CN106699895B

CN106699895B - Novel fusion antigen, detection kit containing same and application

Info

Publication number: CN106699895B
Application number: CN201611102245.0A
Authority: CN
Inventors: 梁权; 惠星星; 王尧; 李基�
Original assignee: Shanghai Kehua Bio Engineering Co ltd
Current assignee: Shanghai Kehua Bio Engineering Co ltd
Priority date: 2016-12-05
Filing date: 2016-12-05
Publication date: 2020-08-04
Anticipated expiration: 2036-12-05
Also published as: CN106699895A

Abstract

The invention provides a novel fusion antigen and an immunoassay kit containing the fusion antigen. The fusion antigen comprises fusion protein and a target antigen fragment, the expression level of the fusion antigen in cell supernatant is high, and the sensitivity and stability of an immunoassay kit prepared by using the recombinant antigen are obviously improved.

Description

Novel fusion antigen, detection kit containing same and application

Technical Field

The present invention is in the field of medical detection and diagnosis. Specifically, the invention relates to a novel fusion antigen, an immunoassay kit containing the fusion antigen and application thereof.

Background

Hepatitis E (Hepatitis E, abbreviated as Hepatitis E), also known as enterically transmitted non-A, non-B Hepatitis, is caused by infection with Hepatitis E ViRus (HEV). HEV is rare in europe and america, but is widely prevalent in the far east, with nearly 20% of the chinese carrying antibodies to hepatitis e, meaning that it has been infected. Pigs and other animals may carry hepatitis e virus and may be a source of this virus. The pregnant women infected with HEV are serious in illness and easy to suffer from liver failure, and particularly the death rate of the pregnant women in late gestation is high. HEV morphology and genomic structure are more similar to calicivirus and spread primarily through the digestive tract. In the acute viral hepatitis stage, IgM hepatitis E antibody appears in blood, and after three to several months, the IgM hepatitis E antibody is replaced by IgG antibody and is kept for several years.

HEV is an RNA virus whose genome consists of non-coding, non-structural and structural regions, with 3 open reading frames (ORF1, ORF2 and ORF3) encoding viral proteins. ORF-1 is located at the 5' end of the viral genome and encodes viral non-structural proteins; ORF2 is located at the 3' end of the viral genome, encoding the viral capsid proteins; ORF3 is located between ORF1 and ORF2, with varying degrees of overlap between both, encoding viral regulatory proteins. At present, serological detection of hepatitis E is mainly used for detecting anti-HEV antibodies, and high-quality recombinant antigens are needed for development of high-quality HEV immunodetection kits.

The research of all countries in the field of preventing and treating hepatitis E mainly focuses on the aspects of vaccine and diagnosis. For many years, the development of effective HEV vaccines has not been successful, and timely and accurate diagnosis of HEV infection is the key point in the current hepatitis E prevention and control work. In the aspect of hepatitis E diagnosis, HEV antibody detection is a universal method and an important means for HEV diagnosis at present. The HEV antibody screening can be carried out on various blood products and blood or other body fluids of a human population to be tested, so that the hepatitis E virus infection can be effectively detected.

At present, the indirect method and the capture method are most widely applied to the HEV immune antibody detection kit. The indirect method mainly detects IgG, and the principle is as follows: coating HEV antigen on the enzyme immunoassay reaction plate, adding a sample to be detected, adding a secondary antibody labeled with enzyme after incubation, adsorbing the HEV antibody on a solid phase support if the HEV antibody exists in the sample, amplifying a signal through an enzyme conjugate on the secondary antibody, and obtaining a judgment result by using an enzyme labeling instrument. The capture method mainly detects IgM by using a reaction plate coated with an anti-human IgM mu chain, adding a sample diluent and a sample to be detected, incubating, adding a labeled antigen-enzyme conjugate diluted by an enzyme diluent, incubating, adding a developing solution and a stop solution, and reading an OD value by an enzyme-labeling instrument.

Key quality indicators for HEV immunoassay kits are sensitivity and stability, which are substantially determined by the quality of the antigen used in the kit, and the high quality antigen needs to be excellent in both activity and stability. The activity and stability of the antigen are determined by the amino acid composition of the antigen, and the general rule is that if the in vitro expressed recombinant antigen is expressed in high amount and folded fully in the supernatant, the conformation of the antigen is closer to that of the natural antigen, and the activity and stability are better.

Because HEV antigen has strong hydrophobicity, low expression quantity and poor activity, and the obtained antigen quantity is small, most methods for expressing HEV antigen are that a section of fusion protein is fused and expressed on the antigen to form a fusion protein-antigen chimeric antigen, the recombinant antigen expressed by the method has better performance in the aspects of solubility and expression quantity, and the fusion proteins commonly adopted in the prior art comprise fusion proteins such as TRX (thioredoxin) and GST (glutathione transferase). The application of the fusion proteins on HEV antigen expression is beneficial to improving the expression quantity of the antigen, but the fusion proteins have the conditions of low sensitivity and poor stability after being used for a detection reagent.

Therefore, a recombinant antigen with high antigen activity, high detection sensitivity and high stability is urgently needed in the field of HEV immunodetection, so that the recombinant antigen can be used as a coating antigen or a labeled antigen to be used as a detection reagent for detecting HEV antibodies, and the quality of the reagent is improved.

Disclosure of Invention

The invention aims to provide a HEV genetic engineering recombinant antigen with good solubility and folding conformation close to the natural one, and the HEV genetic engineering recombinant antigen is used for improving the sensitivity and stability of the conventional HEV antibody detection kit.

Another object of the present invention is to provide a fusion protein which can improve the expression level of a recombinant protein, is soluble and can be folded correctly, a plasmid vector containing a nucleic acid sequence encoding the fusion protein and the nucleic acid sequence, and a host cell clone containing the plasmid vector.

In a first aspect, the present invention provides a fusion antigen comprising a fusion protein and an antigenic fragment of interest,

wherein the fusion protein is:

(a) the amino acid sequence is shown as SEQ ID NO: 1; or

(b) 1 through substitution, deletion or addition of one or a plurality of amino acid residues, and has the functions of the protein (a).

In a specific embodiment, the antigenic fragment of interest comprises SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

In a preferred embodiment, the derived protein of (b) is a derived protein formed by substitution, deletion or addition of 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residues of the amino acid sequence of SEQ ID NO. 1 and having the function of the protein of (a).

In a preferred embodiment, the derived protein of (b) is a derived protein formed by deletion or addition of 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residues from the amino acid sequence of SEQ ID NO. 1 and having the function of the protein of (a).

In a preferred embodiment, the derived protein of (b) is a derived protein formed by adding or deleting 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residues to or from the C-terminus and/or N-terminus of the amino acid sequence of SEQ ID NO. 1 and having the function of the protein of (a).

In a preferred embodiment, the derived protein of (b) is a derived protein formed by adding 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residues to the C-terminal and/or N-terminal of the amino acid sequence of SEQ ID NO. 1, and having the function of the protein of (a).

In a second aspect, the present invention provides a nucleotide sequence encoding a fusion antigen according to the first aspect of the invention.

In a third aspect, the present invention provides an expression vector comprising an encoding nucleotide sequence according to the second aspect of the present invention.

In a fourth aspect, the present invention provides a host cell comprising an expression vector according to the third aspect of the present invention or having integrated in its genome an encoding nucleotide sequence according to the second aspect of the present invention.

In a fifth aspect, the present invention provides a fusion protein, which is:

(a) the amino acid sequence is shown as SEQ ID NO: 1; or

In a sixth aspect, the present invention provides a nucleotide sequence encoding a fusion protein according to the fifth aspect of the present invention.

In a seventh aspect, the present invention provides an immunoassay kit comprising:

(a) a recombinant antigen according to the first aspect of the invention; and

(b) other reagents for immunoassay.

In a preferred embodiment, the immunoassay kit is a HEV immunoassay kit.

In a preferred embodiment, the immunoassay kit further comprises instructions for use.

In an eighth aspect, the present invention provides the use of a fusion antigen according to the first aspect of the present invention or a fusion protein according to the fifth aspect of the present invention in the preparation of an immunoassay kit or an immunoassay reagent.

In a preferred embodiment, the immunoassay kit is an HEV immunoassay kit and the immunoassay reagent is an HEV immunoassay reagent.

In a ninth aspect, the present invention provides an immunoassay method comprising detecting antibodies in a sample using the fusion antigen of the first aspect of the invention or the immunoassay kit of the seventh aspect of the invention.

In preferred embodiments, the immunoassay method may be for non-diagnostic purposes.

In a preferred embodiment, the antibody is an HEV antibody.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a schematic diagram of the construction process of the R vector of the present invention.

FIG. 2 is a schematic diagram of the construction process of the R-HEV expression plasmid of the present invention.

Detailed Description

The inventors have conducted extensive and intensive studies and unexpectedly found that a fusion antigen obtained by fusion expression of a specific fusion protein (referred to herein as R protein) of the present invention and HEV antigen has significant advantages in terms of both antigen activity and stability. When the fusion antigen is applied to HEV antibody detection by using the HEV immunodetection reagent as a coating antigen or a labeled antigen, the detection sensitivity and stability are obviously improved. The present invention has been completed based on this finding.

Definition of

Unless otherwise indicated, the terms used in the present invention are defined as follows.

The term "fusion protein" as used herein refers to a protein for fusion with an antigen fragment of interest to express a fusion antigen.

The term "fusion antigen" used in the present invention refers to a product of fusion expression of the above-mentioned fusion protein together with an antigen fragment of interest.

The term "recombinant antigen" used in the present invention refers to an antigen which is expressed by cloning a nucleotide sequence corresponding to a fragment encoding an antigen of interest into an expression vector using a genetic engineering recombination technique to form a recombinant plasmid, and then introducing the recombinant plasmid into a host cell.

Fusion proteins of the invention

The invention provides a novel fusion protein, and the amino acid sequence of the fusion protein is shown as SEQ ID NO:1 is shown.

The inventors unexpectedly found that the fusion protein of the present invention has a large amount of hydrophilic amino acids, good fusibility, and stable conformation. Compared with other fusion proteins, the polypeptide as a fusion protein has obvious advantages in the aspects of activity and stability.

In view of the teachings of the present invention and the prior art, it will also be apparent to those skilled in the art that "fusion proteins of the present invention" shall also include variants of the proteins having the same or similar function as "fusion proteins of the present invention" but with minor differences in their amino acid sequences from the amino acid sequence shown in SEQ ID NO. 1. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 30, preferably 1 to 10, more preferably 1 to 6, most preferably 1 to 3) amino acids, and addition of one or more (usually up to 20, preferably up to 10, more preferably up to 6 or 3) amino acids at the C-terminus and/or N-terminus. For example, it is well known to those skilled in the art that substitutions with amino acids of similar or analogous properties, e.g., isoleucine and leucine, do not alter the function of the resulting protein. As another example, the addition of one or several amino acids at the C-terminus and/or N-terminus, such as a tag added for ease of isolation, does not generally alter the function of the resulting protein. For example, the fusion protein in the present embodiment is a protein with a6 × his tag at the N-terminus.

In addition to almost full-length polypeptides, the invention also encompasses active fragments of the "fusion proteins of the invention". Typically, the fragment has at least about 20 contiguous amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the amino acid sequence of the "fusion protein of the invention".

The invention also provides "fusion protein" analogues of the invention ", these analogues and" fusion protein "can be different in amino acid sequence, can also be not affected by the sequence of the modified form of the difference, or both, these polypeptides include natural or induced genetic variants, induced variants can be obtained by various techniques, such as by radiation or exposure to mutagens to generate random mutagenesis, also can be through site-directed mutagenesis method or other known molecular biology techniques.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to increase their resistance to proteolysis or to optimize solubility.

Thus, in view of the teachings of the present invention and the prior art, one skilled in the art can generate conservatively variant mutants by making amino acid substitutions as shown, for example, in the following table.

In view of the above, the fusion protein provided by the present invention also includes a derivative protein formed by the substitution, deletion or addition of one or several amino acid residues of the amino acid sequence shown in SEQ ID NO. 1, and having the function of the protein shown in SEQ ID NO. 1.

In a preferred embodiment, the derivative protein is formed by substitution, deletion or addition of 1-10, more preferably 1-6, still more preferably 1-3, most preferably 1 amino acid residue of the amino acid sequence shown in SEQ ID NO. 1; in a further embodiment, the derivative protein is formed by deletion or addition of 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residue from the amino acid sequence shown in SEQ ID NO. 1; in a further preferred embodiment, the derivative protein is formed by adding or deleting 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residue to the C-terminus and/or N-terminus of the amino acid sequence shown in SEQ ID NO. 1; in a most preferred embodiment, the derivative protein is formed by adding 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, and most preferably 1 amino acid residue to the C-terminus and/or N-terminus of the amino acid sequence shown in SEQ ID NO. 1.

On the basis of the fusion protein, the invention also provides a coding nucleotide sequence of the fusion protein.

Based on the present invention, the person skilled in the art can obtain the fusion protein (R protein) of the present invention by various methods well known to those skilled in the art. For example, but not limited to: the whole gene is synthesized into SEQ ID NO:1, the synthesized nucleotide sequence is subjected to enzyme digestion and connection, and the gene is constructed into a vector without a fusion protein gene to become an R vector. Extracting the vector plasmid, and carrying out enzyme digestion electrophoresis identification to obtain a positive strain. Inducing the expression of the target protein, and carrying out SDS-PAGE electrophoresis to observe the molecular weight and the expression quantity of the expressed protein. Purifying the corresponding gene engineering recombinant protein R.

Fusion antigens of the invention

The present inventors further fused and expressed the above fusion protein with a target protein on the basis of the fusion protein of the present invention, and found that the expression level and solubility of the target protein in the supernatant can be improved. Therefore, the fusion antigen obtained by fusion expression of the fusion protein and the target antigen fragment can be used for an immunoreagent to obviously improve the sensitivity and stability of detection.

In a specific embodiment, the fusion protein of the invention is expressed as a fusion antigen fused to, for example, but not limited to, amino acid 366-630 (SEQ ID NO:2) of HEV ORF2 protein. The fusion antigen is applied to HEV immunodetection, and can obviously improve the sensitivity and stability of HEV detection.

On the basis of the fusion antigen, the invention also provides a coding nucleotide sequence of the fusion antigen; an expression vector comprising said coding nucleotide sequence; and host cells comprising said expression vectors or having said coding nucleotide sequences integrated in the genome.

The fusion antigen of the present invention can be prepared in various ways well known to those skilled in the art. For example, the constructed R vector is used as a template, a proper enzyme cutting site is selected, and the SQE ID NO:2 and the fragment has enzyme cutting sites capable of being connected with the R vector, and the vector is constructed according to a general molecular cloning process. After the vector is constructed, the corresponding plasmid is obtained through cloning and strain culture. Selecting proper host strain, culturing, expressing and purifying the corresponding protein.

For example, in a specific embodiment, the method of making comprises:

(a) encoding a polypeptide comprising SEQ ID NO:1 and SEQ ID NO:2 connecting the nucleotide sequence of the protein fragment with a plasmid vector to form a recombinant plasmid;

(b) transferring the recombinant plasmid in the step (a) into a host cell to form a clonal daughter cell;

(c) culturing the clonal cell of step (b) to express the recombinant protein;

(d) and (5) purifying the recombinant protein.

The immunoassay kit of the present invention

Based on the fusion protein and the fusion antigen of the present invention, those skilled in the art will understand that the fusion protein and the fusion antigen of the present invention can be used to prepare corresponding immunoassay kits or immunoassay reagents.

The immunoassay kit contains the recombinant antigen of the present invention and other reagents for immunoassay. It will be understood by those skilled in the art that if the antigen fragment of interest in the recombinant antigen is amino acids 366-630 of the HEV ORF2 protein described above (SEQ ID NO:2), then the immunoassay is a HEV immunoassay kit, but is not so limited.

In a further embodiment, the immunoassay kit of the present invention is further provided with instructions for use.

One skilled in the art can use the fusion antigen or immunoassay kit of the present invention or to detect antibodies in a sample, such as, but not limited to, HEV antibodies. In preferred embodiments, the immunoassay method may be for non-diagnostic purposes.

The invention has the advantages that:

1. after the fusion protein is fused and expressed with other target proteins, the expression quantity and solubility of the target protein can be improved, the soluble expression of the target protein is facilitated, and the spatial conformation of a target antigen is close to that of a natural antigen;

2. the activity, stability and the like of the recombinant antigen expressed by fusion of the fusion protein and the target protein are superior to those of the antigen expressed by other commonly used methods at present, so that the sensitivity of immunoassay is obviously improved.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental methods without specifying specific conditions in the following examples, generally according to conventional conditions, or according to literature known in the art, such as the conditions described in various textbooks, for example, the conditions described in the molecular cloning experimental manual (second edition) (j. sambrook et al); either according to the instructions for use of commercially available equipment or reagents, or according to the conditions recommended by the manufacturer.

Example 1 construction of vectors with R fusion proteins

The expression vector plasmid used in the present invention is pET-28a (+) (Novagen), and pET-28a (+) is not essential to the practice of the present invention, and many other expression vectors such as pQE32 (Qiagen) can be used in the practice of the present invention.

For SEQ ID NO:1, deducing a preferred codon sequence of escherichia coli by using biological correlation software, adding an NcoI enzyme cutting site and 6 His label sequences CCATGGGCCATCACCACCATCACCAC at the front end of the sequence, adding BamHI and XhoI enzyme cutting site sequences at the tail end of the sequence, adding a stop codon GGATCCTAACTCGAG between the two enzyme cutting sites, and sending the sequences to the whole gene synthesis of a biological organism.

The vector plasmid containing the target sequence synthesized was digested simultaneously with NcoI and XhoI enzymes (various enzymes for molecular biology used in the present invention were purchased from NEB Co., Ltd.), and then the digested products were recovered and ligated to pET-28a vector digested with NcoI and XhoI, followed by cloning, PCR to identify recombinants, to obtain positive clones, and plasmid extraction to obtain recombinant vector R1 (see FIG. 1).

Example 2 construction of expression plasmid containing HEV fusion antigen Gene

PCR amplification of the HEV gene ORF2 segment SEQ ID NO:2, the upstream primer carries a BamHI site, the downstream primer carries an XhoI site and the XhoI site is preceded by a stop codon TAA. And after recovery and enzyme digestion, the PCR fragments are respectively connected to R1 vectors which are subjected to enzyme digestion by BamHI and XhoI, and the recombinants are identified by cloning and PCR to obtain a positive clone R1-HEV. This step can be seen in fig. 2.

Example 3 expression and purification of fusion antigen containing HEV

R1-HEV plasmid transformed B L21 DE3 cells, spread on L B plate containing 50ug/ml kanamycin sulfate), cultured overnight at 37 ℃, picked up single clones, cultured with 500ml L B medium containing 50ug/ml kanamycin at 37 ℃ with shaking to OD600 about 0.8, induced with 0.5mM IPTG at 37 ℃ for 3 hours, collected by centrifugation, resuspended in 20ml of ultrasonic buffer (50mM Tris-HCl, pH8.0, 100mM NaCl) per liter of bacterial liquid, disrupted by ultrasonication, and identified by SDS-PAGE to show that more than 70% of fusion antigen is expressed in the ultrasonic supernatant.

In order to further prove that the fusion protein of the invention has the advantages of high activity and good stability, the fragment corresponding to SEQ ID NO:2 in ORF2 of HEV and other different fusion proteins TRX and GST are respectively subjected to fusion expression (the preparation process of the two fusion proteins is similar to that of R1-HEV and is not repeated here), and the results are compared to perform an experiment for explaining the superiority of the R fusion protein, namely R1-HEV, TRX-HEV and GST-HEV are subjected to induction expression and comparison under the same conditions, the comparative experiment steps comprise that R1-HEV, TRX-1 and GST-HEV clones are respectively subjected to shake culture at 37 ℃ to OD600 of about 0.8 by using 500ml of L B culture medium containing kanamycin with the same concentration at the same concentration, induction is performed by using IPTG with the final concentration of 0.5mM, the induction conditions are that at 37 ℃, 3 hours, the bacteria are collected by centrifugation for 20 minutes, the bacteria liquid is subjected to electrophoresis by using 20ml of ultrasonic buffer solution (50mM of TRis-HCl, pH0, 100mM NaCl), the total volume of SDS, the bacteria is crushed, the cells are respectively subjected to electrophoresis, and the cell suspension is obtained by performing electrophoresis, and each liter of the cell is subjected to obtain the:

from the above results, it can be seen that the expression level of the fusion protein in the supernatant of R1-HEV was better than that of the other two.

The supernatants of each recombinant protein were purified separately: the Ni-NTA affinity column was equilibrated with 5 bed volumes of equilibration buffer (50mM Tris-HCl, pH8.0, 100mM NaCl, 5mM imidazole), the ultrasound supernatant sample was added, unbound protein was washed off with 5 bed volumes of equilibration buffer, the desired protein was eluted with elution buffer (50mM Tris-HCl, 100mM NaCl, 500mM imidazole, pH8.0), and the protein concentration was determined and stored at-20 ℃ for further use. The fusion antigen expressed and purified by R1-HEV is abbreviated as R1-HEV Ag hereinafter, and other fusion antigens are similar and are respectively named as TRX-HEV Ag and GST-HEV Ag.

Example 4 fusion antigen coating of solid phase Carrier

The R1-HEV Ag fusion antigen is added into carbonate buffer (50mM, pH9.6) at the concentration of 0.5ug/ml, mixed evenly and placed at normal temperature for 30 minutes to form coating liquid. Adding the coating solution into an enzyme-labeled reaction plate according to 100 ul/hole, and coating overnight at 2-8 ℃. The following day the coating solution was aspirated, and the plate washed once with PBST (10mM PBS, 0.1% Tween-20, pH7.4) wash solution, followed by blotting. Filling each hole with a blocking solution containing 5% of sucrose and 1% of BSA, blocking for 1-2 hours at 37 ℃, sucking off the blocking solution, and finally drying the residual liquid in the reaction plate by spinning. And (3) vacuumizing the reaction plate, filling the reaction plate into an aluminum platinum bag, adding a drying agent, carrying out heat sealing, and storing at 2-8 ℃ for later use. The coating method of other fusion antigens is the same.

Example 5 detection of HEV antibodies by fusion antigen-coated reaction plate Indirect E L ISA

Adding 100 mul of sample diluent into each hole of the coated enzyme label plate, adding 10 mul of sample to be detected (positive serum), and incubating for 30 minutes at 37 ℃; the plates were washed five times with PBST wash and patted dry. Add PB buffer (10mM, pH7.4) containing 20% newborn bovine serum and a certain amount of rabbit anti-human IgG-HRP per 100 ul/well, incubate for 30 minutes at 37 ℃; the plates were washed five times with PBST wash and patted dry. (TRX-HEV Ag, GST-HEV Ag Experimental method is the same as R1-HEVAg)

50ul of each of a developer A containing 0.8% of citric acid and 1.7% of sodium citrate and a developer B containing 0.2% of TMB (manufacturer's, product number TB0514), 5mM of citric acid, 0.5mM of EDTA-2Na, 4% of absolute ethyl alcohol and 0.3% of acetone are added into each well, and the mixture is developed in a dark place at 37 ℃ for 10 minutes. Adding 50ul of stop solution containing 2M sulfuric acid into each hole to stop the reaction, and reading the OD value after zero calibration of blank holes with the 450nm wavelength (the reference wavelength is 630nm) of an enzyme-labeling instrument.

The invention uses the same method to coat TRX-HEV Ag and GST-HEV Ag on solid phase carrier, uses indirect E L ISA to detect HEV positive serum, obtains the result of table 2, and the result shows that the detection activity of the fusion protein connected with HEV antigen coating is higher than that of other two fusion antigens.

TABLE 2 comparison of the sensitivity of detection of HEV antibody by the fusion antigen-coated reaction plate Indirect E L ISA

Example 6 stability of Each fusion antigen-coated reaction plate

The enzyme-labeled reaction plate coated with each fusion antigen was left at 37 ℃ for 6 days, and the reaction plate was taken out and equilibrated at room temperature for 30 minutes or longer. Positive samples were tested with 4 ℃ reaction plates. The reaction plates are placed at 2-8 ℃ for 14 months, taken out and balanced at room temperature for more than 30 minutes, and 10 positive blood are respectively detected by the method. The results are shown in Table 3. Experiments show that the storage stability of the fusion protein is better than that of reaction plates coated by other two fusion antigens after the fusion protein is connected with the HEV antigen coated reaction plate.

TABLE 3 comparison of stability of the respective fusion antigen-coated reaction plates

The fusion protein R of the invention is connected with the recombinant antigen expressed after HEV target protein, and is used for detecting HEV antibody by E L ISA after coating a reaction plate, and the indexes such as activity, stability and the like are all superior to HEV antigen expressed by expression vectors such as TRX-HEV Ag, GST-HEV and the like.

Example 7 fusion antigen labeling of HRP

The fusion antigen labeled HRP adopts a classical NaIO4 method. Weighing 10mg of horseradish peroxidase (HRP, SIGMA corporation, USA, product number P8375) and dissolving in 1ml of ultrapure water, slowly adding dropwise 5mg/ml NaIO4 (Producer organism, product number ST1244) solution freshly prepared from 1ml of ultrapure water, adding 1ml of 5% ethylene glycol (Producer organism, product number 0518A60) solution after keeping out of the light for 30 minutes at 4 ℃, and keeping out of the light for 30 minutes at 4 ℃. Then, 1ml of R1-HEVAg antigen (2 mg/ml) was immediately added thereto, and the mixture was dialyzed overnight against a carbonate buffer (50mM, pH9.6) at 4 ℃ in the absence of light. The next day, 0.2ml of a freshly prepared solution of NaBH4 (SIGMA corporation, USA, Cat. 71321) was added dropwise to the mixture, mixed well and allowed to stand at 4 ℃ for 2 hours. The above solution was dialyzed against PBS buffer (150mM, pH7.4) at 4 ℃ overnight. Adding glycerol with the final concentration of 50%, mixing uniformly, storing at-20 deg.C in dark place, and naming as R1-HEV Ag-HRP, wherein the labeling methods and names of other fusion antigens are the same.

Example 8 detection of HEV antibodies by HRP-labeled fusion antigens E L ISA

The capture method is used for detecting the activity of each enzyme conjugate, a reaction plate (Shanghai Kehua bioengineering Co., Ltd.) coated with an anti-human IgM mu chain is taken, 100 mu l of sample diluent is added into each hole, 10 mu l (positive blood) of a sample to be detected is added, each antigen enzyme diluted by the enzyme diluent is added, a developing solution and a stop solution are added, and an OD value is read after an enzyme-labeling instrument is used.

TABLE 4 comparison of activity of HEV antibody detection after HRP labeling of HEV fusion antigen

The inventor uses the same method to mark R-HEV Ag, TRX-HEV Ag and GST-HEV Ag with HRP respectively, and then uses the capture method E L ISA to detect HEV positive sample, and obtains the result of table 4, the result shows that the detection activity of the fusion protein of the invention is higher than that of other two fusion antigens after being connected with HEV gene and marked.

Example 8 comparison of the stability of HRP-labeled fusion antigens on Placement

Diluting each fusion antigen enzyme with antigen enzyme diluent according to a certain proportion, respectively standing at 37 deg.C and 2-8 deg.C for 6 days, taking out, and balancing at room temperature for more than 30 minutes. And (4) detecting HEV positive samples together according to a capture method. Diluting each fusion antigen enzyme with antigen enzyme diluent according to a certain proportion, respectively standing at 2-8 deg.C for 6 months and 12 months, taking out, and balancing at room temperature for more than 30 minutes. HEV positive samples are detected together according to the capture method, which is the same as the above method. The results are shown in Table 5. Experiments show that the storage stability of the fusion protein is obviously better than that of HRP marked by other two fusion antigens after the fusion protein is connected with the HRP marked by HEV antigen.

TABLE 5 stability comparison of HEV fusion antigen labeled HRP after dilution

The inventor respectively carries out research on rapid thermal stability and long-term storage stability by coating and marking HRP-labeled R-HEV Ag-HRP, TRX-HEV Ag-HRP and GST-HEV Ag-HRP by various fusion antigens R-HEV Ag, TRX-HEV Ag and GST-HEV Ag-HRP. Each reaction plate and each antigen enzyme were diluted with an enzyme diluent and left at 37 ℃ for 6 days, and the reaction plate and the enzyme were removed to examine the same positive serum under the same conditions, respectively, as shown in Table 4. Similarly, each reaction plate and each antigen enzyme were diluted appropriately with enzyme diluent and left at 2-8 ℃ for 14 months, and the same negative and positive quality control sera were examined under the same conditions as in table 5 for long-term storage stability studies. The result shows that the fusion antigen of the fusion protein connected with HEV gene has obviously better stability than other two fusion antigens when used in HEV detection reagent.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai Kowa bioengineering GmbH

<120> novel fusion antigen, detection kit containing same and application

<130>P2016-1948

<160>2

<170>PatentIn version 3.5

<210>1

<211>146

<212>PRT

<213> Artificial sequence

<220>

<223> fusion protein of the present invention

<400>1

Lys Lys Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile Thr Pro

1 5 10 15

Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp Ala Val

20 25 30

Tyr Asn Gly Lys Leu Ile Tyr Pro Ile Val Glu Ile Tyr Asn Lys Asp

35 40 45

Leu Leu Pro Asn Pro Pro Lys Thr Trp Glu Glu Ile Pro Ala Leu Asp

50 55 60

Lys Glu Leu Lys Ala Lys Gly Lys Glu Glu Leu Met Phe Asn Leu Gln

65 70 75 80

Glu Pro Tyr Phe Thr Trp Pro Leu Ile Ala Ala Asp Gly Gly Tyr Ala

85 90 95

Phe Lys Tyr Glu Asn Gly Lys Tyr Asp Asn Lys Asp Val Gly Val Asp

100 105 110

Asn Ala Gly Ala Lys Ala Gly Leu Thr Asp Asn Leu Val Asp Leu Ile

115 120 125

Lys Asn Lys His Met Asn Ala Asp Thr Asp Tyr Ser Ile Ala Gly Gly

130 135 140

Gly Glu

145

<210>2

<211>264

<212>PRT

<213> Artificial sequence

<220>

<223> amino acids 366-630 of HEV ORF2 protein

<400>2

Leu His Phe Thr Gly Thr Asn Gly Val Gly Glu Val Gly Arg Gly Ile

1 5 10 15

Ala Leu Thr Leu Phe Asn Leu Ala Asp Thr Leu Leu Gly Gly Leu Pro

20 25 30

Thr Glu Leu Ile Ser Ser Ala Gly Gly Gln Leu Phe Tyr Ser Arg Pro

35 40 45

Val Val Ser Ala Asn Gly Glu Pro Thr Val Lys Leu Tyr Thr Ser Val

50 55 60

Glu Asn Ala Gln Gln Asp Lys Gly Ile Ala Ile Pro His Asp Ile Asp

65 70 75 80

Leu Gly Glu Ser Arg Val Val Ile Gln Asp Tyr Asp Asn Gln His Glu

85 90 95

Gln Asp Arg Pro Thr Pro Ser Pro Ala Pro Ser Arg Pro Phe Ser Val

100 105 110

Leu Arg Ala Asn Asp Val Leu Trp Leu Ser Leu Thr Ala Ala Glu Tyr

115 120 125

Asp Gln Thr Thr Tyr Gly Ser Ser Thr Asn Pro Met Tyr Val Ser Asp

130 135 140

Thr Val Thr Phe Val Asn Val Ala Thr Gly Ala Gln Gly Val Ser Arg

145 150 155 160

Ser Leu Asp Trp Ser Lys Val Thr Leu Asp Gly Arg Pro Leu Ile Thr

165 170 175

Ile Gln Gln Tyr Ser Lys Thr Phe Tyr Val Leu Pro Leu Arg Gly Lys

180 185 190

Leu Ser Phe Trp Glu Ala Gly Thr Thr Lys Ala Gly Tyr Pro Tyr Asn

195 200 205

Tyr Asn Thr Thr Ala Ser Asp Gln Ile Leu Ile Glu Asn Ala Ala Gly

210 215 220

His Arg Val Cys Ile Ser Thr Tyr Thr Thr Asn Leu Gly Ser Gly Pro

225 230 235 240

Val Ser Ile Ser Ala Val Gly Val Leu Ala Pro His Ser Val Leu Ala

245 250 255

Ala Leu Glu Asp Thr Val Asp Tyr

260

Claims

1. A fusion antigen comprising a fusion protein and an antigenic fragment of interest,

wherein, the fusion protein has an amino acid sequence shown as SEQ ID NO: 1;

the antigenic fragment of interest comprises SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

2. The fusion antigen-encoding nucleotide sequence of claim 1.

3. An expression vector comprising the coding nucleotide sequence of claim 2.

4. A host cell comprising the expression vector of claim 3 or having integrated in its genome the coding nucleotide sequence of claim 2.

5. A fusion protein, which is a polypeptide with an amino acid sequence shown in SEQ ID NO: 1.

6. A nucleotide sequence encoding the fusion protein of claim 5.

7. An immunoassay kit comprising:

(a) the fusion antigen of claim 1; and

(b) other reagents for immunoassay.

8. Use of the fusion antigen of claim 1 or the fusion protein of claim 5 in the preparation of an immunoassay kit or an immunoassay reagent.