CN115948621A

CN115948621A - HPV screening method based on menstrual blood DNA

Info

Publication number: CN115948621A
Application number: CN202310088548.5A
Authority: CN
Inventors: 田瑞; 余晓盈
Original assignee: Zhuhai Shutong Medical Technology Co ltd
Current assignee: Zhuhai Shutong Medical Technology Co ltd
Priority date: 2023-01-18
Filing date: 2023-01-18
Publication date: 2023-04-11

Abstract

The invention relates to the technical field of cervical cancer screening, and discloses an HPV screening method based on menstrual blood DNA. The method comprises the following steps: extracting DNA of menstrual blood; constructing a DNA library with a sequencing linker; hybridizing the DNA library with a Human Cot-1DNA blocking reagent and a probe to obtain a hybridization product; adding streptavidin magnetic beads into the hybridization product to capture the DNA of the target area; PCR amplification to obtain the upper computer library for sequencing analysis. The invention provides a noninvasive self-sampling screening scheme of menstrual blood sanitary napkins-express mailing-HPV detection based on HPV capture sequencing technology, and the sanitary napkins mailed to the next day of menstruation for premenopausal women can participate in screening. The invention solves the dilemma of missed diagnosis, misdiagnosis and over-treatment faced by the existing screening means.

Description

HPV screening method based on menstrual blood DNA

Technical Field

The invention relates to the technical field of cervical cancer screening, in particular to an HPV screening method based on menstrual blood DNA.

Background

Cervical cancer is one of the leading causes of cancer death in women worldwide, and about 75% of cases are caused by persistent infection with the most common high-risk human papillomavirus types (i.e., HPV16 and HPV 18). Cervical cancer develops through the process of high-risk HPV infection, virus persistence, clonal expansion, and the differentiation of persistently infected cells into premalignant lesions, which gradually transform into invasive cancer.

HPV infection is the most key pathogenic factor which is generally accepted to cause the development of cervical cancer, and the HPV-DNA examination method is to detect whether a screened person has human papilloma virus infection through a molecular means. Compared with cytological and morphological observation, HPV detection has high sensitivity, namely lower missed diagnosis rate, and has better guiding significance for screening cervical cancer. On 6 th 7 th 2021, the World Health Organization (WHO) and the united nations human reproductive special program (HRP) have jointly issued a new version of guidelines for the prevention and treatment of cervical cancer, which recommend HPV-DNA detection as the first screening method. HPV-DNA detection is a rapid, simple, accurate and objective diagnosis method, and has simpler operation and low cost. The sampling methods include the following methods: 1. a medical sample book: when the specimen is taken, the specimen is taken by a brush for exfoliative cells of the cervical canal and put into a culture dish for pathological examination. If condyloma acuminatum is obtained from vulva, a small part of biopsy is taken for pathological examination. 2. Self-taking a sample: the self-sampling mode is time-saving, labor-saving, simple and convenient, and can avoid the collection of cervical exfoliated cell samples (medical samples) of patients in a gynecological examination mode in hospitals by clinicians and the necessary medical cost, thereby greatly improving the screening coverage rate, and particularly in the areas with shortage of medical resources and conflict of religious culture. 3. Urine sample: urine, as an easily accessible, non-invasive test sample, has also recently been used in self-sampling screening studies and follow-up studies after vaccination. Compared with a cervical cell sample, the HPV detection sensitivity of the urine self-taken sample reaches 89% of that of the cervical cell sample, and the detection sensitivity of the urine self-taken sample to CIN2+ of a colposcopic revisiting person reaches 92%.

The accuracy of the TCT detection result popularized at present is influenced by a plurality of factors, for example, a sample is taken 3-7 days after the menstrual period is clean, the menstrual period sample influences the result interpretation, and the sample is not suitable to be collected; sexual intercourse, bath, vaginal lavage and local medicine application should be prohibited within 24 hours before sampling; if the drug is administered, the sample must be taken before administration to avoid affecting the results of the examination. Meanwhile, the cervical iodine test, colposcopy and the like also depend on the level and subjective judgment of doctors. TCT detection (cervical thin-layer liquid-based cytology) is generally used clinically to indicate whether HPV virus exists. The HPV virus typing test can also determine whether HPV virus infection exists and identify the virus type. However, none of these methods can detect the integration state of the HPV genome. The ratio of E2/E6 gene expression is currently used to predict HPV integration status, but this method does not allow determination of gene integration sites. The vaginal self-sampling tool user must have a basic cultural level to be able to read and understand the sampling indication map or procedure. The non-random operation or the error operation according to the sampling process not only can not obtain a satisfactory sample, but also brings medical risks, and mild people or serious people can puncture the vaginal mucosa to cause bleeding to cause psychological stress, and can be infected (toxic) shock. In addition, some obese women, anatomically abnormal women and middle-aged and old women with vaginal atrophy need to be considered, so that the method is not suitable for any self-sampling tool, needs to individually select and develop a new collecting tool according to the situation, and has certain limitation. In the urine self-taken sample, the mechanism of the nucleic acid molecules of the HPV virus reaching and existing in the urine is unknown, the background of each research is different, and the HPV detection program and method aiming at the urine currently lack unified standards. Another disadvantage of urine detection is that the HPV nucleic acid molecules are not definitely derived from the initial lesion site, and the diagnosis and prompt significance are controversial.

The HPV-DNA detection technology comprises the steps of HPV-DNA detection by PCR, pathological histology examination, second generation hybrid capture method (HC 2), HPV-DNA analysis by liquid phase hybrid capture, and the current HPV detection means mainly comprise HC2 HPV detection approved by FDA in the United states, cobas4800 full-automatic HPV sample preparation and detection,

E6/E7mRNA HPV detection and the like, and secondly, under the background that the cervical cancer prevention and control are highly valued in China, the speed of local enterprises is acceleratedThe HPV detection field is laid out, and the localization trend of HPV detection products is increasingly obvious. Comprises a Kaemp organism HPV typing detection kit, an HPV nucleic acid detection kit, a human papilloma virus genotyping detection kit of Dada gene, an HPV nucleic acid detection kit of Huada gene and the like. The detection products are partially approved to be on the market and can be used for clinical HPV detection, but most of the methods are based on PCR detection technology, have low sensitivity and specificity, cannot cover all high-risk HPV, or can only accurately classify part of high-risk HPV, and cannot obtain information which is closely related to canceration risks, such as HPV infection subtypes, SNPs, HPV integration states, integration site distribution and the like, and the method is extremely important for cervical cancer risk prediction.

Disclosure of Invention

The present invention aims to overcome the disadvantages of the prior art and provide a method for screening HPV based on menstrual blood DNA.

In order to realize the purpose, the invention adopts the technical scheme that:

the invention provides an HPV screening method based on menstrual blood DNA, which comprises the following steps:

1) Extracting DNA of menstrual blood;

2) Constructing a DNA library with a sequencing linker, and hybridizing the DNA library, the Human Cot-1DNA blocking reagent and the probe to obtain a hybrid product;

3) Adding streptavidin magnetic beads into the hybridization product, and capturing target region DNA;

4) PCR amplification to obtain the upper computer library and sequencing analysis. HPV subtype, SNPs information and HPV integration site information are analyzed.

The accuracy of the TCT detection result popularized at present is influenced by a plurality of factors, for example, a sample is taken 3-7 days after the menstrual period is clean, the menstrual period sample influences the result interpretation, and the sample is not suitable to be collected; sexual intercourse, basin bath, vaginal lavage, local medicine application and the like should be prohibited within 24 hours before sampling; if the drug is administered, the sample must be taken before administration to avoid affecting the results of the examination. Meanwhile, the cervical iodine test, colposcopy and the like also depend on the level and subjective judgment of doctors. Accurate hrHPV genotyping plays a key role in risk stratification and appropriate intervention of hrHPV. Mainstream HC2 HPV detection cannot distinguish between specific HPV subtypes and is relatively low in specificity (20% to 85%). Due to cross-reactivity problems, the false positive rate is about 10% to 19%. The invention innovatively provides a noninvasive self-sampling screening scheme for menstrual blood DNA detection, all gene sequence information of HPV is obtained by an HPV capture sequencing technology for the first time, specific HPV infection types, subtypes and SNPs loci are obtained by comparison, and information such as HPV integration state, integration locus distribution and the like is obtained by comparison with human genome. And performing joint analysis on the information by using an artificial intelligence machine learning model, and accurately pre-judging the cancer progress risk. The method provided by the invention solves the dilemma of missed diagnosis, misdiagnosis and over-treatment faced by the existing screening means, carries out comprehensive and detailed risk stratification and shunting on HPV positive patients, and achieves the purpose of early accurate prevention and treatment of cervical cancer.

In the technical scheme of the invention, the applicant incorporates 120 HPV infected women and collects 137 sanitary napkins for HPV capture sequencing. The results show that the consistency of HPV capture sequencing of menstrual blood and the results of clinical traditional HPV detection is 92.7%. Furthermore, the sensitivity of HPV capture sequencing is even higher to 97.7%. In addition, the advantages of capture sequencing also include the ability to detect additional hrHPV infections and multiple hrHPV infections.

In addition, the existing HPV DNA detection sampling mainly comes from cervical/vaginal cast-off cell samples collected after a sampler is inserted into the vagina, and the HPV DNA of the invention can obtain detection samples only by sampling menstrual blood in a natural period and adopting a DNA extraction technology, thereby having the characteristics of time saving, labor saving, high efficiency and safety.

At present, there is no method for detecting HPV based on menstrual blood DNA combined hybridization capture second-generation sequencing in the market, and the method is different from other methods for hybridization capture in addition to the sample source:

(1) Can detect any HPV infection type, can perform detailed typing on HPV in a sample, including subtype and SNP site identification, and discover a new HPV genotype;

(2) The virus load can be evaluated according to the proportion of the virus reads;

(3) And (4) determining whether the HPV is integrated according to whether an HPV-human breakpoint exists or not, and determining an integration site. Compared with the similar technologies in the market, the HPV capture sequencing technology independently developed by me has better capture performance, sensitivity and specificity. On the basis, HPV subtypes, SNPs types and related integration information obtained by an HPV capture sequencing technology are utilized to establish a cervical cancer risk prediction model for early screening and risk stratification management of HPV related diseases, and a new idea is provided for early accurate prevention and treatment of HPV infection related tumors. The HPV capture sequencing technology developed by the invention can be used for carrying out capture sequencing on different lesion samples and extracting the HPV typing/integration state and SNPs information of the lesion samples.

As a preferred embodiment of the method for screening for HPV based on DNA of menstrual blood according to the present invention, the menstrual blood is obtained by collecting sanitary napkins with menstrual blood.

The invention innovatively provides a noninvasive self-sampling screening scheme of menstrual blood sanitary napkins-express mailing, and under the innovation mode, the sanitary napkins mailed to the next day of menstruation for premenopausal women can participate in screening, so that the medical cost and the related expense for screening are saved, and the convenience for taking in screening is greatly increased. The sanitary towel sampling mode shortens the hospitalizing time, omits complicated procedures, transfers the special medical environment to the home or community of the screener, is not influenced by regions, time, economy and the like, and can quickly cover various crowds in different conditions and areas of city and countryside; meanwhile, the mode of combining the network auxiliary community can help realize efficient, convenient, high-quality and low-cost large-scale crowd screening. Therefore, noninvasive menstrual blood sampling is an effective way for reducing screening cost, reducing screening obstacles, improving screening efficiency and screening coverage rate, and brings a lot of assistance for promoting the prevention and treatment work of cervical cancer in China.

Except for the completely noninvasive urine self-sampling and pad/menstrual blood self-sampling, other self-sampling kit modes, which are developed in hospitals and markets at present, have certain potential risks and hazards because sampling tools are required to be inserted into the vagina. The invention innovatively provides a non-invasive self-sampling screening scheme of menstrual blood sanitary towel-express mailing, and solves the problem that the invasive modes bring discomfort and tension to screeners. The noninvasive menstrual blood sampling mode avoids the collection of cervical exfoliated cell samples (medical sample books) of patients and invasive sampling of self-taken samples in a gynecological examination mode in hospitals by clinicians, and has the capability of greatly improving the screening coverage rate.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, HPV includes at least one of HPV6, HPV11, HPV16, HPV18, HPV26, HPV30, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV60, HPV73 and HPV 82.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, in step 2), the DNA library construction method includes a Tn5 transposase disruption method, an enzymatic disruption method and a mechanical disruption method, and the DNA library construction method includes, but is not limited to, the Tn5 transposase disruption method, the enzymatic disruption method and the mechanical disruption method.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the nucleotide sequence of the linker sequence is shown in SEQ ID NO 1-3; the nucleotide sequence of the probe is shown as SEQ ID NO. 4-23; the nucleotide sequence of the joint primer is shown as SEQ ID NO. 24-25.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the step 1) of extracting menstrual blood DNA includes the steps of:

a. adding a menstrual blood sanitary towel sample into a buffer solution GA and proteinase K for centrifugation to obtain a mixed solution, adding a buffer solution GB into the mixed solution for centrifugation, and then adding absolute ethyl alcohol;

b. b, adding the solution finally obtained in the step a into an adsorption column for centrifugation, adding a buffer solution GD into the adsorption column for centrifugation, adding a rinsing liquid PW after the centrifugation is finished, washing, centrifuging, and taking out the adsorption column;

c. and d, dropwise adding enzyme-free water to the adsorption column taken out in the step b, and centrifuging to obtain the DNA of the menstrual blood.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, in step 1), the fragmented DNA is used in an amount of 50ng.

In a preferred embodiment of the method for screening an HPV based on menstrual blood DNA of the present invention, in the step b, the centrifugation speed is 12000rpm, and the centrifugation time is 30 s-2 min.

In the step 2), the DNA library construction method adopts a DNA library construction method containing an MTn5 Universal sequence, wherein the MTn5 Universal sequence is shown as SEQ ID NO. 26.

In the step 2), a Blocker sequence is also contained in the hybridization process, the Blocker sequence comprises Tn5Blocker 1, tn5Blocker 4, MGI Blocker1 and MGI Blocker 2, and the sequence of the Tn5Blocker 1 is shown in SEQ ID NO: 27; the sequence of Tn5Blocker 4 is shown in SEQ ID NO 28; the sequence of MGI Blocker1 is shown in SEQ ID NO: 30; the sequence of MGI Blocker 2 is shown in SEQ ID NO: 31.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the step 3) further comprises resuspending streptavidin magnetic beads, and the specific steps comprise:

mixing streptavidin magnetic beads uniformly, standing and balancing for 30min, removing the supernatant, adding a washing buffer solution into the magnetic beads for mixing uniformly, resuspending the magnetic beads, removing the supernatant, repeating the resuspension step for multiple times, and finally adding the washing buffer solution to obtain the resuspended streptavidin magnetic beads.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the step of capturing the target region DNA comprises:

adding streptavidin magnetic bead magnetic beads into the hybridization product, then adding a washing solution, uniformly mixing, carrying out magnetic attraction, and removing the supernatant to obtain a mixture; adding preheated washing solution into the mixture, magnetically attracting, adding nuclease-free water, and obtaining a DNA library of a capture target area.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the hybridization time in step 2) is 16-24 h.

As a preferred embodiment of the menstrual blood DNA-based HPV screening method of the present invention, the PCR product obtained in step 3) has a length of 270bp to 320bp.

Information such as HPV primary screening or HPV detection and cervical cytology combined screening, HPV types, infection duration and the like jointly determine the risk of CIN3+, and suggestions of colposcopy, treatment or monitoring are all based on the risk of CIN3+ of patients, so that the infection risk of the patients cannot be stratified by current cytological sampling and morphological observation, and the development of downstream detection technology is limited. The risk of carcinogenesis following HPV infection is closely related to the integration of HPV into the human genome, the distribution of integration sites, and the variant lineage, subline and Single Nucleotide Polymorphisms (SNPs) of infecting HPV. The extracted menstrual blood DNA can be used for downstream multiple detections, such as HPV typing detection, HPV integration detection, whole exon sequencing, whole genome sequencing and other multiple application scenes, key information which is highly related to the canceration progress risk, such as specific HPV pedigrees, subtypes and SNPs sites, HPV integration state and integration site distribution, and the like is obtained, the canceration risk is accurately predicted, and missed diagnosis, misdiagnosis and over-treatment are avoided.

Compared with the prior art, the invention has the following beneficial effects:

the invention innovatively provides a noninvasive self-sampling screening scheme of menstrual blood sanitary towel-express mailing-HPV detection based on HPV capture sequencing technology, and under the innovative mode, premenopausal women can take part in screening by mailing the sanitary towel of the next day of menstruation, so that the medical cost and related expenses of screening are saved, the convenience of taking part in screening is greatly improved, and the individual privacy is effectively protected. The invention obtains all gene sequence information of HPV for the first time through a newly designed HPV capture sequencing technology, further obtains specific HPV infection types, subtypes and SNPs sites through comparison, and obtains information such as HPV integration state, integration site distribution and the like through comparison with human genome. And performing joint analysis on the information by using an artificial intelligence machine learning model, and accurately pre-judging the cancer progress risk. The predicaments of missed diagnosis, misdiagnosis and over-treatment faced by the existing screening means are solved, complete and detailed risk stratification and shunting are carried out on HPV positive patients, and the aim of early accurate prevention and treatment of cervical cancer is fulfilled. In the present invention, the applicant included 120 HPV-infected women in total, and 137 sanitary napkins were collected for HPV capture sequencing. The results show that the consistency of HPV capture sequencing of menstrual blood and the results of clinical traditional HPV detection is 92.7%. Furthermore, the sensitivity of HPV capture sequencing is even higher to 97.7%. In addition, the advantages of capture sequencing also include the ability to detect additional hrHPV infections and multiple hrHPV infections.

Drawings

FIG. 1 is a flowchart of the method for extracting DNA from menstrual blood according to example 1;

FIG. 2 is a flowchart of the menstrual blood DNA-based HPV screening method of example 2.

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments.

In the following examples, the experimental methods used were all conventional methods unless otherwise specified, and the materials, reagents and the like used were commercially available without otherwise specified.

Example 1A method for extracting DNA from menstrual blood

In the embodiment, a noninvasive self-sampling screening scheme of menstrual blood sanitary napkins-express mailing is adopted, and in the innovative mode, premenopausal women mail sanitary napkins of the next day of menstruation.

A method for extracting DNA from menstrual blood comprises the following steps:

1. cutting a 1.5 × 1.5cm piece from the obtained sanitary napkin ² Samples (without clipping) were placed in 1.5ml centrifuge tubes.

2. Adding 1ml of buffer solution GA, soaking at normal temperature for 1h, and sucking the soak solution into a new centrifugal tube of 1.5 ml.

3. Adding 20 mul protease K, vortex vibrating for 10sec, mixing, placing into a constant temperature oscillator preheated to 56 ℃, and vibrating for 1h at 900 rpm.

4. Centrifuge briefly, add 200. Mu.l of buffer GB, shake for 10sec and mix well. Placing the centrifuge tube into a constant temperature oscillator preheated to 70 ℃, and oscillating at 900rpm for 10min. After the incubation period, the tube was centrifuged briefly to remove the droplets from the inner wall of the tube cover.

5. 100. Mu.l of absolute ethanol were added. If the room temperature is over 25 ℃, please put the ethanol on ice for precooling. The sample was mixed by gentle inversion, left at room temperature for 5min and centrifuged briefly to remove droplets on the inner wall of the cap.

6. The solutions obtained in the previous step were all added to an adsorption column CR2 (the adsorption column was placed in a collection tube), centrifuged at 12000rpm (13400 Xg) for 30sec, the waste liquid in the collection tube was discarded, and the adsorption column CR2 was returned to the collection tube.

7. Add 500. Mu.l buffer solution GD (check whether absolute ethanol has been added before use) to the adsorption column CR2, wait 3min (give time for rinse reaction), centrifuge for 30sec at 12000rpm (-13400 Xg), discard the effluent from the collection tube, and place the adsorption column CR2 back into the collection tube (this step is done 2 times, GD rinse 2 times).

8. Adding 700 μ l of rinsing liquid PW (to check whether absolute ethanol is added before use) into the adsorption column CR2, waiting for 3min (giving reaction time to the rinsing liquid), centrifuging at 12000rpm (-13400 Xg) for 1min, discarding the waste liquid in the collection tube, and returning the adsorption column CR2 to the collection tube.

9. Add 500. Mu.l of rinse PW to adsorption column CR2, wait 3min (to give rinse reaction time), centrifuge at 12000rpm (-13400 Xg) for 1min (this step is done 2 times, PW rinse 2 times), discard the collection tube waste.

10. The adsorption column CR2 was returned to the waste liquid collection tube, centrifuged at 12000rpm (13400 Xg) for 2min, and the waste liquid was discarded. The adsorption column CR2 was left uncovered and left at room temperature for 5min to thoroughly dry the residual rinse solution in the adsorption material.

11. Transferring the adsorption column CR2 into a clean centrifuge tube, suspending and dropwise adding 30 μ l of enzyme-free water preheated to 72 ℃ into the middle position of the adsorption membrane, standing at room temperature for 5min (for the time of dissolving the enzyme-free water), centrifuging at 12000rpm (-13400 Xg) for 2min, and collecting the solution into the centrifuge tube (the step is performed for 3 times, namely, the column is washed for 3 times, and the step 2 and the step 3 are performed for 2min at room temperature). The DNA product was stored at-20 ℃ to prevent DNA degradation. The flow chart of the method for extracting DNA from menstrual blood in this example is shown in FIG. 1.

Example 2 a method for screening HPV based on DNA from menstrual blood

This example provides a method for menstrual DNA-based HPV screening (Tn 5 transposase breaks HPV capture sequencing), comprising the following steps:

1. fragmentation enzyme embedding

1.1 dissolving linker sequences (Primer A, primer B, primer C) to 100. Mu.M with non-enzymatic water, wherein Primer A sequence: 5 '-phos-CTGTCTCTCTTATACACATCT-NH 2-3' (shown as SEQ ID NO: 1);

PrimerB sequence: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (shown in SEQ ID NO: 2)

Sequence of primer C: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (as shown in SEQ ID NO: 3);

1.2 the following reaction systems are respectively configured:

reaction 1	Dosage of
		Primer A(100μM)	10μl
Primer B(100μM)	10μl
		Total of	20μl

Reaction 2	Amount of the composition
		Primer A(100μM)	10μl
Primer C(100μM)	10μl
		Total of	20μl

1.3 vortex reaction 1 and reaction 2 respectively, shake the mixture fully and evenly, and the mixture is centrifuged for a short time and placed in a PCR instrument for reaction:

hot lid	On，105℃
		75℃	15min
60℃	10min
		50℃	10min
40℃	10min
		25℃	30min

1.4 after the reaction is finished, mixing the reaction 1 and the reaction 2 in equal volume, uniformly mixing, and storing at-20 ℃;

1.5 linker embedding reaction system:

1.6 lightly beating the mixture for 20 times by using a pipettor and fully mixing the mixture;

1.7 at 30 ℃ for 1 hour, the reaction product is named TTE Mix and stored at-20 ℃.

2. Fragmentation

2.1 Tn5 TAPS 5. Multidot buffer is taken out from minus 20 ℃ in advance, and is placed for more than 30min at room temperature;

2.2 reaction system:

TTE Mix	10μl
		Tn5 TAPS 5*buffer	4μl
TCT DNA(50ng)	1μl
		water (W)	5μl
Total of	20μl

2.3 mix well and incubate on PCR instrument at 55 deg.C for 10min.

3. Terminating the fragmentation reaction

3.1 Add 5. Mu.l of 1% SDS into the system of step 2.3, mix well, incubate 55 ℃ for 7min on PCR instrument.

4. Purification of

4.1 taking the DNA purified magnetic beads to room temperature in advance, shaking, uniformly mixing, and incubating at room temperature for 30min for reuse;

4.2 in the PCR tube after the procedure of 3.1, 1 Xvolume of purified magnetic beads was added, and the reaction system was configured as follows:

3.1 samples at the end of the reaction	25μl
		Purified magnetic beads	25μl

4.3 gently sucking, beating and mixing evenly for 6 times, standing and incubating for 10min at room temperature, and placing the PCR tube on a magnetic frame for 3min to clarify the solution;

4.4 removing the supernatant, continuously placing the PCR tube on a magnetic frame, adding 150 mu l of freshly prepared 80% ethanol solution into the PCR tube, and standing for 30s;

4.5 removing the supernatant, adding 200 mul of 80% ethanol solution into the PCR tube again, standing for 30s, and completely removing the supernatant;

4.6 standing at room temperature for 3-5min to completely volatilize residual ethanol;

4.7 adding 16 mul of clean-free water, gently sucking and beating the heavy suspension magnetic beads, moving away the magnetic frame, and standing for 2min at room temperature;

4.8 placing the PCR tube on a magnetic frame for 2min to clarify the solution;

4.9 pipette 15. Mu.l of the supernatant, transfer to a new PCR tube (on an ice box), mark the reaction tube with the sample number, and prepare for the next reaction.

5.pre-PCR

5.1 And (3) PCR system configuration:

eluted product of step 4.9	15μl
		KOD enzyme	1μl
KOD reaction buffer	25μl
		dNTP mix(10mM each)	1μl
MTn5 Universal(10μM)	4μl
		MTn5 IndexP(10μM)	4μl
Total of	50μl

Wherein, MTn5 Universal sequence: GAACGACATGGCTACGATCCGACTTTCGTCGGCAGCGTC (as shown in SEQ ID NO: 26);

note: each sample was added with a different MTn5 IndexP, for example:

/>

5.2 PCR procedure:

purification after PCR amplification

6.1 preparing DNA purified magnetic beads, standing and balancing at room temperature for 30min, and fully mixing the magnetic beads uniformly before use, wherein the generation of bubbles is avoided;

6.2 adding 50 ul (1X) DNA purification magnetic beads into the PCR tube after the 5.2 reaction, and blowing and mixing the mixture by a pipette;

6.3 incubation at room temperature for 10min, placing the PCR tube on a magnetic frame for 3min to clarify the solution;

6.4 removing the supernatant, continuously placing the PCR tube on a magnetic frame, adding 200 mul of freshly prepared 80% ethanol solution into the PCR tube, and standing for 30s;

6.5 removing the supernatant, adding 200 mul of 80% ethanol solution into the PCR tube again, standing for 30s, and completely removing the supernatant;

6.6 standing at room temperature for 3-5min to completely volatilize residual ethanol; the influence on the subsequent experiment effect is avoided; meanwhile, the phenomenon that the quality of the template is influenced due to excessive drying of the magnetic beads is avoided.

6.7 adding 15 mul of clean-free water, gently sucking and beating the heavy suspension magnetic beads, moving away the magnetic frame, and standing for 2min at room temperature;

6.8 placing the PCR tube on a magnetic frame for 2min to clarify the solution;

6.9 pipette 14. Mu.l of the supernatant, transfer to a new PCR tube (on an ice box), mark the reaction tube with the sample number, and prepare for the next reaction.

6.10 use 1. Mu.l sample

3.0Fluorometer (Qubit dsDNA HS Assay Kit) to determine the library concentration, record the library concentration;

7. hybridization of sample with Probe

7.1 diluting Tn5Blocker 1 (5 '-GAACGACATGGCTACGATCCGACTTTCGTCGGCAGCGTC-phosphate-3' with the sequence shown in SEQ ID NO: 27) and Tn5Blocker 4 (5 '-CTGTCTCTTATACACATCTCCGAGCCCACGAGACIIIIIIIIIIGAAGACAACAACTCCTTGGCTCACA-phosphate-3' with the sequence shown in SEQ ID NO: 28) to 200 μ M, mixing in equal volume to prepare Tn5Blocker 3, uniformly mixing, and placing on ice;

7.2 2X Buffer A was preheated 65 ℃ in advance and held at 65 ℃ until finally added to the reaction system. The reaction system is configured according to the following system:

the HPV probes comprise probes (the sequences are sequentially shown as SEQ ID NO: 4-23) such as HPV6, HPV11, HPV16, HPV18, HPV26, HPV30, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV60, HPV73, HPV82 and the like, and the actual length of the probes is about 200bp fragments which are randomly interrupted.

7.3 sucking with a pipettor or shaking with a vortex oscillator, mixing uniformly, and centrifuging instantaneously;

7.4 incubation in PCR instrument with thermal cycle at 95 ℃ for 5min and hot lid temperature 105 ℃;

7.5 hybridization was performed on a second PCR instrument at 60 ℃ for 16h, with a hot lid temperature of 70 ℃.

8. Streptavidin capture magnetic bead equilibration

8.1 preparing Dynabeads Myone Streptavidin T1 Magnetic Beads, standing and balancing for 30min at room temperature, fully and uniformly mixing Magnetic Beads before use, and taking care to avoid generating a large amount of bubbles;

8.2 for each hybridization reaction, 50. Mu.l of magnetic beads were taken and placed in a new PCR tube, which was placed on a magnetic rack for 1min to clarify the solution, and the supernatant was removed;

8.3 taking down the PCR tube from the magnetic frame, adding 200 mul Wash buffer to gently suck and beat for a plurality of times, mixing evenly, and resuspending the magnetic beads;

8.4 placing on a magnetic frame for 1min, and removing the supernatant;

8.5 repeating the step 7.3-7.4 twice, and cleaning the magnetic beads for 3 times;

8.6 remove the PCR tube from the magnetic frame, add 180. Mu.l of Wash buffer and gently pipette 6 times of the resuspended beads for use.

9. Capturing a target region DNA library

9.1 keeping the hybridization product on a PCR instrument, adding 180 mul of capture magnetic beads in the step 8.6 into the hybridization product, sucking by a pipette for 6 times, uniformly mixing, placing on a rotary mixer, and combining for 30min at room temperature;

9.2 placing the PCR tube on a magnetic frame for 2min to clarify the solution, and removing the supernatant;

9.3 adding 200 μ l of conventional washing solution (from iGeneTech) with no crystal and room temperature into the hybridization product, gently sucking and beating for 6 times for mixing, placing on a constant temperature oscillation mixer for washing at room temperature for 15min (800 r/min), then centrifuging for a short time, placing the PCR tube on a magnetic frame for 2min, clarifying the solution, and removing the supernatant;

9.4 adding 200 μ l of 65 deg.C preheated conventional washing solution (from iGeneTech), gently sucking and beating for 6 times, mixing, placing on constant temperature oscillation mixing instrument, incubating at 65 deg.C for 10min, and washing at 800 r/min; if the cells are placed on a PCR instrument, the cells are taken out every 5min, then are slightly shaken and mixed evenly, and then are immediately placed back to the PCR instrument for continuous incubation.

9.5 briefly centrifuge, place PCR tube on magnetic rack for 2min, remove supernatant. Wash again 2 times using Wash buffer2 for a total of 3 times. Last time, thoroughly removing the Wash buffer2;

9.6 keeping the sample on a magnetic frame, adding 200 mul of freshly prepared 80% ethanol into the PCR tube, standing for 30s, completely removing the ethanol solution, and airing at room temperature;

9.7 Add 20.5. Mu.l of nucleic-free water to the PCR tube, remove the PCR tube from the magnetic stand, and gently pipette 6 times of resuspended beads for use.

post-PCR reaction

10.1 And (3) PCR system configuration:

9.7 products (with capture beads)	20.5μl
		KOD enzyme	1μl
KOD reaction buffer	25μl
		dNTP mix(10mM each)	1μl
MGI PCR primer 1(10μM)	1.25μl
		MGI PCR primer 2(10μM)	1.25μl
Total of	50μl

Wherein, MGI PCR primer1 sequence: 5'-GAACGACATGGCTACGA-3' (as shown in SEQ ID NO: 24).

MGI PCR primer 2 sequence: 5'-TGTGAGCCAAGGAGTTG-3' (as shown in SEQ ID NO: 25)

10.2 adjust the pipettor to 40. Mu.l, gently pipette and mix 6 times, then immediately place on the PCR instrument.

10.3 PCR procedure:

10.4 after the PCR is finished, adding 55 mu l of DNA purification magnetic beads into the sample, and gently sucking and beating the sample for 6 times by using a pipettor and uniformly mixing the mixture;

10.5 incubation at room temperature for 5min, placing the PCR tube on a magnetic frame for 3min to clarify the solution;

10.6 removing the supernatant, continuously placing the PCR tube on a magnetic frame, adding 200 mul of 80% absolute ethyl alcohol, and standing for 30s;

10.7 removing the supernatant, adding 200 mul of 80% absolute ethyl alcohol into the PCR tube, standing for 30s, and completely removing the supernatant;

standing at 10.8 room temperature for 5min to completely volatilize residual ethanol;

10.9 adding 25 μ l of clean-free water, taking down the PCR tube from the magnetic frame, gently blowing and uniformly mixing the heavy suspension magnetic beads, and standing at room temperature for 2min;

10.10 placing the PCR tube on a magnetic frame for 2min;

10.11 sucking 23 mul of supernatant by using a pipette, transferring the supernatant into a 1.5ml centrifuge tube, and marking the information of the sample;

10.12 taking 1 μ l of library and using the Qubit dsDNA HS Assay Kit to carry out quantification, recording the concentration of the library, wherein the concentration of the library is about 1-10ng/μ l;

10.13 taking 3 mul of sample to use gel electrophoresis to measure the fragment length, wherein the library length is between 270bp and 320 bp;

10.14 sequencing was performed using a high throughput sequencing platform.

Example 3 a method for screening HPV based on DNA from menstrual blood

This example provides a method for screening HPV based on menstrual DNA (enzymatic break-down HPV capture sequencing), comprising the following steps:

1. fragmentation, end repair and A-tailing addition

1.1 the amount of DNA added was 200ng, and the reaction system was prepared as follows (this operation was carried out on an ice box):

TABLE 1 end repair, 3' end plus "A" system

1.2, blowing and uniformly mixing by using a pipettor (avoiding violent shaking and uniformly mixing), and putting the PCR tube back on the ice box for later use;

1.3 running a PCR program, setting the parameters of a PCR instrument as follows:

1.4 immediately after completion of the program run, the next ligation reaction was carried out

2. Joint connection

TABLE 2 Joint dilution table

2.1 in the PCR tube of the above step 2 reaction, the reaction system was configured as follows (this operation was carried out on an ice box):

TABLE 3 connection System

2.2 the PCR tubes were placed on a PCR machine with the reaction program 22 ℃ for 15min, the PCR machine without a hot lid, and then stored at 12 ℃.

3. Post-ligation purification

3.1 taking the Agencour AMPureXP magnetic beads to room temperature in advance, shaking, uniformly mixing, and incubating at room temperature for 30min for reuse;

3.2 in the PCR tube after the procedure of step 2, the experiment was performed with 0.8 × volume of purified magnetic beads, and the reaction system was configured as follows:

TABLE 4 magnetic bead purification System

3.3 gently sucking, beating and mixing for 6 times, standing and incubating at room temperature for 5-15min, and placing the PCR tube on a magnetic frame for 3min to clarify the solution;

3.4 removing the supernatant, placing the PCR tube on a magnetic frame, adding 200 μ l of freshly prepared 80% ethanol solution (no more than 1 week at most) into the PCR tube, and standing for 30s;

3.5 remove the supernatant, add again 200. Mu.l 80% ethanol solution into the PCR tube, remove the supernatant thoroughly after standing for 30s (it is recommended to use a 10. Mu.l pipette to remove the bottom residual ethanol solution);

3.6 standing at room temperature for 3-5min to completely volatilize residual ethanol; the influence on the subsequent experiment effect is avoided; meanwhile, the phenomenon that the quality of the template is influenced due to excessive drying of the magnetic beads is avoided.

3.7 adding 22 mul of clean-free water, gently sucking and beating the heavy-suspension magnetic beads, moving away the magnetic frame, and standing for 2min at room temperature;

3.8 placing the PCR tube on a magnetic frame for 2min to clarify the solution;

3.9 pipette 20. Mu.l of the supernatant (after the bead elution, the supernatant is not aspirated) and transfer to a new PCR tube (on an ice box), mark the sample number on the reaction tube, and prepare for the next reaction.

Pre-PCR reaction

4.1 taking out 2X PCR Master Mix, PCR Index Primer and Universal PCR Primer from the kit preserved at-20 ℃ in advance, putting the mixture on an ice box for dissolving, and putting the mixture on ice for later use after uniformly mixing;

4.2 depending on the type of Index chosen, the formulation was carried out selectively with reference to the following system (this operation was carried out on ice-boxes):

TABLE 5 Pre-PCR System

The sequence of the Universal PCR Primer is 5-phos/GAACGACATGGCTACGA-3 (shown in SEQ ID NO: 29);

note: each sample was added with a different PCR Index Primer for MGI, for example:

/>

4.3 gently blowing and beating the mixture by using a pipettor, and then centrifuging the mixture for a short time;

4.4 Place the sample on the PCR machine and start the PCR procedure as follows:

4.5 The number of PCR cycles was adjusted depending on the amount of DNA put, and the reference data are as follows:

TABLE 6 Pre-PCR cycle number reference

4.6 the purification of the beads was performed immediately after the program run was completed.

Purification after PCR amplification

5.1 preparing Purification Beads, standing and balancing for 30min at room temperature, and fully and uniformly mixing magnetic Beads before use, wherein a great amount of bubbles are avoided;

5.2 adding 50 mul (1 x) Agencour AMPureXP purified magnetic beads into the PCR tube reacted in the step 4, and blowing and uniformly mixing by using a pipette;

5.3 incubation at room temperature for 5-15min, placing the PCR tube on a magnetic frame for 3min to clarify the solution;

5.4 removing the supernatant, continuously placing the PCR tube on a magnetic frame, adding 200 mu l of freshly prepared 80% ethanol solution into the PCR tube, and standing for 30s;

5.5 remove the supernatant, add 200. Mu.l 80% ethanol solution into the PCR tube again, remove the supernatant thoroughly after standing for 30s (it is recommended to use a 10. Mu.l pipette to remove the residual ethanol solution at the bottom);

5.6 standing at room temperature for 3-5min to completely volatilize residual ethanol; the influence on the subsequent experiment effect is avoided; meanwhile, the magnetic beads are prevented from being excessively dried, and the quality of the template is influenced (the drying time is related to the humidity of the room temperature of an experiment, the color of the magnetic beads can be observed during drying, the color is slightly darker and glossy when liquid is remained, and the color can become lighter and matte after the liquid is volatilized).

5.7 adding 15 mul of clean-free water, slightly sucking and beating the heavy suspension magnetic beads, moving the magnetic frame away (in the process of eluting the magnetic beads, when eluent is added, a centrifuge tube is ensured to be on the magnetic frame, so that the magnetic beads after leaving the magnetic frame and being dried are prevented from flying away to cause sample loss), and standing for 2min at room temperature;

5.8 placing the PCR tube on a magnetic frame for 2min to clarify the solution;

5.9 pipette up 14. Mu.l of the supernatant (after the bead elution, the bead is not aspirated when the supernatant is aspirated), transfer the supernatant to a new PCR tube (on an ice box), mark the reaction tube with a sample number, and prepare for the next reaction.

5.10 use 1. Mu.l sample

3.0Fluorometer (Qubit dsDNA HS Assay Kit)Library concentration determination, recording library concentration, as required for downstream liquid phase capture>57.7ng/μl；

6. Hybridization of sample with Probe

6.1 library preparation

1) MGI Blocker1 (shown in SEQ ID NO:30, GAACGACATGGCTACGATCCGACTT) and MGI Blocker 2 (shown in SEQ ID NO:31,

AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAIIIIIIIIIICAACTCCTTGGCTCACA) to 200 μ M, mixing in equal volume to obtain MGI Blocker 3, dissolving MGI Blocker 3 and human Cot-I DNA in ice box, and placing on ice or 4 deg.C;

2) A reaction system is configured according to the following system, and 2X Buffer A needs to be preheated in advance at 65 ℃ and cannot be cooled to normal temperature;

TABLE 7 one-tube hybridization System

3) Sucking with a pipettor or oscillating with a vortex oscillator, mixing, and centrifuging instantly;

4) Performing thermal cycle incubation on a PCR instrument at 95 ℃ for 5min and a hot cover temperature of 85 ℃;

5) Hybridization was performed on a PCR instrument at 60 ℃ for 16h, with a hot lid temperature of 70 ℃.

7. Streptavidin capture magnetic bead equilibration

7.1 preparing Dynabeads Myone Streptavidin T1 Magnetic Beads, standing and balancing for 30min at room temperature, fully and uniformly mixing Magnetic Beads before use, and taking care to avoid generating a large amount of bubbles;

7.2 taking 50 mul of magnetic beads, placing the magnetic beads in a new PCR tube, placing the tube on a magnetic frame for 1min to clarify the solution, and removing the supernatant;

7.3 taking down the PCR tube from the magnetic frame, adding 200 mu l G-BB, gently sucking for several times, mixing uniformly, and resuspending the magnetic beads;

7.4 placing on a magnetic frame for 1min, and removing the supernatant;

7.5 repeating the step 3-4 twice, and cleaning the magnetic beads 3 times in total;

7.6 remove the PCR tube from the magnetic frame, add 200. Mu. l G-BB and gently pipette 6 times of the resuspended beads for use.

8. Capturing a target region DNA library

8.1 keeping the hybridization product on a PCR instrument, adding 180 mul of capture magnetic beads after the heavy suspension in the step 7.6 into the hybridization product, sucking and beating for 6 times by using a pipette, uniformly mixing, placing on a rotary mixer, and combining for 30min at room temperature;

8.2 placing the PCR tube on a magnetic frame for 2min to clarify the solution, and removing the supernatant;

8.3 Add 200. Mu.l of non-crystallizing, room temperature wash (from iGeneTech, G-WB 1) to the hybridization product, gently pipette 6 times and mix, transfer to a new tube (non-specific product will stick to the tube wall). Cleaning in a rotary mixer for 15min (normal temperature or 37 deg.C, rotation speed not more than 10 rpm), centrifuging for a short time, placing PCR tube on a magnetic frame for 2min to clarify the solution, and removing the supernatant;

8.4 adding 200 μ l of 65 deg.C preheated washing solution (from iGeneTech, G-WB 2), gently sucking and beating for 6 times, mixing (or slightly shaking and mixing, centrifuging for a short time, and paying attention to that the magnetic beads do not precipitate), placing on a constant temperature shaking and mixing instrument, incubating at 65 deg.C for 10min, and washing at 800 r/min; if the cells are placed on a PCR instrument, the cells are taken out every 5min and then gently shaken and mixed, and then immediately placed into the PCR instrument for continuous incubation (keeping the temperature at 65 ℃).

8.5 briefly centrifuge, place PCR tube on magnetic rack for 2min, remove supernatant. The washing was performed 2 times again using G-WB2 for a total of 3 times. The final thorough removal of wash solution (from iGeneTech, G-WB 2) (residues can be removed with a 10. Mu.l pipette);

8.6 keeping the sample, adding 200 mul of freshly prepared 80% ethanol into the PCR tube on a magnetic frame, standing for 30s, completely removing the ethanol solution (the residue can be removed by using a10 mul pipette), and airing at room temperature;

8.7 Add 22.5. Mu.l of Nuclear-free water to the PCR tube, remove the PCR tube from the magnetic stand, and gently pipette 6 times the resuspended beads for use.

post-PCR reaction

9.1 taking out 2 XPCR Master Mix and MGI PCR primer 1/2 (20. Mu.M) from the kit stored at-20 ℃, placing the mixture on ice for dissolving, and placing the mixture on ice for standby after dissolving and mixing;

9.2 prepare the reaction system according to the following table:

TABLE 8 Post-PCR System

The sequence of MGI PCR primer1 is shown in SEQ ID NO:24 (GAACGACATGGCTACGA);

the sequence of MGI PCR primer 2 is shown in SEQ ID NO:25 (TGTGAGCCAAGGAGTTG).

9.3 adjust the pipettor to 40. Mu.l, gently pipette and mix 6 times, then immediately place on the PCR instrument.

9.4 run PCR Instrument program:

TABLE 9 number of PCR reaction reference cycles for post-capture products

9.5 Adding 55 mu l of Agencourt AMPureXP magnetic beads into the sample after the PCR is finished, and gently sucking and beating the sample for 6 times by using a pipettor and uniformly mixing the mixture;

9.6 incubation at room temperature for 5min, placing the PCR tube on a magnetic frame for 3min to clarify the solution;

9.7 removing the supernatant, continuously placing the PCR tube on a magnetic frame, adding 200 mul of 80% absolute ethyl alcohol, and standing for 30s;

9.8 removing the supernatant, adding 200 μ l of 80% absolute ethanol into the PCR tube, standing for 30s, and completely removing the supernatant (removing residual ethanol at the bottom by using a10 μ l pipette);

9.9 standing at room temperature for 5min to completely volatilize residual ethanol;

9.10 adding 25. Mu.l of clean-free water, taking down the PCR tube from the magnetic frame, gently blowing and uniformly mixing the heavy suspension magnetic beads, and standing at room temperature for 2min;

9.11 placing the PCR tube on a magnetic frame for 2min;

9.12 using a pipette to suck 23 mu l of supernatant fluid and transferring the supernatant fluid to a 1.5ml centrifuge tube, and marking the information of the sample;

9.13 taking 1 μ l of library and using the Qubit dsDNA HS Assay Kit to carry out quantification, recording the concentration of the library, wherein the concentration of the library is about 1-10ng/μ l;

9.14 fragment length measurements were performed on 1. Mu.l samples using the Agilent2100Bioanalyzer system (Agilent DNA1000 Kit) with library lengths ranging from about 270bp to 320 bp;

9.15 sequencing was performed using a high throughput sequencing platform.

The method for extracting the DNA of the menstrual blood has the advantages of no wound, wide applicable crowd range, convenience, rapidness, privacy protection and the like, and specifically comprises the following steps: present cervical carcinoma sampling technique all has the sample of invasiveness, and this patient of doctor's sample needs doctor to expose the cervix with peeping the external genitals, then carries out the rotation in the cervical orifice with the sample brush and gathers the sample, sends the laboratory in the sampling tube of later addition cell preservation liquid and detects. The existing self-taking sample is also a condition that certain medical general knowledge and culture background need to be mastered, satisfactory samples cannot be obtained without random operation or wrong operation according to a sampling flow, medical risks are brought, and mucous membrane damage or bleeding infection is seriously caused. The cervical cancer screening method is derived from noninvasive sampling of menstrual blood, does not need any invasive sampling, does not need a screener to read obscure medical terms, and can realize cervical cancer screening only by cutting sanitary napkins during regular menstruation and storing the sanitary napkins in a sealed bag for mailing. In the existing self-sampling technology, some obese women, anatomically abnormal women and old women with vaginal atrophy can not be suitable for any self-sampling tool, and a new acquisition tool needs to be individually selected and developed according to the situation. The universality of premenopausal female menstrual blood sampling (noninvasive self-sampling by adopting 'menstrual blood sanitary towel-express mail') is very suitable for people who participate in cervical cancer screening in the past year and need HPV follow-up visit, HPV vaccine reserved inoculation, people who do not have HPV detection, people who have cervical cancer screening consciousness, people who are inconvenient to come to the hospital for detection and large-scale group detection. The menstrual blood self-sampling technology can improve the acceptance of cervical cancer screening, the self-sampling reduces the cost of patients in transportation and medical treatment, the convenience is high, the sampling place is selected by self, and the patients have stronger privacy and self-perception. It was found that women who were positive for HPV sampling would prefer to return to the hospital for further screening or colposcopy. Nowadays, networks and informatization are highly developed, HPV self-sampling technology and the Internet are jointly applied, and sampling convenience is improved. In a word, "the menstrual blood DNA self-sampling" greatly increases the convenience of taking part in screening, saves the screening cost, enables the screening to cover the people to be screened, solves the problem of insufficient technical strength, enables the screening to be developed in low-resource areas, and further improves the cervical cancer prevention and control strength.

The screening method adopts a menstrual blood DNA-HPV liquid phase hybridization capture sequencing method, can avoid the generation of redundant sequencing data compared with whole genome sequencing, saves a large amount of time and cost, and has the following advantages compared with the current clinical HPV detection means based on hybridization and PCR:

1) Any HPV infection type can be detected;

2) Can carry out detailed typing on HPV in a sample, including subtype and SNP locus identification, and discover new HPV genotypes;

3) The virus load can be evaluated according to the proportion of the virus reads;

4) And (4) determining whether the HPV is integrated according to whether an HPV-human breakpoint exists or not, and determining an integration site.

5) Compared with the existing HPV capture sequencing technology, the research is superior to similar products in the market in capture performance (capture efficiency and target area coverage uniformity), sensitivity and specificity based on menstrual blood HPV DNA, and a probe synthesis technology is independently developed, so that probes can be designed and synthesized aiming at common high-risk HPV types and suspected high-risk HPV types, the probes have higher capture efficiency, a chip synthesis platform is not required to be relied on, the cost, the period and the platform limit of an HPV molecular diagnosis kit are greatly reduced, and the rapid popularization to the early-screening market is facilitated.

In the present invention, the applicant included 120 HPV infected women and collected 137 sanitary napkins for HPV capture sequencing. The results show that the consistency of HPV capture sequencing of menstrual blood and the results of clinical traditional HPV detection is 92.7%. Furthermore, the sensitivity of HPV capture sequencing is even higher to 97.7%.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A menstrual blood DNA-based HPV screening method is characterized by comprising the following steps:

1) Extracting DNA of menstrual blood;

2) Constructing a DNA library with a sequencing joint, and hybridizing the DNA library, a Human Cot-1DNA blocking reagent and a probe to obtain a hybridization product;

3) Adding streptavidin magnetic beads into the hybridization product to capture the DNA of the target area;

4) PCR amplification to obtain the upper computer library and sequencing analysis.

2. The HPV screening method of claim 1, wherein the menstrual blood is obtained by collecting sanitary napkins carrying menstrual blood.

3. The HPV screening method of claim 1, wherein the HPV comprises at least one of HPV6, HPV11, HPV16, HPV18, HPV26, HPV30, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV60, HPV73, HPV 82.

4. The HPV screening method of claim 1, wherein the DNA library constructing method in step 2) comprises Tn5 transposase disruption, enzymatic disruption, and mechanical disruption.

5. The HPV screening method as claimed in claim 1 wherein the linker sequence has the nucleotide sequence shown in SEQ ID NO 1-3.

6. The HPV screening method of claim 1, wherein the probe has a nucleotide sequence as set forth in SEQ ID NOS 4-23.

7. The HPV screening method of claim 1, wherein the adapter primer has a nucleotide sequence as set forth in SEQ ID NOS 24-25.

8. The HPV screening method of claim 1, wherein the extracting DNA of menstrual blood in the step 1) comprises the steps of:

9. The HPV screening method as claimed in claim 1, wherein the DNA library constructing method in step 2) adopts a DNA library containing MTn5 Universal sequence, and the MTn5 Universal sequence is shown in SEQ ID NO. 26.

10. The HPV screening method as claimed in claim 1, wherein in the step 2), the hybridization process further comprises a Blocker sequence, the Blocker sequence comprises Tn5Blocker 1, tn5Blocker 4, MGI Blocker1 and MGI Blocker 2, and the sequence of the Tn5Blocker 1 is shown as SEQ ID NO: 27; the sequence of Tn5Blocker 4 is shown in SEQ ID NO 28; the sequence of MGI Blocker1 is shown in SEQ ID NO: 30; the sequence of MGI Blocker 2 is shown in SEQ ID NO 31.

11. The HPV screening method of claim 1, wherein the step of capturing the target region DNA comprises:

adding streptavidin magnetic beads into the hybridization product, then adding washing liquid, uniformly mixing, carrying out magnetic attraction, and removing the supernatant to obtain a mixture; adding preheated washing liquid into the mixture, magnetically attracting, and adding nuclease-free water to obtain the DNA of the capture target area.

12. The HPV screening method of claim 1, wherein the time for hybridization in step 2) is 16 to 24 hours.

13. The HPV screening method of claim 1, wherein the PCR product obtained in step 3) is 270bp to 320bp in length.