CN115960989A - Method and kit for targeted enrichment of genome target region sequence fragments and application of kit - Google Patents
Method and kit for targeted enrichment of genome target region sequence fragments and application of kit Download PDFInfo
- Publication number
- CN115960989A CN115960989A CN202211621887.7A CN202211621887A CN115960989A CN 115960989 A CN115960989 A CN 115960989A CN 202211621887 A CN202211621887 A CN 202211621887A CN 115960989 A CN115960989 A CN 115960989A
- Authority
- CN
- China
- Prior art keywords
- mda
- target region
- amplification
- specific
- mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 68
- 239000012634 fragment Substances 0.000 title claims abstract description 46
- 230000003321 amplification Effects 0.000 claims abstract description 57
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 57
- 238000006073 displacement reaction Methods 0.000 claims abstract description 35
- 108091092584 GDNA Proteins 0.000 claims abstract description 22
- 238000002156 mixing Methods 0.000 claims abstract description 18
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 17
- 230000035772 mutation Effects 0.000 claims description 42
- 238000012163 sequencing technique Methods 0.000 claims description 37
- 239000003153 chemical reaction reagent Substances 0.000 claims description 22
- 230000001717 pathogenic effect Effects 0.000 claims description 22
- 238000012408 PCR amplification Methods 0.000 claims description 21
- 208000002903 Thalassemia Diseases 0.000 claims description 15
- 238000001976 enzyme digestion Methods 0.000 claims description 15
- 102100022357 GATOR complex protein NPRL3 Human genes 0.000 claims description 10
- 102100027685 Hemoglobin subunit alpha Human genes 0.000 claims description 10
- 101001009007 Homo sapiens Hemoglobin subunit alpha Proteins 0.000 claims description 10
- 108010008532 Deoxyribonuclease I Proteins 0.000 claims description 9
- 102000007260 Deoxyribonuclease I Human genes 0.000 claims description 9
- 230000015572 biosynthetic process Effects 0.000 claims description 9
- 108010064144 endodeoxyribonuclease VII Proteins 0.000 claims description 9
- 239000000203 mixture Substances 0.000 claims description 9
- 238000003786 synthesis reaction Methods 0.000 claims description 9
- 238000003776 cleavage reaction Methods 0.000 claims description 8
- 230000007017 scission Effects 0.000 claims description 8
- -1 OR51AB1P Proteins 0.000 claims description 7
- 238000013461 design Methods 0.000 claims description 7
- 238000013467 fragmentation Methods 0.000 claims description 7
- 238000006062 fragmentation reaction Methods 0.000 claims description 7
- 102000004533 Endonucleases Human genes 0.000 claims description 6
- 108010042407 Endonucleases Proteins 0.000 claims description 6
- 201000006288 alpha thalassemia Diseases 0.000 claims description 6
- 208000008453 delta beta-thalassemia Diseases 0.000 claims description 6
- 230000002255 enzymatic effect Effects 0.000 claims description 6
- 238000011176 pooling Methods 0.000 claims description 6
- 102100028500 DNA-directed RNA polymerase III subunit RPC10 Human genes 0.000 claims description 5
- 102100024108 Dystrophin Human genes 0.000 claims description 5
- 102000004190 Enzymes Human genes 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 5
- 102100037156 Gap junction beta-2 protein Human genes 0.000 claims description 5
- 102100030826 Hemoglobin subunit epsilon Human genes 0.000 claims description 5
- 102100038614 Hemoglobin subunit gamma-1 Human genes 0.000 claims description 5
- 102100038617 Hemoglobin subunit gamma-2 Human genes 0.000 claims description 5
- 102100030378 Hemoglobin subunit theta-1 Human genes 0.000 claims description 5
- 102100030387 Hemoglobin subunit zeta Human genes 0.000 claims description 5
- 101000723883 Homo sapiens DNA-directed RNA polymerase III subunit RPC10 Proteins 0.000 claims description 5
- 101001053946 Homo sapiens Dystrophin Proteins 0.000 claims description 5
- 101000954092 Homo sapiens Gap junction beta-2 protein Proteins 0.000 claims description 5
- 101001083591 Homo sapiens Hemoglobin subunit epsilon Proteins 0.000 claims description 5
- 101001031977 Homo sapiens Hemoglobin subunit gamma-1 Proteins 0.000 claims description 5
- 101001031961 Homo sapiens Hemoglobin subunit gamma-2 Proteins 0.000 claims description 5
- 101000843063 Homo sapiens Hemoglobin subunit theta-1 Proteins 0.000 claims description 5
- 101000982762 Homo sapiens Olfactory receptor 51V1 Proteins 0.000 claims description 5
- 101000990750 Homo sapiens Olfactory receptor 52Z1 Proteins 0.000 claims description 5
- 101001074444 Homo sapiens Polycystin-1 Proteins 0.000 claims description 5
- 101000622041 Homo sapiens Putative RNA-binding protein Luc7-like 1 Proteins 0.000 claims description 5
- 101000617738 Homo sapiens Survival motor neuron protein Proteins 0.000 claims description 5
- 101000708381 Homo sapiens U11/U12 small nuclear ribonucleoprotein 25 kDa protein Proteins 0.000 claims description 5
- 101150009730 Nprl3 gene Proteins 0.000 claims description 5
- 102100026978 Olfactory receptor 51V1 Human genes 0.000 claims description 5
- 102100030574 Olfactory receptor 52Z1 Human genes 0.000 claims description 5
- 102100035278 Pendrin Human genes 0.000 claims description 5
- 102100036143 Polycystin-1 Human genes 0.000 claims description 5
- 102100023468 Putative RNA-binding protein Luc7-like 1 Human genes 0.000 claims description 5
- 108091006507 SLC26A4 Proteins 0.000 claims description 5
- 101001053942 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2) Diphosphomevalonate decarboxylase Proteins 0.000 claims description 5
- 102100021947 Survival motor neuron protein Human genes 0.000 claims description 5
- 102100031474 U11/U12 small nuclear ribonucleoprotein 25 kDa protein Human genes 0.000 claims description 5
- 208000005980 beta thalassemia Diseases 0.000 claims description 5
- 208000006602 delta-Thalassemia Diseases 0.000 claims description 5
- 230000000415 inactivating effect Effects 0.000 claims description 5
- 230000008569 process Effects 0.000 claims description 5
- 230000002194 synthesizing effect Effects 0.000 claims description 5
- 102100039128 DNA-3-methyladenine glycosylase Human genes 0.000 claims description 4
- 101710174134 Globin CTT-Z Proteins 0.000 claims description 4
- 101710094895 HTLV-1 basic zipper factor Proteins 0.000 claims description 4
- 101000744174 Homo sapiens DNA-3-methyladenine glycosylase Proteins 0.000 claims description 4
- 101000755816 Homo sapiens Inactive rhomboid protein 1 Proteins 0.000 claims description 4
- 102100022420 Inactive rhomboid protein 1 Human genes 0.000 claims description 4
- 239000007853 buffer solution Substances 0.000 claims description 4
- 230000008685 targeting Effects 0.000 claims description 3
- 230000004544 DNA amplification Effects 0.000 claims description 2
- 230000002779 inactivation Effects 0.000 claims 1
- 238000005516 engineering process Methods 0.000 abstract description 13
- 239000000047 product Substances 0.000 description 30
- 239000011324 bead Substances 0.000 description 29
- 108020004414 DNA Proteins 0.000 description 24
- 239000000872 buffer Substances 0.000 description 15
- 238000000746 purification Methods 0.000 description 14
- 238000007481 next generation sequencing Methods 0.000 description 11
- 238000007672 fourth generation sequencing Methods 0.000 description 7
- 238000001962 electrophoresis Methods 0.000 description 5
- 230000033616 DNA repair Effects 0.000 description 4
- 238000000137 annealing Methods 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000007403 mPCR Methods 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 102000012410 DNA Ligases Human genes 0.000 description 2
- 108010061982 DNA Ligases Proteins 0.000 description 2
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 206010064571 Gene mutation Diseases 0.000 description 2
- 101150071666 HBA gene Proteins 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000003766 bioinformatics method Methods 0.000 description 2
- 230000000295 complement effect Effects 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000010828 elution Methods 0.000 description 2
- 238000013412 genome amplification Methods 0.000 description 2
- 239000011499 joint compound Substances 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 239000011535 reaction buffer Substances 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 238000012070 whole genome sequencing analysis Methods 0.000 description 2
- 101100509371 Arabidopsis thaliana CHR11 gene Proteins 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 230000002759 chromosomal effect Effects 0.000 description 1
- 230000001351 cycling effect Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 238000010494 dissociation reaction Methods 0.000 description 1
- 230000005593 dissociations Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000010438 heat treatment Methods 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 239000011148 porous material Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 239000002096 quantum dot Substances 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 230000010076 replication Effects 0.000 description 1
- 238000005464 sample preparation method Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 241001515965 unidentified phage Species 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method and a kit for targeted enrichment of genome target region sequence fragments and application thereof, wherein the method comprises the following steps: and mixing gDNA of a sample to be detected, a specific MDA primer and phi 29DNA polymerase, and performing multiple displacement amplification to obtain an enriched sequence fragment of the target region. The method adopts an MDA technology, utilizes specific MDA primer amplification, and improves the identification accuracy of the target region gene compared with random primer amplification.
Description
Technical Field
The invention belongs to the technical field of gene sequencing, and particularly relates to a method and a kit for targeted enrichment of genome target region sequence fragments and application thereof.
Background
Oxford Nanopore's core technology-Nanopore (Nanopore) sequencing technology. Unlike all the conventional sequencing techniques, the reading of a base sequence is not performed by detecting light, a fluorescent signal color, or PH, but is performed by an electric signal-based sequencing technique. Protein nanopores are embedded on a synthetic membrane and immersed in an electrophysiological solution to allow ionic current to pass through the nanopores. When a molecule such as DNA or RNA passes through a nanopore, it interferes with the current, causing a characteristic change in the current signal. In this process, the signal is analyzed in real time to determine the base sequence of the DNA or RNA strand that is passing through the pore. The appropriate sample preparation method can be selected based on the desired experimental results to generate the most appropriate read length.
When sequencing genomic DNA, it is first necessary to perform whole genome amplification. Multiple Displacement Amplification (MDA) is the best single cell genome amplification technology recognized at present, can carry out high-fidelity uniform amplification on a whole gene, amplifies a fragment of 10-100kb and can provide a large amount of complete whole genome sequences. MDA (multiple displacement amplification technology) relies on the principle of strand displacement and utilizes bacteriophage Φ 29DNA polymerase to highly amplify DNA. Random primers are first used to anneal to the template DNA at multiple sites, and then Φ 29DNA polymerase initiates replication simultaneously at multiple sites of the DNA, which synthesizes DNA along the DNA template while displacing the complementary strand of the template. The replaced complementary strand becomes a new template for amplification, so that finally we can obtain a large amount of DNA.
However, the technology mainly aims at gDNA whole sequencing, and in order to cover a whole genome, a large amount of random primers need to be chemically synthesized, so that high cost is caused. However, in practical applications, whole genome sequencing is not needed, and a desired result can be obtained by amplifying a certain region, then building a library and sequencing, and at this time, random primer amplification by using MDA causes great waste in sequencing cost.
Regarding the technology of targeted gene enrichment, CN113637796A mentions a method for obtaining a library in the current nanopore sequencing technology, which includes genome extraction, design of specific primers with a linker, first round of multiplex PCR amplification of primers with a linker, enrichment and purification of a target fragment, second round of multiplex PCR amplification of a purified product using Index linker primers, enrichment of a target fragment, mass mixing of samples and the like, tail end repair, and sequencing linker ligation, thus completing library construction.
CN114196743A mentions a method for constructing a library when using nanopore sequencing, comprising; extracting total nucleic acid, performing multiplex PCR amplification of a specific primer with a first round of universal sequence, performing PCR amplification of a second round of tag sequence, connecting sequencing joints, mixing samples prepared for sequencing in the same batch, and performing a connecting reaction to obtain a sequencing library.
However, the above methods all require synthesis of a large number of primers to complete two PCR cycles to obtain enough target fragments for sequencing after library construction. The large size of the target gene fragment still causes high cost. In the field of gene sequencing of a target region, no method suitable for target gene enrichment exists at present, and the problem of high cost caused by a large number of primers required by two rounds of PCR synthesis can be solved.
Disclosure of Invention
In order to solve the problems, the invention provides a method for targeted enrichment of genome target region sequence fragments.
In a first aspect, the present invention provides a method for targeted enrichment of genomic target region sequence fragments, the method comprising:
mixing gDNA of a sample to be detected, a specific Multiple Displacement Amplification (MDA) primer and phi 29DNA polymerase, and performing Multiple Displacement Amplification (MDA) to obtain a sequence fragment of an enriched target region.
In a second aspect, the invention provides a method of sequencing a genomic target region, the method comprising:
performing targeted enrichment on a genome target region by using the method to obtain an enriched sequence fragment; and
sequencing the enriched sequence fragments.
The third aspect of the invention provides the application of the method for enriching the sequence fragment of the genome target region in a targeted mode or the method for sequencing the genome target region in determining the type of gene mutation. Preferably, the genetic mutation is a thalassemia mutation, more preferably a pathogenic alpha-thalassemia mutation, a pathogenic beta-thalassemia mutation, a pathogenic delta-thalassemia mutation or a pathogenic delta beta-thalassemia mutation.
In a fourth aspect, the present invention provides a kit for targeting sequence fragments enriched in a target region of a genome, wherein the kit comprises:
an MDA reagent for performing Multiple Displacement Amplification (MDA) of gDNA in a sample to be tested, the MDA reagent comprising a specific MDA primer and a Φ 29DNA polymerase.
The fifth aspect of the invention provides the application of the kit in determining the type of gene mutation. Preferably, the genetic mutation is a thalassemia mutation, more preferably a pathogenic alpha-thalassemia mutation, a pathogenic beta-thalassemia mutation, a pathogenic delta-thalassemia mutation or a pathogenic delta beta-thalassemia mutation.
The invention has the advantages of
The invention mainly improves the prior method from three aspects:
the invention replaces random primers required by whole genome Multiple Displacement Amplification (MDA), and enriches the required detection region through specific MDA primers, thereby successfully realizing the enrichment of the target region, improving the sequencing depth and reducing the single sample sequencing cost in nanopore sequencing.
In addition, the target area is enriched, so that the amount of sequencing data required by a single sample is reduced, and a foundation is laid for simultaneous computer sequencing of multiple samples.
Drawings
FIG. 1 is a schematic diagram of an experimental scheme of a targeted enrichment method of a gene in a target region according to an embodiment of the present invention.
FIG. 2 is an electrophoretogram before and after purification by multiple displacement amplification according to one embodiment of the present invention; where lanes 2 and 3 are before MDA product purification and lanes 5 and 6 are after MDA product purification.
FIG. 3 is an electrophoretogram following endonuclease digestion of multiple displacement amplification products in accordance with one embodiment of the present invention.
FIG. 4 is a schematic diagram of the experimental scheme of the method for targeted enrichment of a gene in a target region according to one embodiment of the present invention.
FIG. 5 is an electrophoretogram of products of multiple displacement amplification performed according to one embodiment of the present invention.
Figure 6 is a summary of NGS sequencing coverage performed according to one embodiment of the invention.
Figure 7 is a deep summary of NGS sequencing performed according to one embodiment of the invention.
Detailed Description
Hereinafter, embodiments of the present invention will be described in more detail to help understanding of the present invention. It should be understood that the description of these embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.
In a first aspect, the invention provides a method for targeted enrichment of genomic target region sequence fragments, the method comprising:
mixing gDNA of a sample to be detected, a specific Multiple Displacement Amplification (MDA) primer and phi 29DNA polymerase, and performing Multiple Displacement Amplification (MDA) to obtain a sequence fragment of an enrichment region. Multiplex displacement amplification is preferably performed in a buffer for amplification (buffer). The amount of the primer is controlled to be enough, and the ideal effect is difficult to achieve when the amount of the primer is too small.
According to a particular embodiment of the invention, the specific MDA primer is a primer capable of specifically binding to a sequence fragment of a genomic target region; preferably, the specific MDA primer is 20bp to 150bp in length;
preferably, the specific MDA primer is prepared by fragmenting a target gene amplified and enriched product;
further preferably, the fragmenting of the product after target gene amplification enrichment comprises the following steps:
1) Design and synthesis of PCR specific primers: designing primers aiming at target regions of a genome at intervals of 2Kb to 10Kb, and synthesizing to obtain specific primers for LR-PCR;
2) LR-PCR amplification: using negative gDNA as a template and the specific primer obtained in the step 1) to carry out LR-PCR amplification to obtain an LR-PCR amplification product;
3) Fragmenting the LR-PCR amplification product, preferably by enzymatic or mechanical disruption; and optionally
4) NGS pooling and library enrichment was performed using pooled LR-PCR products, followed by fragmentation. Preferably, the mechanical disruption comprises ultrasonic disruption. The method comprises the steps of designing a primer aiming at the specificity of a target region, carrying out large-fragment amplification by using LR-PCR, and carrying out enzyme digestion on an LR-PCR product to 20-150 bp by using an enzyme digestion mode to prepare the specific primer for MDA; the specificity is improved, and simultaneously, the synthesis cost of high-volume random primers can be reduced.
Further preferably, the fragmentation means is enzymatic cleavage. The fragment with the length of about 100bp can be prepared more easily by using an enzyme digestion method.
One skilled in the art can select a suitable primer preparation method according to the size of the primer.
According to a specific embodiment of the present invention, in step 2), a plurality of annealing temperatures are used for the LR-PCR amplification;
preferably, the annealing temperature is 55 ℃ to 65 ℃.
Preferably, in step 2), the LR-PCR amplification conditions are as follows: 90 ℃ to 98 ℃ for 10 seconds to 45 seconds; cycling for 30 times at 90 ℃ to 98 ℃ for 10 seconds to 45 seconds, 55 ℃ to 65 ℃ for 30 seconds to 90 seconds, 55 ℃ to 72 ℃ for 8 to 10 minutes; from 55 ℃ to 72 ℃ for from 2 minutes to 10 minutes; keeping at 4 ℃;
further preferably, the LR-PCR conditions are: 30 seconds at 94 ℃;30 seconds at 94 ℃, 1 minute at 55-65 ℃ and 8-10 minutes at 65 ℃ and circulating for 30 times; 10 minutes at 65 ℃; keeping at 4 ℃.
It is understood that the negative gDNA used in step 2) of the present invention refers to genomic DNA that is not mutated; the gDNA of the test sample may contain genomic DNA which has been mutated and/or not.
According to a particular embodiment of the invention, the method further comprises a purification step of the PCR product;
preferably, the method further comprises the step of purifying and quantifying the LR-PCR product.
According to a specific embodiment of the invention, the method further comprises the step of performing a homogeneity test on the pooled sample using the NGS platform prior to fragmentation.
According to a specific embodiment of the present invention, the method further comprises a step of purifying the fragmented products using DNA sorting magnetic beads;
preferably, the DNA sorting magnetic beads are Beckman AMPure XP magnetic beads.
According to a particular embodiment of the invention, the method further comprises a second enzymatic cleavage with an endonuclease after MDA, thereby obtaining enriched sequence fragments;
preferably, the second enzyme digestion comprises: adding endonuclease to digest the MDA product;
preferably, the endonuclease is endonuclease I and/or endonuclease VII. It is understood that, in the present invention, endonuclease I can also be written as T7 Endoclearase I, and Endonuclease VII can also be written as T4 Endoclearase VII.
According to a specific embodiment of the present invention, wherein the Multiple Displacement Amplification (MDA) process comprises:
mixing the gDNA of the sample to be detected and the small fragment amplification product according to the mass ratio of 10000-10 to 1, heating to 90-98 ℃ for 3-10 minutes, and immediately placing on ice for 5-10 minutes; and
adding amplification buffer solution and phi 29DNA polymerase, performing constant-temperature amplification at 28-32 ℃ for 2-8 hours, inactivating at 60-65 ℃ for 5-30 minutes, and keeping at 4 ℃;
further preferably, the multiple displacement amplification process comprises: mixing the gDNA of the sample to be detected and the specific MDA primer according to the mass ratio of 10000-10, immediately placing the mixture on ice for 5 minutes at 95 ℃ for 5 minutes; and
adding amplification buffer solution and phi 29DNA polymerase, performing constant temperature amplification at 30 ℃ for 6 hours, inactivating at 65 ℃ for 10 minutes, and keeping at 4 ℃.
According to a specific embodiment of the present invention, the method further comprises the steps of purifying the PCR product by using DNA sorting magnetic beads after the multiple displacement amplification;
preferably, the DNA sorting magnetic beads are Beckman AMPure XP magnetic beads.
According to a specific embodiment of the invention, the method further comprises a step of purifying the enzyme digestion product by using DNA sorting magnetic beads after the second enzyme digestion;
preferably, the DNA sorting magnetic beads are Beckman AMPure XP magnetic beads.
According to a specific embodiment of the present invention, the method further comprises performing NGS pooling and enriching the library using the pooled LR-PCR products, followed by fragmentation in step 3). The NGS library is built by using the mixed sample, and the library is enriched and fragmented and then used as a primer of an MDA technology, so that the amount of the primer required by the MDA can be effectively amplified. This method also provides good savings in costs associated with LR-PCR.
Preferably, the genomic target region comprises a thalassemia-mutation-related region and/OR F8, DMD, GJB2, PKD1, SMN1, SLC26A4, OR52Z1, OR51V1, BRCA;
preferably, the thalassemia mutation-associated region includes HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, and LUC7L.
In a second aspect, the invention provides a method of sequencing a target region of a genome, the method comprising:
performing targeted enrichment on a genome target region by using the method to obtain an enriched sequence fragment; and
sequencing the enriched fragments.
Preferably, the sequencing can adopt any available sequencing technology such as nanopore sequencing technology, second generation high-throughput sequencing technology and the like.
Preferably, the method further comprises pooling using the enriched sequence fragments, preferably ONT, prior to sequencing. Preferably, the sequencing is minint on-machine sequencing.
According to a specific embodiment of the present invention, preferably, the method further comprises a step of purification using magnetic beads after the library is constructed;
preferably, the magnetic beads are 1 × Beckman AMPure XP magnetic beads.
According to a specific embodiment of the present invention, preferably, the method further comprises the step of connecting the linker after the library construction purification.
According to a specific embodiment of the present invention, preferably, the method further comprises a step of performing purification using 0.4 × XP magnetic beads and Long Fragment Buffer (LFB) after the linker is attached.
Preferably, the genomic target region comprises a thalassemia-mutation-related region and/OR F8, DMD, GJB2, PKD1, SMN1, SLC26A4, OR52Z1, OR51V1, BRCA;
preferably, the thalassemia mutation-associated region includes HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, and LUC7L.
In a third aspect, the invention provides the use of said method for targeted enrichment of sequence fragments of a genomic target region or said method for sequencing a genomic target region for determining the type of genetic mutation, preferably said genetic mutation is a thalassemia mutation, more preferably a pathogenic alpha-thalassemia mutation, a pathogenic beta-thalassemia mutation, a pathogenic delta-thalassemia mutation or a pathogenic delta beta-thalassemia mutation.
In a fourth aspect, the present invention provides a kit for targeting sequence fragments enriched in a target region of a genome, wherein the kit comprises:
an MDA reagent for performing Multiple Displacement Amplification (MDA) of gDNA in a sample to be tested, the MDA reagent comprising a specific MDA primer and a Φ 29DNA polymerase. Preferably, the MDA reagents further comprise a buffer for amplification (buffer).
Preferably, the kit further comprises a second cleavage reagent for a second cleavage of the MDA product, the second cleavage reagent comprising an endonuclease, preferably endonuclease I and/or endonuclease VII.
Preferably, the MDA reagent further comprises: reagents for performing LR-PCR amplification comprising a specific primer set designed and synthesized for a target region of a genome at intervals of 2Kb to 10 Kb; and
a first enzyme cutting reagent used for carrying out the first enzyme cutting on the LR-PCR amplification product.
Preferably, the kit further comprises magnetic beads for DNA purification;
preferably, the magnetic beads are Beckman AMPure XP magnetic beads;
more preferably, the bead ratios are 1.8 ×, 1 × and 0.5 × XP beads.
The fifth aspect of the invention provides the use of said kit for determining the type of genetic mutation, preferably said genetic mutation is a thalassemia mutation, more preferably a pathogenic alpha-thalassemia mutation, a pathogenic beta-thalassemia mutation, a pathogenic delta-thalassemia mutation or a pathogenic delta beta-thalassemia mutation.
The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention should not be construed as limiting the implementable scope of the present invention.
Example 1
This example provides the use of the method of the invention for targeted enrichment of genomic target region fragments in nanopore sequencing.
The experimental protocol is shown in figure 1:
1. LR-PCR specific primers were designed and synthesized: designing primers aiming at a target region of a genome at intervals of 2Kb to 10Kb, and synthesizing to obtain specific primers for LR-PCR;
LR-PCR amplification: using negative gDNA as a template and the specific primer obtained in the step 1) to carry out LR-PCR amplification to obtain an LR-PCR amplification product;
3. fragmentation (first cleavage): mixing LR-PCR amplification products, preferably mixing the products with equal mass, and then carrying out first enzyme digestion to obtain a specific MDA primer of 20bp to 150bp; and
4. multiple Displacement Amplification (MDA): mixing 100ng of gDNA of a sample to be detected, 10ng of specific MDA primer and phi 29DNA polymerase, and performing constant-temperature Multiple Displacement Amplification (MDA) for 6 hours;
5. and performing enzyme digestion for the second time to obtain a target fragment: adding T7 Endonuclease I and/or T4Endonuclease VII to digest the MDA product;
6, establishing a library by ONT and sequencing;
7. and (4) bioinformatics analysis.
The experiment specifically comprises the following steps:
(1) Design and synthesis of PCR specific primers: using Primer3 software to design primers for target regions of the hA gene chr16:60001-120000 at intervals of about 2Kb to 10Kbp, and synthesizing the primers; exemplary partial primers are as follows:
| number of | Name of | Upstream primer sequence |
| SEQ ID NO.1 | HBA_01F | CTTGGAGAACCACTACTCTCTTCAAAGC |
| SEQ ID NO.2 | HBA_02F | GGGATTGCGTTGGAACAGGAATTAAAAG |
| SEQ ID NO.3 | HBA_03F | ACCCTTAGAAGACAGATGCACTCCTAAA |
| SEQ ID NO.4 | HBA_04F | GAAGAGACCACTGAGGACAGACATTCTA |
| SEQ ID NO.5 | HBA_05F | TAGGGGTCTGCTTTCCTCTATGTTTCTT |
| SEQ ID NO.6 | HBA_06F | CCAACATGGCAAAACACCATCTCTACTA |
| SEQ ID NO.7 | HBA_07F | AGACTCTCCAGCTGTTAACATTCTACCA |
| SEQ ID NO.8 | HBA_08F | TCCCATATCGCACAAAGATTGTCACTTC |
| SEQ ID NO.9 | HBA_09F | TCCCATATCGCACAAAGATTGTCACTTC |
| SEQ ID NO.10 | HBA_10F | CCCAGTTAACATACGCTCTCCATCAAAA |
| Numbering | Naming of | Sequence of downstream primer |
| SEQ ID NO.11 | HBA_01R | GGTCTCTTCCCAGAAAGAAACTCACATC |
| SEQ ID NO.12 | HBA_02R | GGCTGTGACGTTCTACAATAAACTGCTA |
| SEQ ID NO.13 | HBA_03R | TGTGTCTCCACCCTAATCTCATCTTGAA |
| SEQ ID NO.14 | HBA_04R | CTGTAAAATGCTCCTGTCAGGAAATGGA |
| SEQ ID NO.15 | HBA_05R | TTAGTAGAGATGGGGTTTTGCCATGTTG |
| SEQ ID NO.16 | HBA_06R | AGTCATCCTTCCTTCTCCATCTTTGTCT |
| SEQ ID NO.17 | HBA_07R | CAGTGCTTTGGATCTTTTCCTGGTGATA |
| SEQ ID NO.18 | HBA_08R | CCTCAGCCCCTATTCTTTGTCTGAAAAG |
| SEQ ID NO.19 | HBA_09R | GGCAGTAGTTGTAGATGTAGCTGTGTTC |
| SEQ ID NO.20 | HBA_10R | GGAGAAAACAGCCTGAGAAATCACTGAT |
(2) LR-PCR amplification: LR-PCR amplification was performed using HBA negative sample gDNA as template and NEB reagent (cat. No.: M0323L) and the specific procedure is shown in Table 1:
TABLE 1
There are several annealing temperatures.
(3) Purifying, quantifying and mixing the LR-PCR product with equal mass;
1) And (3) purification:
a. adding 0.5 multiplied Beckman AMPure XP magnetic beads;
b. standing for 5 minutes at room temperature after uniformly mixing;
c. after the instantaneous separation, the mixture is placed on a magnetic frame for about 5 minutes;
d. after the solution becomes clear, sucking the supernatant, adding 200 microliters of freshly prepared 80% ethanol, and standing for 30 seconds;
e. repeating the previous operation;
f. and discarding the supernatant, and adding 20 microliters of nuclease-free water for elution when the liquid in the tube volatilizes and the magnetic beads crack.
2) And (3) quantification:
a. adding 199 microliters of the Qubit reagent into 1 microliter of a sample to be detected;
b. mixing by vortex, and measuring the concentration after instantaneous dissociation.
3) Mixing by mass: the amplification product is diluted to the same concentration by using nuclease-free water, and mixed by equal mass.
Note: the NGS platform may now be used to perform a homogeneity check on the equal quality pooled samples.
(4) Fragmentation (first cut): performing first enzyme digestion on the mixed sample with equal mass by using ABClone (RK 20260) at 32 ℃ for 45 minutes; in addition, in order to amplify primer amount, an NGS library can be built by using a mixed sample with equal mass, and after the library is enriched, the first enzyme digestion is carried out to be used as a specific MDA primer;
(5) Purifying the 1.8 multiplied Beckman AMPure XP magnetic beads;
(6) Using a 0.2mLEP tube, adding 100ng of gDNA sample to be detected and 10ng of specific MDA primer, placing on ice immediately at 95 ℃ for 5 minutes;
(7) Multiple Displacement Amplification (MDA): adding into the system: MDA buffer 37.5. Mu.L, DNA polymerase (. PHI.29) 2.5. Mu.L; amplifying at constant temperature of 30 ℃ for 6 hours, inactivating at 65 ℃ for 10 minutes, and keeping at 4 ℃;
(8) Purifying 1 XBeckman AMPure XP magnetic beads; the electrophorograms before and after the purification by multiplex displacement amplification are shown in FIG. 2; wherein lanes 2 and 3 are before MDA product purification and lanes 5 and 6 are after MDA product purification;
(9) And (3) second enzyme digestion: adding T7 Endonuclease I and/or T4Endonuclease VII 2 μ L and buffer 4 μ L into the purified system; 25 minutes at 37 ℃;
(10) Purifying with 0.5 × Beckman AMPure XP magnetic bead; the electrophoretogram after purification is shown in FIG. 3;
(11) Establishing a library by the ONT: the system is shown in table 2:
TABLE 2
| Reagent | Volume of |
| DNA CS | 1μl |
| DNA | 47μl |
| NEBNext FFPE DNA repair buffer | 3.5μl |
| NEBNext FFPE DNA repair mixture | 2μl |
| Ultra II End-prep reaction buffer | 3.5μl |
| Ultra II End-prep enzyme mixture | 3μl |
5 minutes at 20 ℃ and 5 minutes at 65 ℃;
(12) Purifying 1 XBeckman AMPure XP magnetic beads;
(13) Connecting a joint: the attachment system is shown in table 3:
TABLE 3
| Reagent | Volume of |
| DNA sample obtained in the previous step | 60μl |
| Ligation Buffer (Ligation Buffer, LNB) | 25μl |
| NEBNext rapid T4 DNA ligase | 10μl |
| Joint compound (Adapter Mix, AMX) | 5μl |
| Total of | 100μl |
Room temperature for 10 minutes;
(14) Purifying 0.4 XBeckman AMPure XP magnetic beads and Long Fragment Buffer (Long Fragment Buffer, LFB);
(15) Eluting with 15 μ L EB;
(16) Miniont's machine sequencing and letter generation analysis.
In this embodiment, a specific primer PCR and Multiple Displacement Amplification (MDA) are combined, a specific primer is used for amplification, a target region gene is screened and amplified, the screened and amplified long-chain target region gene is fragmented into a short chain of 20bp to 150bp, and the short chain is used as a specific MDA primer to perform comprehensive amplification of a specific region by an MDA method. The method improves the identification accuracy of the target region gene, improves the comprehensiveness by adopting MDA, and simultaneously avoids the problem of high cost caused by a large amount of primers required by the MDA method.
Example 2
This example provides the use of the method of the invention for targeted enrichment of genomic target region fragments in nanopore sequencing.
The experimental protocol is shown in figure 4:
1. designing and synthesizing Multiple Displacement Amplification (MDA) specific primers;
2. multiple Displacement Amplification (MDA): mixing 100ng of gDNA of a sample to be detected, 10ng of specific MDA primer and phi 29DNA polymerase, and performing constant-temperature Multiple Displacement Amplification (MDA) for 6 hours;
3. and (3) carrying out enzyme digestion for the second time to obtain a target fragment: adding T7 Endonuclease I and/or T4Endonuclease VII to digest the MDA product;
establishing a library by ONT and sequencing;
5. and (4) bioinformatics analysis.
The experiment specifically comprises the following steps:
(1) Design and synthesis of PCR specific primers: HBA gene and about 1.49Mb region upstream and downstream, specific chromosomal location: 60001-1550640 as chr16, and carrying out specific primer design and synthesis at an interval of 120 bp;
exemplary partial primers are as follows:
(2) Using a 0.2mL EP tube, adding 100ng of gDNA sample to be detected and 10ng of specific MDA primer, placing on ice immediately at 95 ℃ for 5 minutes;
(3) Multiple Displacement Amplification (MDA): adding into the system: MDA buffer 37.5. Mu.L, DNA polymerase (. PHI.29) 2.5. Mu.L; amplifying at 30 ℃ for 6 hours at constant temperature, inactivating at 65 ℃ for 10 minutes, and keeping at 4 ℃; the electrophoretogram of the MDA product is shown in FIG. 5;
(4) Purifying 1 XBeckman AMPure XP magnetic beads;
(5) Enzyme digestion: adding T7 Endonuclease I and/or T4Endonuclease VII 2 μ L and buffer 4 μ L into the purified system; 25 minutes at 37 ℃;
(6) Purifying with 0.5 × Beckman AMPure XP magnetic bead;
(7) Establishing a library by the ONT: the system is shown in table 4:
TABLE 4
| Reagent | Volume of |
| DNA CS | 1μl |
| DNA | 47μl |
| NEBNext FFPE DNA repair buffer | 3.5μl |
| NEBNext FFPE DNA repair mixture | 2μl |
| Ultra II End-prep reaction buffer | 3.5μl |
| Ultra II End-prep enzyme mixture | 3μl |
5 minutes at 20 ℃ and 5 minutes at 65 ℃;
(8) Purifying 1 XBeckman AMPure XP magnetic beads;
(9) Connecting a joint: the attachment system is shown in table 5:
TABLE 5
| Reagent | Volume of |
| DNA sample obtained in the previous step | 60μl |
| Ligation Buffer (Ligation Buffer, LNB) | 25μl |
| NEBNext rapid T4 DNA ligase | 10μl |
| Joint compound (Adapter Mix, AMX) | 5μl |
| Total of | 100μl |
Room temperature for 10 minutes;
(10) Purifying 0.4 × Beckman AMPure XP magnetic bead and Long Fragment Buffer (Long Fragment Buffer, LFB);
(11) Elution with 15. Mu.L EB;
(12) Miniont's machine sequencing and letter generation analysis. Figure 6 shows the NGS sequencing coverage summary results. Figure 7 shows the NGS sequencing depth summary results.
This example combines multiple displacement amplification with specific primers (MDA), where specific primers are synthesized and specific regions are amplified comprehensively by the MDA method. The method improves the identification accuracy of the target region gene, improves the coverage of the target region by adopting MDA, and simultaneously avoids the problem of high cost of whole genome sequencing.
The nanopore sequencing targeted enrichment method can replace a primer synthesis region, is not limited to F8, DMD, GJB2, PKD1, SMN1, SLC26A4, OR52Z1, OR51V1, BRCA, HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBF 1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, LUC7L thalassemia-related regions, comprises chr11: 5167971-52261 (hg 38) and chr16:48994-210817 (hg 38) regions, and can detect at least one kind of pathogenic mutation of alpha-thalassemia-delta-beta thalassemia-related mutations, and at least one kind of pathogenic mutation of pathological mutations related to CHR11: 5167971-60 thalassemia-delta mutation.
This example is based on Oxford Nanopore Technologies (ONT) platform technology for sequencing experiments, but the invention is not limited thereto. The present invention may be applied to a variety of NGS platforms.
It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention, and those skilled in the art will appreciate that various modifications and changes can be made to the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (10)
1. A method of targeted enrichment of genomic target region sequence fragments, the method comprising:
mixing gDNA of a sample to be detected, a specific Multiple Displacement Amplification (MDA) primer and phi 29DNA polymerase, and performing Multiple Displacement Amplification (MDA) to obtain a sequence fragment of an enriched target region.
2. The method of claim 1, wherein the specific MDA primers are primers that are capable of specifically binding to a sequence fragment of a genomic target region; preferably, the specific MDA primer is 20bp to 150bp in length;
preferably, the specific MDA primer is prepared by fragmenting a target gene amplified and enriched product;
further preferably, the fragmenting of the product after target gene amplification enrichment comprises the following steps:
1) Design and synthesis of PCR specific primers: designing primers aiming at target regions of a genome at intervals of 2Kb to 10Kb, and synthesizing to obtain specific primers for LR-PCR;
2) LR-PCR amplification: using negative gDNA as a template and the specific primer obtained in the step 1) to carry out LR-PCR amplification to obtain an LR-PCR amplification product;
3) Fragmenting the LR-PCR amplification product, preferably by enzymatic or mechanical disruption; and optionally
4) NGS pooling and library enrichment was performed using pooled LR-PCR products, followed by fragmentation.
3. The method of claim 1 or 2, wherein the multiplex displacement amplification process comprises:
mixing the gDNA of the sample to be detected and the specific MDA primer according to the mass ratio of 10000-10, keeping the mixture at 90-98 ℃ for 3-10 minutes, and immediately placing the mixture on ice for 5-10 minutes; and
adding amplification buffer solution and phi 29DNA polymerase, performing constant-temperature amplification at 28-32 ℃ for 2-8 hours, keeping at 60-65 ℃ for 5-30 minutes for inactivation, and keeping at 4 ℃;
preferably, the multiplex displacement amplification process comprises: mixing the gDNA of the sample to be detected and the specific MDA primer according to the mass ratio of 10 to 1, immediately placing the mixture on ice for 5 minutes at 95 ℃ for 5 minutes; and
adding amplification buffer solution and phi 29DNA polymerase, performing constant temperature amplification at 30 ℃ for 6 hours, inactivating at 65 ℃ for 10 minutes, and keeping at 4 ℃; and is provided with
Preferably, after the multiple displacement amplification, performing a second enzyme digestion using an endonuclease to obtain an enriched sequence fragment;
preferably, the second enzyme digestion comprises: digesting the multiple displacement amplification product by adding endonuclease I and/or endonuclease VII.
4. The method of any one of claims 1 to 3, wherein the genomic target region comprises a thalassemia mutation-related region and/OR F8, DMD, GJB2, PKD1, SMN1, SLC26A4, OR52Z1, OR51V1, BRCA;
preferably, the thalassemia-mutation-associated region includes HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, and LUC7L.
5. A method of sequencing a genomic target region, the method comprising:
performing targeted enrichment on a genomic target region using the method of any one of claims 1 to 4, resulting in an enriched sequence fragment; and
sequencing the enriched sequence fragments.
6. The method according to claim 5, wherein the method further comprises using the enriched sequence fragments for pooling, preferably ONT pooling, followed by sequencing;
preferably, the genomic target region comprises a thalassemia-mutation-related region and/OR F8, DMD, GJB2, PKD1, SMN1, SLC26A4, OR52Z1, OR51V1, BRCA;
preferably, the thalassemia mutation-associated region includes HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, and LUC7L.
7. A kit for targeting sequence fragments that enrich for a target region of a genome, wherein the kit comprises:
an MDA reagent for performing Multiple Displacement Amplification (MDA) of gDNA in a sample to be tested, the MDA reagent comprising a specific MDA primer and a Φ 29DNA polymerase.
8. The kit according to claim 7, wherein the kit further comprises a reagent for a second enzymatic cleavage of the MDA product, said second enzymatic cleavage reagent comprising endonuclease I and/or endonuclease VII.
9. The kit of claim 7 or 8, wherein the kit further comprises: reagents for performing LR-PCR amplification comprising a specific primer set designed and synthesized for a target region of a genome at intervals of 2Kb to 10 Kb; and
a first enzyme cutting reagent for fragmenting an LR-PCR amplification product.
10. Use of the method of claims 1 to 6 and/or the kit of any one of claims 7 to 9 for determining the type of genetic mutation, preferably the genetic mutation is a thalassemia mutation, more preferably a pathogenic alpha-thalassemia mutation, a pathogenic beta-thalassemia mutation, a pathogenic delta-thalassemia mutation or a pathogenic delta beta-thalassemia mutation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211621887.7A CN115960989A (en) | 2022-12-16 | 2022-12-16 | Method and kit for targeted enrichment of genome target region sequence fragments and application of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211621887.7A CN115960989A (en) | 2022-12-16 | 2022-12-16 | Method and kit for targeted enrichment of genome target region sequence fragments and application of kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115960989A true CN115960989A (en) | 2023-04-14 |
Family
ID=87353739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211621887.7A Pending CN115960989A (en) | 2022-12-16 | 2022-12-16 | Method and kit for targeted enrichment of genome target region sequence fragments and application of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115960989A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676532A (en) * | 2011-03-17 | 2012-09-19 | 北京贝瑞和康生物技术有限公司 | Method for rearranging immunoglobulin and producing antibody through MDA-PCR (Multiple Displacement Amplification-Polymerase Chain Reaction) enriched genome |
| CN108350488A (en) * | 2015-08-17 | 2018-07-31 | 加利福尼亚大学董事会 | Multiple displacement amplification (MDA) method based on droplet and compositions related |
-
2022
- 2022-12-16 CN CN202211621887.7A patent/CN115960989A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676532A (en) * | 2011-03-17 | 2012-09-19 | 北京贝瑞和康生物技术有限公司 | Method for rearranging immunoglobulin and producing antibody through MDA-PCR (Multiple Displacement Amplification-Polymerase Chain Reaction) enriched genome |
| CN108350488A (en) * | 2015-08-17 | 2018-07-31 | 加利福尼亚大学董事会 | Multiple displacement amplification (MDA) method based on droplet and compositions related |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230250476A1 (en) | Deep Sequencing Profiling of Tumors | |
| JP7033602B2 (en) | Barcoded DNA for long range sequencing | |
| CN113444770B (en) | Construction method and application of single-cell transcriptome sequencing library | |
| TW201321518A (en) | Method of micro-scale nucleic acid library construction and application thereof | |
| CN110886021B (en) | Construction method of single-cell DNA library | |
| CN108517567B (en) | Adaptor, primer group, kit and library construction method for cfDNA library construction | |
| CN113088562A (en) | Novel low-initial-quantity DNA methylation library building method | |
| CN111575348A (en) | Metagenome library, and library construction method and application thereof | |
| CN111748637A (en) | SNP molecular marker combination, multiplex composite amplification primer set, kit and method for genetic relationship analysis and identification | |
| CN116083529B (en) | Method for targeted enrichment of DNA of genome target region and application thereof | |
| CN115960989A (en) | Method and kit for targeted enrichment of genome target region sequence fragments and application of kit | |
| WO2020259303A1 (en) | Method for rapid construction of rna 3'-end gene expression library | |
| CN106222164B (en) | Methods, compositions and kits for unidirectional amplification of nucleic acids in vitro using transposase | |
| CN112912514A (en) | Barcoding of nucleic acids | |
| US20200208198A1 (en) | Methods of assaying nucleic acids of low quantities using a buffer nucleic acid | |
| US11268087B2 (en) | Isolation and immobilization of nucleic acids and uses thereof | |
| CN117757895A (en) | Single-stranded DNA library construction kit and application thereof | |
| WO2023025784A1 (en) | Optimised set of oligonucleotides for bulk rna barcoding and sequencing | |
| CN114507903A (en) | Plasmid sequencing method | |
| KR20240032631A (en) | Highly sensitive methods for accurate parallel quantification of variant nucleic acids | |
| CN116426618A (en) | Method for simultaneously detecting DNA genetic markers and RNA molecular markers for forensic identification | |
| KR20240032630A (en) | Methods for accurate parallel detection and quantification of nucleic acids | |
| WO2023086818A1 (en) | Target enrichment and quantification utilizing isothermally linear-amplified probes | |
| CN117778547A (en) | SNP (Single nucleotide polymorphism) typing detection probe and application thereof | |
| CN117222737A (en) | Methods and compositions for sequencing library preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |