization is carried out on SPF chickens 14 days old, 30 vaccine groups are only used for leg muscle vaccination, and abdominal cavity vaccination is carried out on SPF chickens 15 days old. Details are given in table 8.

Table 8: animal experimental design of recombinant adenovirus vector vaccine

2. Immunogenicity testing

And (3) detection of immune factors: after the first immunization of SPF chickens at the age of 7 days, blood is taken and serum is separated at the ages of 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks and 6 weeks after the immunization. The GyH ELISA antibody detection method established in the laboratory ("establishment and application of circovirus humanized type 1 antibody/antigen ELISA detection method", university of Shandong agriculture Master's academic paper) is used for detecting the antibody growth and death rule, and the detection results show that the antibody levels of all vaccines start to rise in two weeks after the first immunization, the vaccine C starts to fall in the fourth week, other vaccines start to fall in the fifth week, and the antibody level of the chicken flocks inoculated with the multi-epitope vaccine GyMEV is highest (FIG. 6). IL-4 and IFN-gamma detection is carried out by using chicken IL-4 and IFN-gamma ELISA detection kit, and the detection result shows that the IL-4 and IFN-gamma expression quantity of the inoculated multi-epitope vaccine gyMEV inoculated chicken flock is highest, which indicates that the multi-epitope vaccine gyMEV has the best immunogenicity (figures 7A and 7B; in the figures)The abscissa time represents the 1-4 weeks after the first immunization at 7 days of age). Taking 4 weeks after the first immunization at 7 days as an example, the IFN-gamma expression level of the vaccine group GyMEV is 180.4pg/ml, and the IL-4 expression level is 210.07pg/ml; the IFN-gamma expression level of the vaccine group A is 69.19pg/ml, and the expression level of IL-4 is 103.33pg/ml; the IFN-gamma expression level of the vaccine group B is 89.86pg/ml, and the expression level of IL-4 is 99.0pg/ml; the IFN-gamma expression level of the vaccine group C is 76.53pg/ml, and the IL-4 expression level is 77.33pg/ml; the control group G had an IFN-. Gamma.expression level of 57.45pg/ml and an IL-4 expression level of 60.86pg/ml. The vaccine group GyMEV will screen 8 CDs 8 compared to vaccine group a-vaccine group C ⁺ T cell epitope, 8 CD4 ⁺ The T cell epitope and the 12B cell epitopes are combined together, and the T cell epitope and the 12B cell epitope have obvious synergistic effect on the aspect of improving the immunogenicity of the vaccine.

3. Protective assay

And (3) weight detection: after the 15-day-old chicken flocks are inoculated with the virus, the feeding condition and the drinking condition of the chicken flocks are observed every day, the weight is weighed and recorded, the growth condition of the chicken flocks is monitored to prepare a line graph, and the result shows that: compared with the control group G, the vaccine group GyMEV can effectively relieve early growth inhibition symptoms of the virus, and the multi-epitope vaccine GyMEV has the best protection (figure 8, the abscissa in the table takes the 15-day-old virus inoculation as 0 day).

GyH1 antigen detection: after 15 days of virus inoculation, blood was collected weekly, blood DNA was extracted, and PCR identification was performed using GyH1 identification primers (F: GACACAGACTGCGACGAAGA; R: ATGCTCCTGGCTGTCTAGAT) for GyH 1. Infection, mortality and protection rates were calculated for each group GyH (table 9).

Table 9: animal experiments groups GyH infection, mortality and protection rates

Note: infection rate = (number of positive chickens detected by GyH antigen 5363/30) × 100%;

mortality = (number of dead chickens/30) × 100%;

protection rate = 1-infection rate.

The results in Table 9 are counted up to week 5 after 15 days of virus inoculation.

Pathological observation: each group of test animals was killed and dissected at 5 weeks (after the completion of body weight detection and GyH antigen detection) after 15-day-old vaccination to observe gross lesions of the animals, tissues such as spleen, kidney, glandular stomach, bursa of fabricius, bone marrow, thymus, etc. were collected, tissues and organs of each group of animals were fixed in 4% formalin to prepare paraffin tissue sections, and pathological histological lesions were observed under a microscope (fig. 9), and the results showed that each vaccine group could protect tissues to some extent from damage, while the vaccine group gyMEV had the best effect (table 10).

Table 10: histopathological lesion assessment

Note: "+" indicates lesion severity, "++++" severe lesions, "++++" moderate lesions, "+" mild lesions, "-" no obvious lesions

In summary, the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV of the invention is to screen out 8 CD8 ⁺ T cell epitope, 8 CD4 ⁺ Combining T cell epitopes and 12B cell epitopes to be used as antigen epitope polypeptides, and then inserting encoding genes of the antigen epitope polypeptides into an adenovirus vector to construct recombinant plasmids; and packaging and processing to obtain the recombinant multi-epitope adenovirus vector vaccine with immunogenicity. And 8 CDs 8 alone ⁺ T cell epitopes, 8 CD4 alone ⁺ Compared with the recombinant multi-epitope adenovirus vector vaccine constructed by independently using 12B cell epitopes, the T cell epitope has synergistic effect on the aspects of improving the immunogenicity and the protective performance of the vaccine.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made to the present application by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims (10)

1. An epitope polypeptide of single-chain circular DNA virus GyH, comprising:

(1) CD8 of GyH virus VP1 protein, VP2 protein and VP3 protein ⁺ A T cell epitope region;

(2) CD4 of GyH virus VP1 protein, VP2 protein and VP3 protein ⁺ A T cell epitope region;

(3) GyH 1B cell epitope regions of virus VP1 protein, VP2 protein, and VP3 protein;

(4) A Linker is connected with the arm;

the CD8 ⁺ The T cell epitope region is selected from one or more of amino acid sequences shown in SEQ ID NO.9-SEQ ID NO. 16;

the CD4 ⁺ The T cell epitope region is selected from one or more of amino acid sequences shown in SEQ ID NO.17-SEQ ID NO. 24;

the B cell epitope region is selected from one or more of amino acid sequences shown in SEQ ID NO.25-SEQ ID NO. 36.

2. The epitope polypeptide of claim 1, wherein the Linker arm Linker has the sequence AAY, GPGPG and/or KK.

3. The epitope polypeptide of claim 1, wherein the amino acid sequence of said epitope polypeptide is represented by SEQ ID No.4.

4. A gene encoding the epitope polypeptide according to any one of claims 1 to 3.

5. The encoding gene of claim 4, wherein the nucleotide sequence of the encoding gene is shown as SEQ ID No.8.

6. The biomaterial containing the gene encoding the epitope polypeptide of claim 4 or 5, wherein the biomaterial is a recombinant expression vector, an expression cassette, a recombinant bacterium, or a host cell.

7. Use of the epitope polypeptide of any one of claims 1-3 or the encoding gene of claim 4 or 5 for the preparation of a vaccine for preventing GyH viral infection.

8. Use according to claim 7, wherein the vaccine is in the form of an adenoviral vector vaccine, a subunit vaccine or a DNA vaccine; preferably, the vaccine is in the form of an adenoviral vector vaccine.

9. A single-chain circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine is characterized by being constructed by the following method:

inserting a gene encoding the epitope polypeptide of claim 4 or 5 into an adenovirus vector to construct a recombinant plasmid; packaging and processing to obtain the recombinant multi-epitope adenovirus vector vaccine with immunogenicity;

preferably, the adenovirus vector is a human type 5 replication-defective adenovirus.

10. The use of the single-stranded circular DNA virus GyH recombinant multi-epitope adenovirus vector vaccine of claim 9 in the preparation of a medicament for preventing or treating GyH infection.

Images