CN115960224A

CN115960224A - Preparation method and application of rabbit anti-mouse Ccdc189 polyclonal antibody

Info

Publication number: CN115960224A
Application number: CN202211046613.XA
Authority: CN
Inventors: 郑英; 周慧萍; 杨哲; 牛长敏
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2022-08-30
Filing date: 2022-08-30
Publication date: 2023-04-14

Abstract

The invention discloses a preparation method of a rabbit anti-mouse Ccdc189 polyclonal antibody, which comprises the steps of firstly constructing prokaryotic protein expression recombinant plasmids, taking Ccdc189 eukaryotic expression plasmids as a template, carrying out PCR amplification by using primers, connecting amplification products with pGEM-T-Easy vectors, transforming connecting products into escherichia coli to obtain pGEM-T-Easy-Ccdc189 plasmids, connecting pET-28a (+) plasmids after enzyme digestion, and transforming the escherichia coli to obtain pET-28a-Ccdc189 recombinant plasmids; then carrying out induced expression and purification of prokaryotic protein, transferring the pET-28 a-Cdc 189 recombinant plasmid into competent cells, and carrying out induced purification to obtain Cdc189 protein; and finally, preparing the Ccdc polyclonal antibody, taking the Ccdc189 protein as immunogen, and immunizing the rabbit to obtain the rabbit anti-mouse Ccdc polyclonal antibody.

Description

Preparation method and application of rabbit anti-mouse Ccdc189 polyclonal antibody

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a preparation method and application of a rabbit anti-mouse Ccdc189 polyclonal antibody.

Background

The CCDC (conjugated-domain conjugation, CCDC) protein family is understood to be a protein supersecondary structure formed by the intertwining of 2-7 alpha helices. CCDC protein is widely expressed in tissues, the cellular location of the CCDC protein is diversified, and therefore the CCDC protein participates in various physiological processes of organisms, and researches show that abnormal CCDC gene expression can influence the level of cell growth factors and various processes such as gametogenesis, embryonic development, hematopoiesis, angiogenesis, cilium development and the like. The Ccdc189 protein is a member of the Ccdc protein family, a sperm tail-associated protein, and is located primarily in the major segment and acrosomal region of mature sperm. Research has shown that Ccc-189 gene mutation is related to northern Europe red milk cow weak sperm disease, and Ccc-189 gene mutation can cause bull testicular mitochondrial dysfunction, loss of sperm flagellum movement and generation of male sterility phenotype. The Cdc189 protein is specifically and highly expressed in testis tissues, and male mice are sterile due to gene knockout, but the specific action and molecular mechanism are not clarified. However, it is not known whether Ccdc189 plays an important role in humans and mice, and the molecular mechanism of its action stage and regulation in the male reproductive system has not been reported yet. Therefore, the function and the generating mechanism of the Cdc189 are deeply explored, which is helpful for providing a new theoretical basis and practical reference value for the diagnosis and treatment of male infertility.

To explore the function of Ccdc189, functional analysis and mechanism of action thereof should be studied. Through search, no commercial anti-mouse Ccdc189 antibody is found for sale at present, and through literature search, no literature report about polyclonal and monoclonal antibody preparation of the anti-mouse Ccdc189 is found.

In order to research the function of the Cdc189 and research the specific action and molecular mechanism of the Cdc189 in the spermatogenesis process, a Cdc189 polyclonal antibody is needed urgently.

Disclosure of Invention

The invention provides a preparation method and application of a rabbit anti-mouse Ccdc189 polyclonal antibody aiming at solving the technical problems and overcoming the defects of the prior art.

An object of the present invention is to provide a method for producing a rabbit anti-mouse Ccdc189 polyclonal antibody, comprising the steps of:

construction of S1, ccdc189 prokaryotic protein expression recombinant plasmid

Designing a pair of Ccdc189 gene open reading frame full-length sequence specific primers, carrying out PCR amplification by using Ccdc189 gene open reading frame full-length sequence specific primers as a template, recovering PCR amplification products by using glue, connecting the PCR amplification products with pGEM-T-Easy vectors, converting the connection products into escherichia coli competent cells, culturing to obtain pGEM-T-Easy-Ccdc189 plasmids, carrying out enzyme digestion on pGEM-T-Easy-Ccdc189 plasmids and pET-28a (+) plasmids respectively, recovering the glue, obtaining Ccdc189 target fragments and pET-28a expression vectors, connecting the Ccdc target fragments with the pET-28a expression vectors, converting the Ccdc target fragments and the pET-28a expression vectors into the escherichia coli competent cells, and culturing to obtain pET-28a-Ccdc189 recombinant plasmids;

induced expression and purification of S2, ccdc189 prokaryotic protein

Transferring the pET-28 a-Cdc 189 recombinant plasmid into E.coli BL21 competent cells, carrying out induction culture, carrying out centrifugal collection on thalli, carrying out heavy suspension, cracking and centrifugal washing on the thalli to obtain Cdc189 prokaryotic protein, purifying the Cdc189 prokaryotic protein through an Ni-NTA affinity chromatography column, and eluting by using an imidazole eluent to obtain Cdc189 purified protein;

preparation of S3, ccdc189 polyclonal antibody

And (3) immunizing a rabbit by using the Ccdc189 purified protein as an immunogen, collecting rabbit antiserum, and purifying to obtain the rabbit anti-mouse Ccdc189 polyclonal antibody.

The invention firstly constructs pET28a-Ccdc189 recombinant plasmid by using a molecular cloning method, induces and expresses Ccdc189 protein in escherichia coli, and immunizes the purified Ccdc189 prokaryotic protein to a New Zealand white rabbit so as to obtain the Ccdc189 polyclonal antibody. Western Blot and immunofluorescence analysis are carried out on mouse testis tissues and human testis tissues by using the prepared Ccdc189 polyclonal antibody, and the result shows that the antibody can specifically recognize Ccdc189 protein in the mouse testis tissues and the human testis tissues. The invention provides a beneficial tool and technical support for researching the function of the Cdc189, and simultaneously, the invention is also possible to provide a new target for the diagnosis and treatment of clinical male infertility.

The further optimized technical scheme of the invention is as follows:

the invention preferably adopts Cdc189 variant spliceosome 1 (NM _ 001033040) Gene open reading frame full-length sequence design primers, adopts specific enzyme cutting sites EcoRI and HindIII, and adopts Gene Runner software to design Cdc189 open reading frame full-length sequence specific primers, wherein the forward primers comprise: 5 'GGGAATTCATGATTTACCCCAGTTCCAG-3', reverse primer: 5 'GGAAGCTTGCTTGGTCTTGGTCTTGCC-3'.

The nucleotide sequence of the Cdc189 variant spliceosome 1 gene open reading frame is shown as SEQ ID NO. 3. The expressed prokaryotic protein is Cdc189 variant spliceosome 1 coding full-length protein (NP _ 001028212), and the amino acid sequence of the prokaryotic protein is shown as SEQ ID NO. 4.

In the step S1, the PCR reaction conditions are: 95 ℃ for 5min; 35 cycles of 95 ℃ for 30s, 60 ℃ for 45s and 72 ℃ for 62 s; preserving the PCR amplification product at 72 ℃ for 10min and 4 ℃;

the specific construction method of the Ccdc189 prokaryotic protein expression recombinant plasmid comprises the following steps: separating PCR amplification products by agarose gel electrophoresis, cutting and purifying, connecting the purified PCR products with a pGEM-T-Easy carrier by T4-DNA ligase, reacting overnight at 16 ℃, and coating the competent cells of escherichia coli JM109, IPTG and X-gal on an ampicillin-resistant LB solid culture plate after the connecting products are transformed; selecting a white monoclonal colony, shaking the colony to extract plasmids, carrying out enzyme digestion in a water bath by using restriction enzyme EcoRI, detecting enzyme digestion products by agarose gel electrophoresis, and carrying out sequencing identification on the successfully connected pGEM-T-Easy-Ccdc189 recombinant plasmids; carrying out enzyme digestion on pGEM-T-Easy-Cdc 189 plasmid and pET-28a (+) plasmid which are correctly sequenced by using restriction enzymes EcoRI and Hind III, carrying out agarose gel electrophoresis separation and recovering enzyme digestion products, connecting a recovered Cdc189 target fragment with the pET-28a expression vector, transforming Escherichia coli JM109 competent cells, and coating the competent cells on an LB solid plate with kanamycin resistance for culture; and selecting a monoclonal colony, and determining that the pET-28a-Ccdc189 recombinant plasmid is successfully constructed through double enzyme digestion identification by restriction enzymes EcoRI and Hind III.

In the step S2, the specific method for Cdc189 prokaryotic protein induction expression is as follows:

transforming E.coli BL21 competent cells by pET-28a-Ccdc189 recombinant plasmids, culturing on an LB solid culture medium with kanamycin resistance, selecting a positive monoclonal bacterial colony, placing the bacterial colony in an LB liquid with kanamycin resistance, culturing overnight, adding the bacterial liquid cultured overnight into the LB liquid with kanamycin resistance, culturing for a period of time, taking the bacterial liquid into a test tube, adding an inducer IPTG (isopropyl-beta-thiogalactoside) for prokaryotic induction expression, centrifugally collecting the bacterial body, adding a heavy suspension buffer solution for full heavy suspension, adding a bacterial lysate for cracking, ultrasonically centrifuging the cracked bacterial liquid, collecting precipitates, washing by using a washing solution, dissolving in a urea solution, standing overnight, and centrifugally collecting a supernatant;

the specific method for purifying the Cdc189 prokaryotic protein comprises the following steps: and (3) passing the supernatant through a Ni-NTA affinity chromatography column, eluting the chromatography column by adopting an imidazole solution, then filling the eluent into a treated dialysis bag, putting the dialysis bag into 7M, 6M, 5M, 4M, 3M and 2M urea solutions for gradient renaturation, and collecting the renatured protein solution.

In the step S3, the method for preparing the Ccdc189 polyclonal antibody includes: taking the Cdc189 prokaryotic protein after renaturation as immunogen to immunize adult male New Zealand white rabbits, mixing the Cdc189 prokaryotic protein after renaturation with Freund's complete adjuvant in equal volume in the first immunization, emulsifying on ice, injecting subcutaneously and multiply in the back to immunize adult New Zealand white rabbits, then mixing the Cdc189 prokaryotic protein after renaturation with Freund's incomplete adjuvant in equal volume, immunizing 1 time every 2 weeks, and immunizing 5 times.

The invention aims to provide a rabbit anti-mouse Cdc189 polyclonal antibody, wherein the amino acid sequence of the antigen is shown in SEQ ID NO.4, and the polyclonal antibody provides possibility for deeply researching the function and molecular mechanism of the Cdc189 protein.

The method can be used for repeatedly preparing the polyclonal antibody, and the antibody titers of different experimental groups can fluctuate due to individual differences of experimental animals, but the method can be used for Western Blot, ELISA, immune tissue fluorescence analysis and the like. It is recommended to immunize 5 experimental rabbits simultaneously to prepare antibodies.

The invention also aims to provide application of the rabbit anti-mouse Ccdc189 polyclonal antibody in researching the function and action mechanism of the Ccdc189 protein.

The application of the rabbit anti-mouse Cdc189 polyclonal antibody in research on functions and action mechanisms of Cdc protein specifically comprises enzyme-linked immunosorbent assay (ELISA), immunoblotting test (Western Blot), immunofluorescence analysis and immunohistochemical analysis.

The rabbit anti-mouse Ccdc189 polyclonal antibody provided by the invention can specifically recognize Ccdc189 protein in mouse and human tissues, can be applied to analysis of mouse and human multiple tissues such as ELISA, western Blot, immunofluorescence, immunohistochemistry and the like, and has the characteristics of high specificity, wide application range and the like.

The invention has the following beneficial effects: the preparation method adopts molecular biology and genetic engineering methods to construct a recombinant expression vector of the Cdc189 gene, induction expression and affinity chromatography are carried out to obtain purified prokaryotic expression protein, and the prepared Cdc189 polyclonal antibody has strong specificity, can be used for technologies such as enzyme-linked immunosorbent assay, immunoblotting test, immunofluorescence analysis, immunohistochemical analysis and the like, and provides an important tool for further researching the function of the Cdc protein.

According to the invention, the Cdc189 gene full-length open reading frame sequence is used for expression of prokaryotic protein, the Cdc189 prokaryotic protein with high purity is obtained after purification, renaturation and concentration, the protein mixed adjuvant is used for immunizing adult male New Zealand white rabbits, and after 5 times of immunization, the titer of the obtained anti-mouse Cdc189 polyclonal antibody reaches 1 ⁶ The polyclonal antibody prepared by the antibody preparation method is remarkably superior to the polyclonal antibody prepared by using Cdc189 short fragment polypeptide as immunogen in performance.

The anti-mouse Cdc189 polyclonal antibody provided by the invention has a wide application range, can effectively identify the Cdc189 protein in mouse and human testicular tissues, can be used for technical analysis of the Cdc189 protein such as ELISA, western Blot and immunofluorescence, and has more application fields to be verified.

The polyclonal antibody provided by the invention provides powerful technical support for researching the function and action mechanism of the mouse Ccdc 189.

Drawings

FIG. 1 is a schematic diagram showing the results of enzyme digestion identification analysis after the pET-28a-Ccdc189 recombinant plasmid is successfully constructed. In the figure: m represents DNA marker; a represents the enzyme digestion identification result of pGEM-T-Easy-Ccdc189 recombinant plasmid EcoR 1; b represents the result of double enzyme digestion identification of the recombinant plasmid EcoR1 and HindIII of pET-28a-Ccdc 189.

FIG. 2 is a schematic diagram showing the result of SDS-PAGE analysis of Cdc189 prokaryotic protein successfully induced expression. In the figure: m represents protein marker; IPTG-represents IPTG-uninduced E.coli; IPTG + represents E.coli after IPTG induction; IPTG-precipitation represents the ultrasonic precipitation of IPTG-uninduced Escherichia coli; IPTG-supernatant means IPTG uninduced ultrasonic supernatant of Escherichia coli; IPTG + I precipitation represents IPTG induced first ultrasonic precipitation of Escherichia coli; the IPTG + I supernatant represents the IPTG induced first ultrasonic supernatant of the escherichia coli; IPTG + II precipitation represents the second ultrasonic precipitation of IPTG-induced Escherichia coli; IPTG + II supernatant represents the IPTG induced second sonication of the E.coli supernatant.

FIG. 3 is a diagram showing the result of analyzing Ccdc189 prokaryotic protein enrichment and purification by SDS-PAGE in the present invention. In the figure: m represents protein marker;1 represents a Cdc189 prokaryotic protein solution; 2 represents 0mmol/L imidazole eluent; 3 represents 25mmol/L imidazole eluent; 4 represents 50mmol/L imidazole eluent; 5 represents 100mmol/L imidazole eluent; 6 represents 200mmol/L imidazole eluent.

FIG. 4 shows that the titers of the CCdc189 polyclonal antibodies detected by ELISA in the invention all reach 1 ⁶ Schematic diagram of the absorbance of the polyclonal antibody of (1). In the figure: 1-5 show the antiserum numbers obtained after immunization of male New Zealand white rabbits with Cdc189 renaturation protein.

FIG. 5 is a schematic diagram of Western Blot analysis of the Cdc189 protein specifically recognized by the Cdc189 polyclonal antibody in wild type mouse testis tissue. In the figure: HOM represents the Cdc189 gene knockout homozygote mouse testis tissue; WT means adult wild type mouse testicular tissue.

FIG. 6 is a schematic diagram of cellular immunofluorescence analysis that the Cdc189 polyclonal antibody can specifically identify and locate the Cdc189 protein in human and wild mouse testis tissues. In the figure: a indicates Ccdc189 protein localization in wild type mouse testis tissue, bar =100um; b indicates the localization of Ccdc189 protein in wild type mouse testicular tissue, bar =50um; c indicates the localization of Ccdc189 protein in human testicular tissue, bar =100um; d indicates the localization of Ccdc189 protein in human testicular tissue, bar =50um.

Detailed Description

The technical scheme of the invention is further explained in detail by combining the embodiment as follows: the present embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation manner and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

The sources of reagents and materials involved in the examples are as follows: coli JM109 and e.colibl21 (DE 3) competent cells were prepared and stored by research in gynaecological and reproductive medicine of the medical college of the university of promiscuous, and could be released to the public for free or for compensation; the pET-28a (+) expression vector was purchased from Clontech; alexaFluo 555-labeled donkey anti-rabbit IgG was purchased from seimer feishell science and technology (china) ltd; pGEM-T-Easy kit was purchased from Progema; restriction enzymes EcoRI, hindIII, high fidelity Taq DNA polymerase and T4 DNA ligase were purchased from TaKaRa company; freund complete adjuvant and Freund incomplete adjuvant were purchased from Sigma; ni-NTA affinity chromatography resin was purchased from Shanghai Share Biotech, inc.; horseradish peroxidase (HRP) -labeled goat anti-rabbit IgG was purchased from sequoia cunninghamiana sekino biotechnology limited, beijing; dithiothreitol (DTT), tetramethylbenzidine (TMB) developing solution, bovine Serum Albumin (BSA) and 4',6-diamidino-2-phenylindole (4', 6-diamidino-2-phenylindole, DAPI), isopropyl-beta-D-thiogalactopyranoside (Isopropyl beta-D-1-thiogalactopyranoside, IPTG) 5-bromo-4-chloro-3-indole-beta-D-galactoside (5-bromo-4-chloro-3-indolylbeta-D-galactopyranoside, X-gal), ethylenediaminetetraacetic acid (EDTA), tris (hydroxymethyl) aminomethane (Tris-HCL), triton-X-100, imidazole, lysozyme, available from Beijing SovizScience and technology limited; bicinchoninic acid (BCA) protein quantification kit, dnase I deoxyribonuclease I purchased from beijing kang, century biotechnology limited; the hypersensitivity ECL chemiluminescence kit is purchased from Shanghai Xinsai and Biotech limited. C57BL/6 mice purchased from Jackson laboratories, ccdc189 ^-/- The knockout mice were purchased from race biotechnology, ltd, and adult male new zealand white rabbits were purchased from ameri biotechnology, ltd.

In addition to the biological materials and reagents specifically mentioned above, the other materials and reagents mentioned in the present invention are commercially available and commercially available to the public at home and abroad, and will not be described one by one here.

In the present invention, "%" is a volume percentage.

Example 1

(1) Construction of prokaryotic protein expression recombinant plasmid pET-28a-Ccdc189

A specific primer of a full-length sequence of a Cdc189 open reading frame is designed by using Gene Runner software, wherein the nucleotide sequence of the Cdc189 variant spliceosome 1 Gene open reading frame is shown as SEQ ID NO. 3. The nucleotide sequence of the forward primer is shown as SEQ ID NO.1, and the specific sequence is as follows:

5 'GGGAATTCATGATTTACCCCAGTTCCAG-3', the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2, and the specific sequence is as follows:

5'-GGAAGCTTGCTTGGTCTTGGTCTTGCC-3'. PCR amplification was performed using Cdc189 eukaryotic expression plasmid as template and Cdc189 specific primers.

The PCR reaction conditions are as follows: 95 ℃ for 5min; 35 cycles of 95 ℃ for 30s, 60 ℃ for 45s and 72 ℃ for 62 s; the PCR amplification product was stored at 72 ℃ for 10min and 4 ℃. Separating PCR amplification product by 12g/L agarose gel electrophoresis, cutting gel and purifying, connecting the purified PCR product with pGEM-T-Easy vector by using T4-DNA ligase, and reacting overnight at 16 ℃. The ligation products were transformed into competent cells of Escherichia coli JM109, and plated on ampicillin-resistant LB solid plates (ampicillin concentration 100. Mu.g/ml) together with IPTG (isopropyl-. Beta. -D-thiogalactopyranoside), X-gal (5-bromo-4-chloro-3-indol-. Beta. -D-galactoside). White monoclonal colonies are selected by using a blue-white spot screening principle, plasmids are extracted by shaking, restriction enzyme EcoRI is used for enzyme digestion in water bath at 37 ℃ for 4 hours, and the enzyme digestion products are detected by 12g/L agarose gel electrophoresis. Sequencing and identifying the pGEM-T-Easy-Ccdc189 recombinant plasmid which is successfully connected.

The correctly sequenced pGEM-T-Easy-Ccdc189 plasmid was digested with pET-28a (+) plasmid using restriction enzymes EcoRI and Hind III, the digested product was separated and recovered by 12g/L agarose gel electrophoresis, the target fragment of Ccdc189 and pET-28a expression vector were ligated, transformed into competent cells of Escherichia coli JM109, and plated on kanamycin-resistant LB solid plates (kanamycin concentration in LB solid plates was 100. Mu.g/ml). A single clone colony is selected, and the success construction of the pET-28a-Ccdc189 recombinant plasmid is determined through double enzyme digestion identification of restriction enzymes EcoRI and Hind III, and the result is shown in figure 1.

(2) Induced expression of Ccdc189 prokaryotic protein

E.coli BL21 competent cells were transformed with the pET-28a-Ccdc189 recombinant plasmid and cultured on a kanamycin-resistant LB solid medium. Positive monoclonal colonies were selected and cultured overnight in 5mL of LB solution resistant to kanamycin (kanamycin concentration in LB solution is 100. Mu.g/mL) at 37 ℃ at 225 r/min. The next day, the overnight suspension was added to 500mL of LB solution resistant to kanamycin, incubated at 37 ℃ at 225r/min for 3 hours. Taking 1mL of bacterial liquid in a test tube as a negative control, adding an inducer IPTG into the rest bacterial liquid until the final concentration is 1mmol/L,37 ℃,225r/min, and inducing for 4h. SDS-PAGE detects negative control and induced bacteria liquid, judges whether the prokaryotic protein is expressed or not, and the result is shown in figure 2.

After induction, the cells were collected by centrifugation of E.coli expressing the protein, and then 60mL of a resuspension buffer (50 mmol/L Tris-HCl, 1mmol/L EDTA, 250mL/L sucrose, 10mmol/L DTT, pH = 8.0) was added to the cells to thereby effect complete resuspension. After resuspension, 4.2mL of bacterial lysate (1 mg/mL lysozyme, 5mmol/L MgCl) was added ₂ 0.05mg/mL DNaseI, 10mL/L TritonX-100, 10mmol/mL DTT), 4 ℃, and performing half-speed rotary lysis for 30min by using a magnetic stirrer. Placing the cracked bacteria solution on ice for intermittent ultrasonic treatment for 3 times, and collecting supernatant andthe precipitate was examined by SDS-PAGE. The staining results show that the Ccdc189 prokaryotic protein is mainly in the form of inclusion bodies in the pellet. The precipitate was washed with 15mL of washing solution (50 mmol/L Tris-HCl, 100mmol/L NaCl, 1mmol/L EDTA, 10mmol/mL DTT, pH = 8.0), and finally dissolved in 10mL of 8mol/L urea at 4 ℃ overnight. The next day, the supernatant was collected by centrifugation.

In the above description, DNaseI was DNAseI (from Samerfei) and TritonX-100 was Polyethyleneglycol octylphenyl ether (from Samerfei).

(3) purification of prokaryotic protein pET-28a-Ccdc189

Because the recombinant protein is provided with the His label, an affinity chromatography column which can adsorb the His label is used for purifying supernatant containing the Cdc189 recombinant protein, and then the column is washed by imidazole solutions with different concentrations respectively by utilizing the principle that the imidazole and the His label have similar properties so that target protein can be competitively eluted. And (3) passing the supernatant through a Ni-NTA affinity chromatographic column, and then eluting the chromatographic column by using 25, 50, 100 and 200mmol/L imidazole respectively, wherein SDS-PAGE results show that the elution efficiency of the original nucleoprotein in the imidazole eluate of 50mmol/L and 100mmol/L is highest and the purity is higher (see figure 3). And (3) filling the eluent with the highest purification efficiency into a treated dialysis bag, respectively putting the dialysis bag into 7M, 6M, 5M, 4M, 3M and 2M urea solutions for gradient renaturation, collecting the renatured protein solution, and measuring the concentration of the renatured protein solution to be 2.77mg/ml by using a BCA method. The amino acid sequence of the protein coded by Ccdc189 is shown in SEQ ID NO. 4.

(4) Preparation of Ccdc189 polyclonal antibody

5 adult male New Zealand white rabbits are immunized by taking the Ccc dc189 prokaryotic protein after renaturation as an immunogen. In the primary immunization, the renatured Cdc189 prokaryotic protein is mixed with an equal volume of Freund's complete adjuvant, emulsified on ice and injected into adult New Zealand white rabbits (200 mug/rabbit) by multiple points at the back under the skin. Thereafter, freund's complete adjuvant was replaced with incomplete adjuvant and mixed with the renatured Cdc189 prokaryotic protein in equal volume, and immunized 1 time every 2 weeks for 5 times. After the last immunization, rabbit ear marginal venous blood serum is taken to detect the antibody titer.

(5) ELISA (enzyme-Linked immunosorbent assay) detection of Ccdc189 polyclonal antibody titer

The purified Cdc189 prokaryotic protein is diluted to 8ug/mL, 100 microliter of 96-well enzyme label plate is added into each well for coating, and the mixture is put into a wet box and stays overnight at 4 ℃. The next day, the plate was cleared of liquid and washed 5min × 3 times with PBS-T solution (Prussel). Then adding PBS-T solution containing 1g/L skimmed milk powder, and blocking at 37 ℃ for 1h. Remove the blocking solution, snap dry, wash 5min x 3 times with PBS-T solution. Adding a diluent with the dilution ratio of 1:10 to 1: 1000000 anti-Ccdc 189 serum and normal rabbit serum were incubated at 37 ℃ for 90min. Wash 5min X3 times with PBS-T solution. mu.L of HRP-labeled goat anti-rabbit IgG (1 diluted 2000) was added to each well and incubated at 37 ℃ for 40min. The secondary antibody was removed and washed 5min X3 times with PBS-T solution. Adding 100 mu L of TMB color development solution into each hole, reacting for 10min at room temperature in a dark place, and adding 100 mu L of stop solution into each hole to terminate the reaction. The absorbance value of each hole at 490nm of the wavelength is measured by an enzyme-labeling instrument, the result is shown in figure 4,5 immunized New Zealand white rabbit serums have immunity, and the antibody titer can reach 1 ⁶ 。

(6) Testis tissue Western Blot analysis using Ccdc189 polyclonal antibody

Taking the total testis protein of an adult Ccdc189 gene knockout Homozygote (HOM) mouse and a Wild Type (WT) mouse, respectively, uniformly mixing with a loading protein buffer solution, carrying out boiling water bath for 10min, carrying out ice bath for 5min, and carrying out SDS-PAGE. After electrophoresis, the protein was transferred electrically to a PVDF membrane and blocked with 50g/L skimmed milk powder in TBS solution (MCE China) for 2h at room temperature. Ccdc189 antiserum (1: 2000 dilution) was added and incubated overnight at 4 ℃. The next day, the membranes were washed with TBST solution (shamier fly) for 10min × 3 times, HRP-labeled goat anti-rabbit IgG (1 diluted 2000) was added, and incubated at room temperature for 1h; TBST washing membrane 10min x 3 times. When the antibody is developed by using an ECL developing kit (Beijing Oddai) in a Tanon-2500 chemiluminescence imaging system, the result is shown in figure 5, the prepared rabbit anti-mouse Ccddc 189 polyclonal antibody can specifically recognize endogenous Ccddc 189 protein in a wild mouse testis, and the Ccddc 189 protein is not detected in a Ccddc 189 gene knockout mouse.

(7) Application of Ccdc189 polyclonal antibody to testis tissue and sperm cell immunofluorescence analysis

Taking paraffin sections of human testicular tissues and adult mouse testicular tissues, carrying out conventional dewaxing hydration on mouse spermocyte smears, placing the slices in a sealing solution (formula: 63mL of methanol and 7mL of hydrogen peroxide), and carrying out water bath at 37 ℃ for 10min to remove endogenous peroxidase. Washing with PBS solution (Saimeifei) for 5min × 3 times, placing in citrate buffer (pH =6.0, saimeifei), repairing with microwave oven on high fire for 2.5min and low fire for 7.5min, and naturally cooling at room temperature. PBS solution washing 5min x 3 times, 10g/L BSA (Sammerfet) room temperature blocking 1h. Rabbit anti-Ccdc 189 polyclonal antibody (1. The next day, the sections were incubated at 37 ℃ for 30min. PBS solution washing 5min x 3 times. AlexaFluor 555-labeled donkey anti-rabbit IgG (diluted 1: 1000) was added and incubated at room temperature for 1h in the dark. PBS solution washing 5min x 3 times. DAPI (4', 6-diamidino-2-phenylindole, saimer fly) was stained for 10min at room temperature in the dark, and washed 5min X3 times with PBS solution. The glycerol is sealed, the cells are observed and photographed under an upright fluorescence microscope, the result is shown in figure 6, the Ccdc189 protein is positioned in spermatogenic cells at all levels of human and wild mouse testicular spermatogenic tubules, no fluorescence signal is observed in a Ccdc189 gene knockout mouse, meanwhile, no positive signal is observed in a control group which takes normal rabbit serum as a negative control group, and the rabbit anti-mouse Ccdc189 polyclonal antibody prepared by the method can specifically recognize endogenous Ccdc189 protein in testicular tissues.

According to the invention, pET28 a-Cdc 189 prokaryotic protein expression recombinant plasmid is constructed, mouse Cdc189 prokaryotic protein with His label is induced and expressed in escherichia coli, the Cdc189 prokaryotic protein is purified by using a Ni-NTA affinity chromatography column and renaturated and concentrated to immunize white rabbits in New Zealand, immune rabbit serum is collected to detect antibody titer and is applied and analyzed, and under the same condition, the antibody preparation method disclosed by the invention is superior to polyclonal antibody generated by using mouse Cdc189 carboxyl terminal polypeptide as immunogen.

The above description is only an embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can understand that the modifications or substitutions should be included in the scope of the present invention, and therefore, the scope of the present invention should be subject to the protection scope of the claims.

Claims

1. A preparation method of a rabbit anti-mouse Ccdc189 polyclonal antibody is characterized by comprising the following steps:

construction of S1, ccdc189 prokaryotic protein expression recombinant plasmid

induced expression and purification of S2, ccdc189 prokaryotic protein

preparation of S3, ccdc189 polyclonal antibody

2. The rabbit anti-mouse Ccdc189 polyclonal antibody prepared by the method of claim 1, wherein the amino acid sequence of the antigen is shown in SEQ ID NO. 4.

3. The application of the rabbit anti-mouse Cdc189 polyclonal antibody as claimed in claim 2 in the research of the function and action mechanism of Cdc protein.

4. Use according to claim 3, characterized in that: the method comprises enzyme-linked immunosorbent assay, immunoblotting test, immunofluorescence analysis and immunohistochemical analysis.

5. The method for preparing the rabbit anti-mouse Ccdc189 polyclonal antibody according to claim 1, wherein the rabbit anti-mouse Ccdc189 polyclonal antibody comprises the following steps: the specific primers of the Ccc dc189 gene open reading frame full-length sequence comprise a forward primer with a sequence of GGGAATTCATGATTACCCCCCCAGTTCCAG and a reverse primer with a sequence of GGAAGCTTGCTTGGTCTTGGTCTTGCC.

6. The method according to claim 5, wherein in step S1, the PCR conditions are as follows: 5min at 95 ℃; 35 cycles of 95 ℃, 30s, 60 ℃, 45s, 72 ℃, 62 s; preserving PCR amplification products at 72 ℃ for 10min and 4 ℃;

7. The method for preparing the rabbit anti-mouse Ccdc189 polyclonal antibody according to claim 6, wherein in the step S2, the specific method for inducing expression of the Ccdc189 prokaryotic protein is as follows:

transforming E.coli BL21 competent cells by pET-28a-Ccdc189 recombinant plasmid, culturing on a kanamycin-resistant LB solid culture medium, selecting a positive monoclonal bacterial colony, placing the colony in a kanamycin-resistant LB liquid, culturing overnight, adding the overnight-cultured bacterial liquid into the kanamycin-resistant LB liquid, culturing for a period of time, taking the bacterial liquid into a test tube, adding an inducer IPTG (isopropyl-beta-thiogalactoside) for prokaryotic induction expression, centrifugally collecting bacteria, adding a heavy suspension buffer for full heavy suspension, adding a bacterial lysate for lysis, ultrasonically centrifuging the lysed bacterial liquid, collecting precipitates, washing by using a washing liquid, dissolving in a urea solution, standing overnight, and centrifugally collecting a supernatant;

the specific method for purifying the Cdc189 prokaryotic protein comprises the following steps: passing the supernatant through Ni-NTA affinity chromatography column, eluting with imidazole solution, loading the eluate into treated dialysis bag, gradient renaturation in 7M, 6M, 5M, 4M, 3M, 2M urea solution, and collecting renaturated protein solution.

8. The method for preparing the rabbit anti-mouse Cdc189 polyclonal antibody according to claim 7, wherein in the step S3, the method for preparing the Cdc189 polyclonal antibody comprises the following steps: taking the Cdc189 prokaryotic protein after renaturation as immunogen to immunize adult male New Zealand white rabbits, mixing the Cdc189 prokaryotic protein after renaturation with Freund's complete adjuvant in equal volume in the first immunization, emulsifying on ice, injecting subcutaneously and multiply in the back to immunize adult New Zealand white rabbits, then mixing the Cdc189 prokaryotic protein after renaturation with Freund's incomplete adjuvant in equal volume, immunizing 1 time every 2 weeks, and immunizing 5 times.