CN115961070A - Primer probe combination and kit for detecting aspergillus - Google Patents
Primer probe combination and kit for detecting aspergillus Download PDFInfo
- Publication number
- CN115961070A CN115961070A CN202211122085.1A CN202211122085A CN115961070A CN 115961070 A CN115961070 A CN 115961070A CN 202211122085 A CN202211122085 A CN 202211122085A CN 115961070 A CN115961070 A CN 115961070A
- Authority
- CN
- China
- Prior art keywords
- aspergillus
- probe
- seq
- primer
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 76
- 241000228212 Aspergillus Species 0.000 title claims abstract description 26
- 238000001514 detection method Methods 0.000 claims abstract description 35
- 241001225321 Aspergillus fumigatus Species 0.000 claims abstract description 21
- 229940091771 aspergillus fumigatus Drugs 0.000 claims abstract description 21
- 241000228245 Aspergillus niger Species 0.000 claims abstract description 18
- 241000228197 Aspergillus flavus Species 0.000 claims abstract description 17
- 238000000034 method Methods 0.000 claims description 15
- 239000002773 nucleotide Substances 0.000 claims description 15
- 125000003729 nucleotide group Chemical group 0.000 claims description 15
- 125000006853 reporter group Chemical group 0.000 claims description 9
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 8
- 238000010791 quenching Methods 0.000 claims description 8
- 230000000171 quenching effect Effects 0.000 claims description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 6
- 108090000623 proteins and genes Proteins 0.000 claims description 4
- 235000013305 food Nutrition 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 2
- 239000008223 sterile water Substances 0.000 claims description 2
- 238000012360 testing method Methods 0.000 claims description 2
- 108020005196 Mitochondrial DNA Proteins 0.000 abstract description 12
- 241000894006 Bacteria Species 0.000 abstract description 10
- 230000035945 sensitivity Effects 0.000 abstract description 4
- 108020004414 DNA Proteins 0.000 description 7
- 201000002909 Aspergillosis Diseases 0.000 description 5
- 208000036641 Aspergillus infections Diseases 0.000 description 5
- 230000003321 amplification Effects 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 5
- 206010036790 Productive cough Diseases 0.000 description 4
- 244000052616 bacterial pathogen Species 0.000 description 4
- 238000012986 modification Methods 0.000 description 4
- 230000004048 modification Effects 0.000 description 4
- 208000024794 sputum Diseases 0.000 description 4
- 210000003802 sputum Anatomy 0.000 description 4
- 229910021642 ultra pure water Inorganic materials 0.000 description 4
- 239000012498 ultrapure water Substances 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000003556 assay Methods 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 210000004072 lung Anatomy 0.000 description 3
- 210000003470 mitochondria Anatomy 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 108020004566 Transfer RNA Proteins 0.000 description 2
- 239000011324 bead Substances 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 210000003527 eukaryotic cell Anatomy 0.000 description 2
- 239000012530 fluid Substances 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 210000000056 organ Anatomy 0.000 description 2
- 210000003463 organelle Anatomy 0.000 description 2
- 210000002345 respiratory system Anatomy 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 239000000758 substrate Substances 0.000 description 2
- 238000002054 transplantation Methods 0.000 description 2
- 108020004463 18S ribosomal RNA Proteins 0.000 description 1
- 108020005096 28S Ribosomal RNA Proteins 0.000 description 1
- 240000006439 Aspergillus oryzae Species 0.000 description 1
- 235000002247 Aspergillus oryzae Nutrition 0.000 description 1
- 108020000946 Bacterial DNA Proteins 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 206010062016 Immunosuppression Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 241000208125 Nicotiana Species 0.000 description 1
- 235000002637 Nicotiana tabacum Nutrition 0.000 description 1
- 208000037581 Persistent Infection Diseases 0.000 description 1
- 208000027418 Wounds and injury Diseases 0.000 description 1
- 230000004103 aerobic respiration Effects 0.000 description 1
- 230000000172 allergic effect Effects 0.000 description 1
- 208000010668 atopic eczema Diseases 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 206010006451 bronchitis Diseases 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000007847 digital PCR Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000001506 immunosuppresive effect Effects 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 208000014674 injury Diseases 0.000 description 1
- 230000036210 malignancy Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, in particular to a primer probe and a kit for detecting aspergillus. The primer and the probe are designed aiming at the specific region of the mitochondrial genes of aspergillus fumigatus, aspergillus flavus and aspergillus niger, so that the combined detection of three common aspergillus fumigatus, aspergillus flavus and aspergillus niger can be quickly realized, no cross exists on 22 detected bacteria, and the kit has the characteristics of high sensitivity, good specificity and high repeatability.
Description
Technical Field
The invention relates to the technical field of biotechnology, in particular to a primer probe combination and a kit for detecting aspergillus.
Background
Aspergillus is the most infectious mould strain, and has more than 250 wide-spread nature, and more than 40 of the aspergillus are pathogenic bacteria. Aspergillus can parasitize the skin and upper respiratory tract of normal people and is a conditional pathogen. The normal people have certain resistance to aspergillus and do not cause diseases. Aspergillosis is mostly secondary, when the resistance of a body is reduced, pathogenic bacteria can pass through a skin mucosa injury or be inhaled into a respiratory tract, and then enter blood circulation to other tissues or organs to cause diseases. Patients with immunosuppression, malignancy, organ transplantation (common in lung transplantation) are the major patient population with aspergillus infection. The main infection sites of aspergillus are the lungs, which are divided into three main groups: allergic bronchial infection, chronic infection, and invasive infection. The aspergillus mainly infecting the lung includes aspergillus fumigatus, aspergillus flavus, aspergillus niger and the like. The tobacco aspergillosis accounts for more than 90% of all aspergillosis.
Mitochondria, also known as the energy supply station of eukaryotic cells, are an important organelle in eukaryotic cells because aerobic respiration is performed in mitochondria. As a semi-autonomous organelle, mitochondria possess a certain number of genetic systems, called mitochondrial genes, independent of the nucleus.
Because fungi are difficult to culture and grow slowly, the main method for detecting aspergillus infection is GM detection, which has the disadvantage that influence by certain foods or drugs can cause false positive results. At present, a report of detecting aspergillus by using a qPCR technology is also available, but the detection target is genome DNA (18S RNA, ITS zone or 28S RNA) of one strain of aspergillus fumigatus or three strains of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and a report of using a linear body gene as the detection target for detecting aspergillus is not available at present.
Disclosure of Invention
In view of the above, the invention provides a primer probe combination and a kit for detecting aspergillus. The primer probe combination can rapidly realize the joint detection of three common aspergillus including aspergillus fumigatus, aspergillus flavus and aspergillus niger, and has the advantages of high sensitivity, good specificity and high repeatability.
In order to achieve the above object, the present invention provides the following technical solutions:
a primer probe combination for detecting aspergillus, comprising:
primers and probes for detecting aspergillus fumigatus: 1-2 and 3 respectively;
detecting a primer and a probe of the aspergillus niger: primers of the nucleotide sequences shown in SEQ ID NO. 4-5 and probes of the nucleotide sequences shown in SEQ ID NO. 6; and/or
Primers and probes for detecting aspergillus flavus: primers of the nucleotide sequences shown in SEQ ID NO. 7-8 and probes of the nucleotide sequences shown in SEQ ID NO. 9.
The invention designs primers and probes aiming at specific conserved region sequences of mitochondrial genes of aspergillus fumigatus, aspergillus flavus and aspergillus niger, wherein the nucleotide sequence of the specific conserved region of the mitochondrial genes of aspergillus fumigatus is shown as SEQ ID NO. 13; the nucleotide sequence of the specificity conservative region of the Aspergillus niger mitochondrial gene is shown as SEQ ID NO. 14; the nucleotide sequence of the specificity conservative region of the aspergillus flavus mitochondrial gene is shown as SEQ ID NO. 15.
In the invention, the 5 'end of the probe is marked with a fluorescence reporter group, and the 3' end of the probe is marked with a fluorescence quenching group. Wherein:
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 3 is marked with a fluorescence reporter group FAM, and the 3' end is marked with a fluorescence quenching group MGB;
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 6 is marked with a fluorescence reporter group ROX, and the 3' end is marked with a fluorescence quenching group MGB;
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 9 is marked with a fluorescence reporter group CY5, and the 3' end is marked with a fluorescence quenching group MGB.
The invention also provides the application of the primer probe combination in the preparation of the aspergillus detection kit; the Aspergillus includes at least one of Aspergillus fumigatus, aspergillus flavus or Aspergillus niger.
The invention also provides a kit for detecting aspergillus, which comprises the primer probe combination.
The kit provided by the invention also comprises a primer and a probe which are designed aiming at the conserved region shown in SEQ ID NO.16 and are used for detecting the reference gene: a primer with a nucleotide sequence shown as SEQ ID NO. 10-11 and a probe with a nucleotide sequence shown as SEQ ID NO. 12.
Wherein, the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO.12 is marked with a fluorescence reporter group VIC, and the 3' end is marked with a fluorescence quenching group BHQ1.
The kit provided by the invention also comprises sterile water and ddPCRMix.
The invention also provides a method for detecting aspergillus, and the primer probe or the kit provided by the invention is used for detecting a sample to be detected.
In the invention, the detection is PCR detection, and the detection procedure is as follows: 95 ℃ for 5min, [98 ℃ for 15s,60 ℃ for 30s ]. Times.40 cycles.
In the invention, the samples to be detected comprise human sputum samples, alveolar lavage fluid samples, blood samples and thoracoabdominal water samples. In some embodiments, the assays of the invention are assays for non-diagnostic purposes, such as assays for samples of an environment or for food, wherein the sample in the environment comprises a water sample or a swab on a surface of an object.
The primer and the probe are designed aiming at the specific regions of mitochondrial genes of aspergillus fumigatus, aspergillus flavus and aspergillus niger, so that the joint detection of three common aspergillus fumigatus, aspergillus flavus and aspergillus niger can be quickly realized, no cross exists on 22 detected bacteria, and the kit has the characteristics of high sensitivity, good specificity and high repeatability.
Detailed Description
The invention provides a primer probe combination and a kit for detecting aspergillus. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
Unless otherwise specified, the test materials used in the present invention are all common commercial products and are all available on the market.
The invention is further illustrated by the following examples:
example 1
1.1 primer Probe design
1.1.1 respectively designing a pair of primers and a probe by adopting Primer Express software according to the analysis result of mitochondrial gene sequences of aspergillus (including aspergillus fumigatus, aspergillus flavus and aspergillus niger); meanwhile, a group of primer probes of exogenous internal reference are matched, and the specific information is as follows:
TABLE 1
1.1.2 samples
1.1.2.1 bacterial DNA samples: and (3) externally purchasing dead bacteria, and extracting genome DNA by a magnetic bead method.
1.1.2.2 human DNA sample: extracting genome DNA by a magnetic bead method by using sterile sputum/alveolar lavage fluid.
1.1.2.3 exogenous internal reference template: synthesized by biological companies, and dissolved and diluted for later use.
1.2 digital PCR amplification System
1.2.1 25XBc primer probe mixed solution
TABLE 2
| Components | Stock solution (mu M) | Volume (mu L/person) |
| ASP-FUM-MIT-F-4 | 100 | 0.1 |
| ASP-FUM-MIT-R-4 | 100 | 0.1 |
| ASP-FUM-MIT-P-4 | 100 | 0.03 |
| ASP-NIG-MIT-F-1 | 100 | 0.1 |
| ASP-NIG-MIT-R-1 | 100 | 0.1 |
| ASP-NIG-MIT-P-1 | 100 | 0.03 |
| ASP-FLA-MIT-F-2 | 100 | 0.15 |
| ASP-FLA-MIT-R-2 | 100 | 0.15 |
| ASP-FLA-MIT-P-2 | 100 | 0.045 |
| IC-F | 100 | 0.15 |
| IC-R | 100 | 0.15 |
| IC-P | 100 | 0.045 |
| Total up to | / | 1.15 |
1.2.2 ddPCR reaction system
TABLE 3
1.2.3 amplification procedure
98℃5min【98℃15s，60℃30s】*40
TABLE 4
1.4 conclusion
For the pathogenic bacteria, the kit only detects aspergillus fumigatus, aspergillus niger and aspergillus flavus, and does not detect other pathogenic bacteria. The primer probe has high specificity, and can accurately and specifically detect the aspergillus niger and aspergillus oryzae.
Example 2
A primer probe is designed by taking the gene of Aspergillus fumigatus 18sRNA as a target, and the sequence of the primer probe is as follows:
TABLE 5
| primer/Probe name | Sequence of |
| IF-ASP-FUM-F-1 | CCCGTCGCTACTACCGATTG |
| IF-ASP-FUM-R-1 | CGGCTCTGGGGAGTCGTT |
| IF-ASP-FUM-P-1 | CTGGCTCAGGGGAGTT |
And (3) detecting the amplification efficiency of the primer probe:
TABLE 6
With the primer probe of the present invention and the primer probe of table 5, qPCR detection was performed with the optimal primer probe concentration and the concentrations of the above 3 artificially synthesized DNA templates, and the Ct value increased by about 3 for each 10-fold decrease in the result concentration. Since the power of 3.3 of 2 is equal to 10, the amplification efficiency of the primer probe in the system is close to 100%.
Example 3
4 Aspergillus fumigatus positive sputum samples were assayed using the above primer probe systems (18 sRNA and A. FUM-MIT), respectively. After extracting by using a sputum DNA extraction reagent TF1 developed by our company, 5. Mu.l of each system was added as a template. The detection values are as follows:
TABLE 7
| Sample 1 (FAM) | Sample 2 (FAM) | Sample 3 (FAM) | Sample 4 (FAM) | |
| 18sRNA | 3.11copies/μl | 2.57copies/μl | 2.62copies/μl | 3.78copies/μl |
| A.FUM-MIT | 1300copies/μl | 1003copies/μl | 1078copies/μl | 1503copies/μl |
In real positive sample detection, the detection concentration taking aspergillus fumigatus mitochondrial genes as a detection target is about 390 times that taking 18sRNA as the detection target, the detection rate of positive samples is higher, and the detection concentration taking 18sRNA as the detection target is lower, so that false negative results are easy to occur.
Example 4 blank detection Limit (LoB) value
20 parts of deionized water were extracted daily as a template, and the above primer probe systems (18 sRNA and A. FUM-MIT) were used on different amplification instruments for three consecutive days. Except that all detection values are 0, analyzing whether the detection result obeys normal distribution by using a sps 23.0 software S-W, and if so, analyzing the LoB value by using a parametric method; if not, the LoB values were analyzed by nonparametric methods. The results are as follows:
TABLE 8
The maximum value of the calculation results of 3 times of taking the mitochondrial gene as the detection target is LoB value, namely 0.09 copies/mu l of aspergillus fumigatus and 0 copies/mu l of aspergillus flavus and aspergillus niger; the maximum value of the results obtained by taking 3 times and taking 18sRNA as the detection target is LoB, namely 0.29 copies/mu l of aspergillus fumigatus, 0.19 copies/mu l of aspergillus flavus and 21 copies/mu l of aspergillus niger. The specificity of a primer probe system taking mitochondrial genes as a detection target is obviously higher than that of a primer probe system taking 18sRNA as the detection target.
Example 5 blank detection Limit (LoD) values
1.1 minimum detection limit (LoD)
If LoB =0, then a probability unit scheme is employed; if LoB ≠ 0, the classical scheme is employed. The largest LOD of 3 reagent batches was formulated as the final reported value.
1.1.1 probability Unit scheme
Using ultrapure water as a substrate, DNAs of different target bacteria at known concentrations were incorporated, respectively, to prepare positive specimens. Then, ultrapure water was used to perform gradient dilution.
The same set of instruments including a droplet generator, a PCR amplification instrument and a chip reader are used, and 3 batch reagents are used for respectively and repeatedly detecting different concentration gradients of each target bacterium sample for 30 times.
And respectively calculating the positive detection rate of each concentration gradient of each target bacterium specimen, and selecting the lowest concentration with the positive detection rate of more than or equal to 95 percent as the LoD value of each target bacterium.
1.1.2 classical protocol
Using ultrapure water as a substrate, DNA of known concentrations of different target bacteria was incorporated as positive specimens. Then, the samples were diluted with ultrapure water to five concentrations of 1 × LoB, 2 × LoB, 3 × LoB, 4 × LoB, and 5 × LoB, respectively, and used as low-value samples.
The same set of instruments including a droplet generation instrument, a PCR amplification instrument and a chip reader are used, 3 batch number reagents are used, five low-value samples of each target bacterium are repeatedly detected for at least 12 times respectively, and the measurement results of at least 60 low-value samples are counted.
Respectively calculating LoD values of the target bacteria, wherein the method comprises the following steps:
1) The data distribution of at least 60 low value specimen measurements per lot of reagent is analyzed.
2) If the data are normally distributed, a parameter statistical method is adopted for analysis.
3) If the data are distributed in a biased state, a nonparametric statistical method is adopted for analysis.
The results are shown in the table below, with detection limits of LoD values.
TABLE 9
The result shows that the sensitivity of the primer probe system taking the mitochondrial gene as the detection target is obviously higher than that of the primer probe system taking 18sRNA as the detection target.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.
Claims (10)
1. A primer probe combination for detecting aspergillus, which is characterized by comprising:
primers and probes for detecting aspergillus fumigatus: 1-2 and 3, and a probe;
detecting a primer and a probe of the aspergillus niger: primers of the nucleotide sequences shown in SEQ ID NO. 4-5 and probes of the nucleotide sequences shown in SEQ ID NO. 6; and/or
Primers and probes for detecting aspergillus flavus: primers of the nucleotide sequences shown in SEQ ID NO. 7-8 and probes of the nucleotide sequences shown in SEQ ID NO. 9.
2. The primer and probe according to claim 1,
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 3 is marked with a fluorescence reporter group FAM, and the 3' end is marked with a fluorescence quenching group MGB;
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 6 is marked with a fluorescence reporter group ROX, and the 3' end is marked with a fluorescence quenching group MGB;
the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 9 is marked with a fluorescence reporter group CY5, and the 3' end is marked with a fluorescence quenching group MGB.
3. Use of the primer-probe combination of claim 1 or 2 for the preparation of a kit for the detection of aspergillus.
4. The use according to claim 3, wherein the Aspergillus comprises at least one of Aspergillus fumigatus, aspergillus flavus or Aspergillus niger.
5. A kit for detecting Aspergillus, comprising the primer-probe combination according to claim 1 or 2.
6. The kit of claim 5, further comprising primers and probes for detecting the reference gene: a primer with a nucleotide sequence shown as SEQ ID NO. 10-11 and a probe with a nucleotide sequence shown as SEQ ID NO. 12.
7. The kit according to claim 6, wherein the probe having the nucleotide sequence shown in SEQ ID NO.12 has a fluorescence reporter group VIC labeled at the 5 'end and a fluorescence quencher group BHQ1 labeled at the 3' end.
8. The kit of claim 5, further comprising sterile water and ddPCR Mix.
9. A method for the detection of Aspergillus for non-diagnostic purposes, characterized in that a test sample is detected using the kit according to any one of claims 5 to 8.
10. The method of claim 9, wherein the sample to be tested comprises a water sample from the environment, a food sample, or a swab on the surface of an object.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211122085.1A CN115961070A (en) | 2022-09-15 | 2022-09-15 | Primer probe combination and kit for detecting aspergillus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211122085.1A CN115961070A (en) | 2022-09-15 | 2022-09-15 | Primer probe combination and kit for detecting aspergillus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115961070A true CN115961070A (en) | 2023-04-14 |
Family
ID=87359105
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211122085.1A Pending CN115961070A (en) | 2022-09-15 | 2022-09-15 | Primer probe combination and kit for detecting aspergillus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115961070A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820921A (en) * | 2022-12-19 | 2023-03-21 | 领航基因科技（杭州）有限公司 | Primer probe combination for detecting three kinds of lung invasive fungi and digital PCR kit thereof |
-
2022
- 2022-09-15 CN CN202211122085.1A patent/CN115961070A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820921A (en) * | 2022-12-19 | 2023-03-21 | 领航基因科技（杭州）有限公司 | Primer probe combination for detecting three kinds of lung invasive fungi and digital PCR kit thereof |
| CN115820921B (en) * | 2022-12-19 | 2024-07-05 | 领航基因科技（杭州）有限公司 | Primer probe combination for detecting three lung invasive fungi and digital PCR kit thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115820921B (en) | Primer probe combination for detecting three lung invasive fungi and digital PCR kit thereof | |
| CN115820922B (en) | Primer probe combination and kit for detecting cryptococcus | |
| CN111500771B (en) | Primer group and kit for detecting novel coronavirus SARS-CoV-2 | |
| CN111020062A (en) | Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain | |
| CN108034745B (en) | Primer probe combination and kit for simultaneously detecting four candida | |
| US11306365B1 (en) | Molecular marker C42257 for rapidly identifying genetic sex of Marsupenaeus japonicus and applications thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| CN108070675B (en) | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus | |
| CN115961070A (en) | Primer probe combination and kit for detecting aspergillus | |
| CN116004874A (en) | Primer combination and kit for detecting Chlamydia psittaci based on isothermal amplification method | |
| CN114672585A (en) | Primer probe for detecting lung pathogenic bacteria and kit thereof | |
| CN117512204B (en) | Primer and probe combination for multiplex detection of aspergillus, cryptococcus and yersinia, kit and application | |
| CN113755619A (en) | Digital PCR detection kit for Burkholderia | |
| CN112680541B (en) | LNA-Taqman-multiplex fluorescence PCR technology and application thereof in rapid detection of candida | |
| CN106755379B (en) | Dimer mutation fluorescent primer quantitative PCR method for synchronously quantifying and genotyping 4 aspergillus | |
| CN114908084B (en) | Primer probe of cercospora spinosa, aspergillus terreus and aspergillus nidulans and application thereof | |
| CN112593008A (en) | Primer group, kit, method and application for detecting fungi | |
| CN115181803A (en) | Taqman probe qPCR detection primer group for detecting chaulmoogra and application | |
| CN116445647A (en) | Kit for detecting aspergillus, rhizopus and mucor | |
| CN114908181A (en) | Primer probe for detecting candida keratolytica and candida Norwegian and application thereof | |
| CN110484649A (en) | The primer and probe of fluorescence quantitative PCR detection turns ceramic route bacterium | |
| CN113444842B (en) | Specific primer group for fox retrovirus detection and application of PCR detection kit | |
| CN114908085A (en) | Primer, probe and kit for PCR detection of rhizopus | |
| CN109207623B (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and detection kit for identifying three sporothrix bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |