CN115948550A

CN115948550A - Marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof

Info

Publication number: CN115948550A
Application number: CN202211455208.3A
Authority: CN
Inventors: 吴艳; 王磊
Original assignee: Yixing Peoples Hospital
Current assignee: Yixing Peoples Hospital
Priority date: 2022-11-21
Filing date: 2022-11-21
Publication date: 2023-04-11

Abstract

The invention provides a marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof, belonging to the technical field of molecular biological detection. The nucleotide sequence of the marker tRF-Gly-CCC-1-M4 for detecting the prostatic cancer provided by the invention is shown in SEQ ID NO. 1. Compared with normal prostate tissue, the relative expression content of tRF-Gly-CCC-1-M4 in prostate cancer tissue cells is obviously increased. By detecting the tRF-Gly-CCC-1-M4, the proliferation state of the prostate cancer can be accurately judged, and a new way is provided for diagnosing the prostate cancer.

Description

Marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof

Technical Field

The invention relates to the technical field of molecular biology detection, in particular to a marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof.

Background

Prostate cancer refers to epithelial malignant tumor that occurs in prostate, and the current method for detecting prostate cancer cell proliferation is usually judged by serum PSA detection. However, in the process of wide application, the detection method is found to have poor specificity and insufficient sensitivity, and cannot distinguish severe prostate inflammation and prompt early prostate cancer cell proliferation. Although detection methods such as ultrasound and nuclear magnetic resonance are supplementary, these methods still have the above-mentioned disadvantages. Therefore, the search for markers with high sensitivity and strong specificity to detect the proliferation of prostate cancer cells has become a hot spot of medical research.

The 2016 Nature Genetics journal reports that tRNA is a highly abundant, ubiquitous, passively involved mRNA decoder and protein translation element. tRNA significantly affects biological processes and disease progression by binding its anticodon to the codon of mRNA. Meanwhile, the high abundance of tRNA in body fluid makes tRNA become a biomarker for clinical application and can be applied to the detection of tumor proliferation and metastasis. A review by Pan Jiang et al in the journal of Current medical Chemistry in 2019 reports that tRFs and TiRNAs are small fragments of RNA of a specific size that are cleaved by specific nucleases (e.g., dicer, angiogenin) in the loop of tRNA under specific conditions such as in specific cells/tissues or under stress on cells. tRFs and tirRNAs belong to a class of small non-coding RNAs, collectively referred to as tsRNAs. tRFs are classified as tRF-1, tRF-2, tRF-3, tRF-5 and i-tRF; and the tiRNA is divided into 5'tiRNA and 3' tiRNA. tRFs and TiRNAs play important roles in inhibiting protein synthesis, regulating gene expression, initiating viral reverse transcriptase, and regulating DNA damage response, and are functional units of tRNA's. With the development of molecular biology, research aiming at tsRNA is expected to provide a new way for the diagnosis and treatment of prostate cancer.

Disclosure of Invention

The invention aims to provide a marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof. tRF-Gly-CCC-1-M4 belongs to tsRNA, is derived from tRNA-Gly-CCC-1, and belongs to the tRF-5c class. Compared with normal prostate tissue, the relative expression content of tRF-Gly-CCC-1-M4 in prostate cancer tissue cells is obviously increased. By detecting tRF-Gly-CCC-1-M4, the proliferation state of the prostatic cancer can be accurately judged, and a new way is provided for diagnosing the prostatic cancer.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a marker tRF-Gly-CCC-1-M4 for detecting prostate cancer, wherein the nucleotide sequence of the marker is shown in SEQ ID NO. 1.

The invention also provides a primer pair for detecting the marker, wherein the sequence of the upstream primer is shown as SEQ ID NO.2, and the sequence of the downstream primer is shown as SEQ ID NO. 3.

The invention also provides application of the marker or the primer pair in preparation of a reagent or a kit for detecting prostate cancer.

Preferably, the detection sample of the reagent or the kit comprises a prostate cell strain, fresh prostate tissue, punctured prostate tissue, fresh urine, fresh prostate massage solution or blood.

The invention also provides a kit for detecting prostate cancer, which comprises the primer pair of claim 2.

Preferably, the control sample in the kit is a human prostate hyperplasia cell line.

The invention provides a marker tRF-Gly-CCC-1-M4 for detecting prostate cancer and application thereof. tRF-Gly-CCC-1-M4 belongs to tsRNA, is derived from tRNA-Gly-CCC-1, consists of nucleotides from 1 st to 28 th at the 5' end of the tRNA, and M represents multiple alignment due to high overlap ratio of tRNA sequences, wherein M4 indicates that the tRF-Gly-CCC-1 fragment can be aligned to 4 on the tRNA, and the nucleotide sequence of the tRF-Gly-CCC-1 fragment is shown in SEQ ID NO.1 (GCATTGGTGGTTCAGTGGTAGAATTCTC) and belongs to tRF-5c type. Compared with normal prostate tissue, the relative expression content of tRF-Gly-CCC-1-M4 in prostate cancer tissue cells is obviously increased. By using tRF-Gly-CCC-1-M4 as a marker and detecting the relative expression content of the tRF-Gly-CCC-1-M4, the proliferation state of the prostate cancer can be accurately and reliably detected, and the occurrence of the prostate cancer and the deterioration degree of the prostate cancer can be better diagnosed.

Drawings

FIG. 1 is a graph showing the relative expression levels of tRF-Gly-CCC-1-M4 in the TEST sample and the Control sample in example 1, wherein Control is the Control sample and TEST is the TEST sample.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Example 1

This example demonstrates the accuracy of diagnosing prostate cancer by detecting the marker tRF-Gly-CCC-1-M4. The specific operation is as follows:

1. extraction of RNA from test sample

Fresh prostate tissue from the subsidiary hospital of Yangzhou university was collected as a test specimen during the period from 10 months to 1 month in 2022, and immediately stored in a refrigerator at-80 ℃. During detection, the collected fresh prostate tissue is taken out, and RNA extraction is carried out after the prostate tissue is unfrozen at room temperature, and the specific operation is as follows:

1.1 preparation of homogenate samples

Fresh prostate tissue was ground, dissolved in distilled water, shaken, and centrifuged at 7500 rpm for 5 minutes at 4 ℃ to obtain precipitated cells. The cell lysis was performed by repeatedly beating the cells with 1ml of TRI REAGENT REAGENT (purchased from Saimer Feishell science, china) per gram of the precipitated cells and adding the TRI REAGENT REAGENT to lyse the cells, thereby obtaining a homogenate sample.

1.2 two-phase separation

The homogenate sample obtained in 1.1 was incubated at 25 ℃ for 5 minutes to allow complete dissociation of the nucleic acid-protein complex. 0.2ml of chloroform (available from Shanghai chemical Co., ltd.) was added to 1ml of the homogenized sample of the TRI REAGENT REAGENT, and chloroform was added to the dissociated homogenate and the cap was closed. After shaking the tube vigorously by hand for 15 seconds, the tube was incubated at 25 ℃ for 3 minutes, and after the incubation was completed, it was centrifuged at 12000 rpm for 15 minutes at 4 ℃. The mixed liquid after centrifugation is layered and divided into a lower red phenol chloroform phase, an intermediate layer and an upper colorless water phase. The RNA is now totally partitioned in the aqueous phase. The volume of the aqueous phase was 60% of the TRI REAGENT REAGENT added during homogenization.

1.3RNA precipitation

The aqueous phase from 1.2 was transferred to a fresh centrifuge tube. To this new tube was added isopropanol in an amount of 50% of the amount of TRI REAGENT added for 1.1 sample homogenization. The aqueous phase and isopropanol were mixed, mixed and incubated at 25 ℃ for 10 minutes to precipitate the RNA therein. After the incubation, the cells were centrifuged at 12000 rpm for 10 minutes at 4 ℃. At this point, the invisible RNA pellet formed a gelatinous pellet on the bottom and side walls of the tube prior to centrifugation.

1.4RNA Wash

The supernatant in 1.3 was removed and 75% ethanol (made with DEPC water available from Shanghai Philips, industrial science, inc.) was added to the remaining pellet in the same amount as the TRI REAGENT REAGENT was added to the 1.1 sample homogenate. After washing the RNA pellet with shaking, it was centrifuged at 7500 rpm for 5 minutes at 4 ℃.

1.5 resolubilizing the RNA pellet

The ethanol solution was removed and the RNA pellet was air dried for 10 minutes. At this point the RNA pellet was not completely dried, ensuring RNA solubility. When dissolving RNA, 1mL of DEPC water was added and the mixture was repeatedly blown with a gun several times, and then incubated at 60 ℃ for 10 minutes to obtain an RNA solution of a sample to be detected. The RNA solution was stored at-70 ℃.

1.6RNA concentration and purity assays

By UV absorption measurement using

ND-1000 RNA concentration and purity were determined, and RNA detection was performed after zeroing the surface of the measurement base with RNA-dissolved DEPC water before measurement. And (3) dropwise adding 1 mu L of the RNA solution obtained in the step (1.5) onto the surface of a measuring base, automatically forming a liquid column between the upper base and the lower base by the liquid drop, automatically completing measurement, and automatically generating files of various parameters of the RNA concentration and the RNA quality in a computer.

Determination of RNA concentration: a reading at 260nm of 1 indicates 40ng RNA/. Mu.L. The formula for calculating the RNA concentration of the sample is as follows: a. The ₂₆₀ (reading). Times.40 ng/. Mu.L.

RNA purity determination: a. The ₂₆₀ /A ₂₈₀ The ratio of (A) to (B) represents the RNA purity.

2. Extraction of control sample RNA

The RNA extraction was performed using BPH-1 human prostate hyperplasia cell line (purchased from Shanghai Bin ear Biotech Co., ltd.) as a control sample, and the specific procedures were as follows:

control samples were centrifuged at 7500 rpm for 5 minutes at 4 ℃ to obtain pelleted cells. Using 1ml of TRI REAGENT REAGENT per gram of precipitated cells, adding the TRI REAGENT REAGENT, and repeatedly blowing to crack the cells. The operation is repeated 1.2 to 1.5 times for the homogenized sample, and the RNA solution of the control sample is obtained. To reduce the viscosity of the solution, the samples were passed twice through a 26-gauge needle to shear genomic DNA prior to the addition of chloroform. Before precipitating RNA by adding isopropanol, 10. Mu.g of RNase-free glycogen was added as a carrier in the aqueous phase, and after separating the two phases, glycogen remained in the aqueous phase and co-precipitated with RNA.

RNA concentration and purity measurements were performed according to 1.6.

Pretreatment of RNA and cDNA Synthesis

Respectively carrying out RNA pretreatment and cDNA synthesis on the RNA solution of the detection sample and the RNA solution of the control sample, and specifically operating as follows:

reagents and raw materials:

rtStar ^TM tRF&tiRNA Pretreatment Kit(Cat#AS-FS-005)、rtStar ^TM First-Strand cDNA Synthesis Kit (3 and 5' adaptor) (Cat # AS-FS-003) was purchased from Arraystar, USA.

Other relevant reagents were purchased from Saimer Feishell science (China) Inc.

3.1 3' terminal deacetylation treatment

A deacetylation reaction solution was prepared according to the system shown in Table 1, vortexed, and incubated at 37 ℃ for 40 minutes. After the incubation was completed, 19. Mu.L of deacetylation Stop buffer (purchased from Saimer Feishhl technology (China)) was sequentially added thereto, vortexed, and incubated at room temperature for 5 minutes to terminate the deacetylation reaction.

TABLE 1 deacetylation reaction solution

Sample RNA	5μg
		Deacylation reaction buffer (5X)	3uL
SUPERase·In ^TM RNase inhibitors	1μL
		Nuclease-free water	Make up to a total volume of 15 μ L

3.2 removal of 3'-cP and addition of 5' -P

The reaction solution after 3.1-time termination of the reaction was placed on ice, and the reagents shown in Table 2 were added in this order, whereby the total volume of the reaction solution was 50. Mu.L. The reaction solution was vortexed, incubated at 37 ℃ for 40 minutes, and after completion of incubation, incubated at 70 ℃ for 5 minutes to terminate the reaction. After the reaction was terminated, RNA was re-extracted.

TABLE 2 reaction reagents

Terminal Enzyme Reaction buffer (10X)	5μL
		10mM ATP	5μL
Terminal Enzyme Mix	3U(1μL)
		Nuclease-free water	5μL

3.3 Demethylation treatment

A Demethylation reaction solution was prepared according to the system shown in Table 3, and the reaction solution was incubated in a water bath at 37 ℃ for 2 hours, followed by addition of 40. Mu.L of nuclease-free water and 10. Mu.L of Demethylation Stop buffer (5X) to terminate the Demethylation reaction. After the reaction was terminated, RNA was re-extracted.

TABLE 3 demethylation reaction solution

Demethylation Reaction buffer (5X)	10μL
		Demethylase	5μL
SUPERase·In ^TM RNase inhibitors	1μL
		Input RNA	5μg
Nuclease-free water	Make up to a total volume of 50 μ L

3.4 connecting 3' joints

The reagents shown in Table 4 were added to 200. Mu.L of RNase-free PCR tube in this order, the PCR tube was incubated at 70 ℃ for 2 minutes, then the PCR tube was transferred to ice, 5. Mu.L of 3'ligation Reaction buffer (2X) and 1.5. Mu.L of 3' ligation Enzyme Mix were further added, and at this time, the total volume in the PCR tube was 10. Mu.L, and then the PCR tube was incubated at 25 ℃ for 1 hour.

TABLE 4 reaction reagents

RNA sample solution after 3.3 treatment	2μL
		3’Adaptor	0.5μL
RNA Spike-in	0.5μL
		Nuclease-free water	Make up to a total volume of 3.5. Mu.L

3.5 reverse transcription primer hybridization

After the end of 3.4 incubation, 2.3. Mu.L of nuclease-free water and 0.5. Mu.L of Reverse Transcription Primer (Reverse Transcription Primer) were sequentially added to the PCR tube, and the total volume in the PCR tube was 12.8. Mu.L, the PCR tube was transferred to a thermal cycler and incubated at 75 ℃ for 5 minutes, 37 ℃ for 15 minutes and 25 ℃ for 15 minutes, respectively.

3.6 connecting 5' joints

To the PCR tube after completion of 3.5 incubation, 0.5. Mu.L of 5' adapter (denatured), 0.5. Mu.L of 5' ligation Reaction buffer solution and 1.2. Mu.L of 5' ligation Enzyme Mix were sequentially added, and at this time, the total volume in the PCR tube was 15. Mu.L, and the mixture was thoroughly mixed, transferred to a thermal cycler, and incubated at 25 ℃ for 1 hour.

3.7 reverse transcription reaction

According to the reaction system shown in Table 5, the reagents in Table 5 were sequentially added to 200. Mu.L of nuclease-free PCR tube, the PCR tube was transferred to a thermal cycler, incubated at 50 ℃ for 1 hour, and immediately cooled on ice to obtain cDNA of the test sample and cDNA of the control sample, respectively, for subsequent PCR amplification.

TABLE 5 reaction System

Adaptor Ligated RNA	15μL
		First-Strand Synthesis Reaction buffer	4μL
SUPERase·In ^TM RNase inhibitors	0.5μL
		Reverse Transcriptase	0.5μL
Total volume	20μL

4. Real-time quantitative PCR detection

Reagents and materials: reagent 2X PCR mastermix (AS-MR-006-5) was purchased from Arraystar, USA; primer design software is Primer 5.0; quantStaudio ^TM 5 Real-time PCR System (Applied Biosystems) was purchased from Applied Biosystems, USA.

4.1 preparation of gradient diluted DNA templates for Standard Curve construction

The reagents were mixed according to the reaction system shown in Table 6. Wherein, the PCR specific primer F is: 5 'ATCGCCGGCTAGCTCAGT-3' (shown as SEQ ID NO. 2); the PCR specific primer R is: 5-; the annealing temperature of the primer was 60 ℃.

The solution was mixed by flicking the bottom of the tube, centrifuged briefly at 5000 rpm and subjected to PCR reaction. The PCR reaction program is: at 95 ℃ for 10min;40 PCR cycles (95 ℃ C., 10 sec; 60 ℃ C., 60 sec (fluorescence collection)). And (3) carrying out 2% agarose gel electrophoresis on the PCR product and 100bp DNA Ladder, staining by ethidium bromide, and detecting whether the PCR product is a single specific amplification band.

TABLE 6 reaction System

PCR products were diluted in 10-fold gradients: the concentration of PCR product was set to 1, and the dilution was 1X 10 ^-1 ，1×10 ^-2 ，1×10 ^-3 ，1×10 ^-4 ，1×10 ^-5 ，1×10 ^-6 ，1×10 ^-7 ，1×10 ^-8 ，1×10 ^-9 。

4.2 performing Realtime PCR reaction

According to Table 6, the reagents except the cDNA template were mixed, supplemented with water to a total volume of 8. Mu.L, the solutions were mixed by flicking the bottom of the tube, centrifuged briefly at 5000 rpm, then 2. Mu.L of cDNA of the test sample and cDNA of the control sample obtained in 3.7 were added, centrifuged briefly and mixed, and PCR was carried out. The PCR reaction program is: at 95 ℃ for 10min;40 PCR cycles (95 ℃,10 sec; 60 ℃,60 sec (fluorescence collection)).

A melting curve of the PCR product is established, after the amplification reaction is finished, the procedure is carried out (95 ℃,10 seconds, 60 ℃,60 seconds, 95 ℃,15 seconds), and then the PCR product is slowly heated to 95 ℃ from 60 ℃ (the temperature of the instrument is automatically controlled-Ramp Rate is 0.075 ℃/second).

Since the content of cDNA in a volume of 2. Mu.L per sample is not completely the same due to the influence of errors in the quantification of RNA concentration, errors in the efficiency of RNA reverse transcription, and the like, a housekeeping gene U6 (whose expression level is substantially constant among different samples) was used as an internal reference to correct the concentration of a target gene. The housekeeping gene was subjected to PCR reaction according to the above procedure. Wherein, the PCR specific primer F of the housekeeping gene is as follows: 5 'GCTTCGGCAGCACACTATATACTAAAAT-3' (shown as SEQ ID NO. 4), and the PCR specific primer R is: 5 '-and-CGCTTCACGAATTTGCGTGTCAT-and-3' (shown as SEQ ID NO. 5); the annealing temperature of the primer was 60 ℃.

4.3 results and calculations

And (3) obtaining the concentrations of the target gene (tRF-Gly-CCC-1-M4) and the housekeeping gene according to the drawn gradient dilution DNA standard curve, and dividing the concentration of the target gene by the concentration of the housekeeping gene U6 to obtain the corrected relative content of the target gene of the sample.

5. The result of the detection

After the detection sample and the control sample are processed by the steps of 3-4, the relative content of tRF-Gly-CCC-1-M4 in the tissue can be obtained, and the detection result is shown in figure 1. As can be seen from FIG. 1, the relative content of tRF-Gly-CCC-1-M4 in the TEST sample (TEST) is significantly higher than that in the Control sample (Control), indicating that the prostate cancer cells are in a proliferation state.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Claims

1. A marker tRF-Gly-CCC-1-M4 for detecting prostatic cancer, wherein the nucleotide sequence of the marker is shown in SEQ ID NO. 1.

2. A primer pair for detecting the marker in claim 1, wherein the sequence of the upstream primer is shown as SEQ ID NO.2, and the sequence of the downstream primer is shown as SEQ ID NO. 3.

3. Use of the marker of claim 1 or the primer pair of claim 2 in the preparation of a reagent or kit for detecting prostate cancer.

4. The use of claim 3, wherein the test sample of the reagent or kit comprises a prostate cell line, fresh prostate tissue, punctured prostate tissue, fresh urine, fresh prostate massage solution, or blood.

5. A kit for detecting prostate cancer, comprising the primer set according to claim 2.

6. The kit of claim 5, wherein the control sample in the kit is a human prostate hyperplasia cell line.