CN115948264B - Genetically engineered bacterium for producing 3-hydroxy propionic acid and application thereof - Google Patents

Abstract

The invention belongs to the technical fields of metabolic engineering and synthetic biology, and relates to a genetically engineered bacterium for producing 3-hydroxy propionic acid and application thereof. The saccharomyces cerevisiae recombinant strain is characterized in that an exogenous modified malonyl-CoA reductase gene MCR is positioned in saccharomyces cerevisiae mitochondria, expressed on chromosomes in two copies, and an endogenous mitochondrial NADP specific isocitrate dehydrogenase encoding gene IDP1 and a mitochondrial NADH kinase encoding gene POS5 are overexpressed. The recombinant saccharomyces cerevisiae strain with high yield of 3-HP is constructed through the transformation, the yield reaches 5.2g/L in shake flask fermentation, and the feed fermentation reaches 36.3g/L in a 5L fermentation tank.

Description

Genetically engineered bacterium for producing 3-hydroxy propionic acid and application thereof

Technical Field

The invention belongs to the technical fields of metabolic engineering and synthetic biology, and relates to a genetically engineered bacterium for producing 3-hydroxy propionic acid and application thereof.

Background

3-Hydroxy propionic acid (3-HP) is an attractive platform chemical which can be used as a precursor for synthesizing acrylic acid, acrylamide and other compounds, so that sustainable production of superabsorbent polymers, plastics, paint and other materials is possible, and the application prospect is wide. The traditional chemical synthesis method is used for producing 3-HP, and has the problems of unfriendly raw materials, high cost and the like, so that the biosynthesis method using microbial fermentation has more advantages for sustainable development.

The 3-HP natural synthetic pathway in microorganisms exists in a few thermophilic archaebacteria and bacteria and is involved in the autotrophic carbon fixation cycle. The 3-HP biosynthesis methods reported so far have shown that it is possible to introduce exogenous pathways into other microorganisms from several intermediates, including glycerol, malonyl-CoA and beta-alanine, to produce 3-HP. Among them, many studies have been conducted on the malonyl-coa pathway, in contrast to the glycerol pathway, which is limited by the need for the supply of coenzyme B12 and is mainly used in bacterial hosts. The malonyl-coa pathway has been used in many microbial cell factories, such as escherichia coli, saccharomyces cerevisiae, etc., and the specific synthesis process is to convert acetyl-coa, which is an intermediate metabolite obtained by metabolism of glucose or other carbon sources, into malonyl-coa through the catalysis of acetyl-coa carboxylase (ACC), and then to synthesize 3-HP through the catalysis of malonyl-coa reductase (MCR).

Saccharomyces cerevisiae, a well-studied model eukaryotic microorganism, has a wide technical platform in both systematic biology and synthetic biology, has been applied to cell factories of various biochemicals based on the advantages of robustness against industrial conditions, ability of high-density fermentation, insensitivity to phage contamination, etc., and has been advanced to a certain extent in the production of 3-HP using it, but still has a large room for improvement. Based on this, because of the different physical and chemical environments of various subcellular organelles in Saccharomyces cerevisiae, many chemicals produced by using different organelles have been developed based on this feature. In particular, the intragranular environment within yeast has a higher redox potential and a higher acetyl-CoA concentration relative to the cytoplasm, and may be more advantageous for the synthesis of 3-HP.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a genetic engineering bacterium for producing 3-hydroxy propionic acid aiming at the prior art, and the purpose of improving the 3-HP yield is achieved by exogenously introducing malonyl-CoA reductase (MCR) with high enzyme activity and positioning the malonyl-CoA reductase to mitochondria and simultaneously improving the supply of cofactor NADPH by utilizing malonyl-CoA pathway.

Therefore, the invention provides a genetically engineered bacterium for producing 3-hydroxy propionic acid.

According to an embodiment of the first aspect of the present invention, the genetically engineered bacterium producing 3-hydroxypropionic acid is a recombinant saccharomyces cerevisiae comprising an exogenous modified malonyl-coa reductase gene MCR in the genome.

Specifically, the recombinant saccharomyces cerevisiae takes wild-type saccharomyces cerevisiae as a host bacterium, positions an exogenous modified malonyl-coa reductase gene MCR in saccharomyces cerevisiae mitochondria, and expresses the gene on chromosomes in two copies.

In some embodiments of the invention, the MCR gene is split into two sections, MCR-N and MCR-C, and the MCR-C is modified by N940V, K1106W, S1114R point mutation.

In some further embodiments of the invention, the MCR-N is expressed using the promoter PGK1p, the MCR-C is expressed using the promoter TDH3p, and the mitochondrial localization sequence CAT2m is attached to the 5' end of each gene, and one copy is inserted into each of the chromosome XI-3 and X-4 positions after the MCR-N is attached to the MCR-C.

For example, in some specific embodiments of the invention, malonyl-coa reductase (MCR) from green-flex orange (Chloroflexus aurantiacus) is first introduced using saccharomyces cerevisiae as a host strain. In the invention, MCR-N and mutated MCR-C are expressed in Saccharomyces cerevisiae with high intensity, and a mitochondrial localization sequence is added at the N end. In a specific embodiment of the invention, the N940V, K1106W, S1114R of MCR-C is subjected to point mutation, expressed using the TDH3p promoter and the MCR-N expressed using the PGK1p promoter. On this basis, mitochondrial localization signal sequences CAT2m were added to the N-terminal of MCR-N and MCR-C, respectively. One copy of the modified MCR gene is inserted into each of XI-3 and X-4 sites of Saccharomyces cerevisiae genome.

In the invention, the nucleotide sequence of the mitochondrial localization sequence CAT2m is shown as SEQ No. 1.

In the invention, the nucleotide sequence of the MCR-N is shown as SEQ No. 2.

In the invention, the nucleotide sequence of MCR-C (marked as MCR-mC) modified by N940V, K1106W, S1114R point mutation is shown in SEQ No. 3.

In the invention, the nucleotide sequence of the MCR-C (without mutation point modification) is shown as SEQ No. 46.

In the invention, the nucleotide sequence of the promoter TDH3p is shown as SEQ No. 4.

According to an embodiment of the second aspect of the present invention, the genetically engineered 3-hydroxypropionic acid producing bacteria further overexpress the endogenous mitochondrial NADP-specific isocitrate dehydrogenase encoding gene IDP1 and the mitochondrial NADH kinase encoding gene POS5.

In some embodiments of the invention, mitochondrial NADP-specific isocitrate dehydrogenase encoding gene IDP1 overexpression is achieved by replacing its original promoter on the chromosome as promoter TEF1 p.

In the invention, the nucleotide sequence of the promoter TEF1p is shown as SEQ No. 5.

In other embodiments of the invention, overexpression of the mitochondrial NADH kinase encoding gene POS5 is achieved by replacing its promoter with the TDH3p promoter and introducing it into the strain in the form of a high copy plasmid.

For example, in some specific examples of the invention, on the basis of the recombinant yeast strain obtained by the embodiment of the first aspect, the mitochondrial NADP-specific isocitrate dehydrogenase-encoding gene IDP1 and the mitochondrial NADH kinase-encoding gene POS5 are overexpressed. Wherein, the promoter region of IDP1 is replaced by strong promoter TEF1p on the saccharomyces cerevisiae genome to carry out over-expression, and in addition, a high copy plasmid which uses promoter TDH3p to over-express POS5 is introduced into the recombinant saccharomyces.

In the invention, the nucleotide sequence of the mitochondrial NADP specific isocitrate dehydrogenase encoding gene IDP1 is shown as SEQ No. 44.

In the invention, the nucleotide sequence of the mitochondrial NADH kinase coding gene POS5 is shown as SEQ No. 45.

In the present invention, the Saccharomyces cerevisiae as host cell is Saccharomyces cerevisiae CEN.PK113-5D (MATA ura3-52 HIS3 LEU2 TRP1 MAL2-8c SUC2) (BioVector plasmid vector strain cell protein antibody Gene Collection-NTCC classical culture collection).

The invention also provides application of the genetically engineered bacteria in synthesizing 3-hydroxy propionic acid.

In some embodiments of the invention, the use comprises fermenting the genetically engineered bacterium to produce 3-hydroxypropionic acid.

In some preferred embodiments of the invention, the shake flask fermentation culture conditions are: the temperature is 30 ℃, the rotation speed of a shaking table is 200rpm, and the culture medium consists of 5g/L(NH₄)₂SO₄、3g/L KH₂PO₄、0.5g/L MgSO₄·7H₂O、 trace metal elements, vitamins and 20g/L glucose.

In some particularly preferred examples of the invention, shake flask fermentation culture conditions are: the temperature is 30 ℃, the rotation speed of a shaking table is 200rpm, and the culture medium consists of 5g/L(NH₄)₂SO₄、3g/L KH₂PO₄、0.5g/L MgSO₄·7H₂O、 trace metal element (15mg/L EDTA、4.5mg/L ZnSO₄·7H₂O、0.3mg/L CoCl₂·6H₂O、1mg/L MnCl₂·4H₂O、0.3mg/L CuSO₄·5H₂O、4.5mg/L CaCl₂·2H₂O、3mg/L FeSO₄·7H₂O、0.4mg/L NaMoO₄·2H₂O、1mg/L H₃BO₄、0.1mg/L KI)、 vitamin (0.05 mg/L biotin, 1mg/L calcium pantothenate, 1mg/L nicotinic acid, 25mg/L inositol, 1mg/L thiamine hydrochloride, 1mg/L pyridoxine hydrochloride, 0.2mg/L para aminobenzoic acid) and 20g/L glucose.

In other preferred embodiments of the invention, the fermenter feed batch fermentation culture conditions are: the pH is maintained at 5, the temperature is maintained at 30 ℃, the dissolved oxygen limit value is 30%, the ventilation is maintained at 0.5VVm, the stirring is set at 400-1200rpm, and the composition of the feed medium is 67.5g/L(NH₄)₂SO₄、27g/L KH₂PO₄、4.5g/L MgSO₄·7H₂O、 trace metal elements, vitamins and 300g/L glucose.

In some particularly preferred examples of the invention, the fed-batch fermentation culture conditions are: the pH was maintained at 5, the temperature was maintained at 30 ℃, the DO limit was 30%, aeration was maintained at 0.5VVm, stirring was set at 400-1200rpm, the composition of the feed medium was 67.5g/L(NH₄)₂SO₄、27g/L KH₂PO₄、4.5g/L MgSO₄·7H₂O、 trace metal element (135mg/L EDTA、40.5mg/L ZnSO₄·7H₂O、2.7mg/L CoCl₂·6H₂O、9mg/L MnCl₂·4H₂O、2.7mg/L CuSO₄·5H₂O、40.5mg/L CaCl₂·2H₂O、27mg/L FeSO₄·7H₂O、3.6mg/L NaMoO₄·2H₂O、9mg/L H₃BO₄、0.9mg/L KI)、 vitamins (0.45 mg/L biotin, 9mg/L calcium pantothenate, 9mg/L niacin, 225mg/L inositol, 9mg/L thiamine hydrochloride, 9mg/L pyridoxine hydrochloride, 1.8mg/L para-aminobenzoic acid), 300g/L glucose.

The invention takes a saccharomyces cerevisiae strain as a host strain, two copies of PGK1p-MCR-N and TDH3p-MCR-mC (the MCR-C after the transformation of the point mutation) expressed by a strong promoter with mitochondrial signal peptide are inserted into the genome of the saccharomyces cerevisiae strain, and a 3-HP production strain is obtained; based on the transformation, the original promoter of the IDP1 is replaced by TEF1p, and an over-expressed TDH3p-POS5 high-copy plasmid is introduced, so that the 3-HP yield is further improved by improving the NADPH content in a mitochondrial environment, and the efficient and sustainable microbial fermentation production of the 3-HP is realized.

Drawings

The invention is described in further detail below with reference to the accompanying drawings:

FIG. 1 shows the metabolic pathways of recombinant Saccharomyces cerevisiae for 3-hydroxypropionic acid synthesis;

FIG. 2 is a map of a fragment of the genomic inserted gene MCR;

FIG. 3 is a fragment map of the genomic replacement IDP1 gene promoter, TEF1p promoter;

FIG. 4 is a map of plasmid pPOS of POS5 over-expressed in TDH3 p;

FIG. 5 is a bar graph of 3-hydroxypropionic acid yield in shake flasks of recombinant Saccharomyces cerevisiae strains according to various embodiments of the present invention.

Detailed Description

In order that the invention may be readily understood, a detailed description of the invention will be provided below with reference to the accompanying drawings and examples. Before the present invention is described in detail, it is to be understood that this invention is not limited to particular embodiments described. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

Unless defined otherwise, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described.

I. Terminology

The term "expression" as used herein refers to the expression of a gene in a metabolic pathway and to the expression of its background promoter.

The term "overexpression" as used herein means that insertion of a strong promoter stronger than its background promoter before a gene initiates expression of the gene.

The term "MCR-mC" refers to MCR-C modified by N940V, K1106W, S1114R point mutation.

The symbols used in the present invention ": : "Gene insertion, accordingly, A: : b represents insertion of the B gene into the A locus.

II. Embodiment

The current 3-HP-producing Saccharomyces cerevisiae strains that utilize the malonyl-CoA pathway are based on cytoplasmic expression. Although the cytoplasm has the advantages of large space, more intermediate metabolites, no need of membrane crossing and the like, certain limitation exists, and the cytoplasm is possibly limited by transcription level regulation, cytoplasmic physical chemical environment, loss of intermediate products of competitive metabolic pathways, metabolite toxicity and the like. The organelles all have unique physicochemical environments (e.g., pH and redox potential), enzymes, metabolites, and cofactors, transferring metabolic pathways into smaller organelles, local concentrations of substrate and enzyme may increase reaction rates and yield, and may reduce intermediate metabolite toxicity, inhibiting byproduct production. Repositioning of key genes in metabolic pathways in different environments in cells is an effective metabolic engineering strategy. Mitochondria are the locus of tricarboxylic acid cycle, amino acid biosynthesis, various cofactors and metabolites. The mitochondrial matrix can provide higher pH, lower oxygen concentration, and higher redox potential than the cytoplasmic matrix. Under aerobic conditions, glucose is converted into pyruvic acid and enters mitochondria to synthesize a large amount of acetyl-CoA, and in addition, the limitation that acetyl-CoA cannot be directly shuttled across a membrane exists in Saccharomyces cerevisiae, so that the content of acetyl-CoA in mitochondria is higher than that of cytoplasmic matrixes. Meanwhile, since 3-HP is a compound synthesized using an acetyl-CoA precursor, the present inventors considered that localization of malonyl-CoA pathway into mitochondria may increase 3-HP production.

As shown in FIG. 1, the malonyl-CoA pathway of 3-HP synthesis is largely divided into two parts: a first part, glucose is converted to acetyl-coa by a glycolytic pathway, and then acetyl-coa is converted to malonyl-coa by an acetyl-coa decarboxylase; the second part, malonyl-coa, is converted to 3-HP, catalyzed by malonyl-coa reductase (MCR). In the production of 3-HP by the malonyl-CoA pathway in Saccharomyces cerevisiae, malonyl-CoA conversion to 3-HP is a key step in the process, and the inventors achieved that the critical reaction of malonyl-CoA conversion from cytoplasm to mitochondria occurs by fusing malonyl-CoA reductase MCR with mitochondrial localization signal sequence CAT2m, and localizing MCR to mitochondria.

Researches show that the refining activity of MCR can be obviously improved after the MCR is functionally split into two sections of MCR-N and MCR-C. In an embodiment of the first aspect, as shown in fig. 2, the resolved MCR is integrated into the yeast genome. The mutation N940V, K1106W, S1114R was first introduced into MCR-C (denoted MCR-mC) and the Saccharomyces cerevisiae strong promoter TDH3p was ligated with the terminator CYC1t before and after the MCR-mC for its expression in Saccharomyces cerevisiae. In addition, the strong Saccharomyces cerevisiae promoter PGK1p and terminator ADH1t were ligated to the MCR-N for its expression in Saccharomyces cerevisiae; in addition, mitochondrial signal sequences CAT2m were ligated to the N-terminal of MCR-N and MCR-mC, respectively, for their localization to mitochondria. The recombinant MCR was inserted into the genome XI-3 and X-4 sites of Saccharomyces cerevisiae, respectively, to give a recombinant Saccharomyces cerevisiae strain with two copies of MCR, which was designated as NmC2.

In the mitochondria of Saccharomyces cerevisiae, NADPH is mainly derived from two pathways: NADH is synthesized by a mitochondrial NADH kinase Pos5p catalytic reaction, NADH ⁺ is synthesized into NADP ⁺ by a Pos5p catalytic NAD ⁺ kinase reaction, NADP ⁺ is synthesized into NADPH by an intra-mitochondrial NADP ⁺ dependent dehydrogenase catalytic reaction, and enzymes catalyzing the reaction include mitochondrial NADP-specific isocitrate dehydrogenase Idp1p, mitochondrial aldehyde dehydrogenase Ald4p and the like.

During the synthesis of 3-HP via the malonyl-CoA pathway, one molecule of the cofactor NADPH is required for the synthesis of each molecule of 3-HP to participate in the catalysis in this key step of malonyl-CoA conversion to 3-HP. Thus, in order to further increase the 3-HP synthesis amount, in an embodiment of the second aspect, the present inventors modified to increase the mitochondrial NADPH synthesis amount on the basis of the strain NmC2 constructed in the embodiment of the first aspect. The inventors have found that overexpression of POS5 with IDP1 achieves this goal. Specifically, the sequence 36bp in front of the open reading frame of the IDP1 gene is replaced by a strong promoter TEF1p of Saccharomyces cerevisiae on the genome of Saccharomyces cerevisiae, so that the over-expression of IDP1 is realized. In addition, a high copy plasmid of the Saccharomyces cerevisiae endogenous POS5 gene overexpressed by the strong promoter TDH3p was constructed and transferred into a yeast strain.

The modification of yeast chromosomes by using the CRISPR/Cas9 system comprises the insertion of exogenous genes and the replacement of promoters of endogenous genes. For this purpose, it is necessary to construct recombinant plasmids containing Cas9 protein and gRNA, the recombinant plasmids used for MCR integration include pCas-XI-3.3 and pCas9-X-4(Zhang Y,et al.Expressing a cytosolic pyruvate dehydrogenase complex to increase free fatty acid production in Saccharomyces cerevisiae[J].Microbial Cell Factories,2020,19(1).). for chromosomal IDP1 promoter replacement, the recombinant plasmids used are pCas9_idp1p, the vectors and template plasmids involved in the construction process include pCas-LacZ plasmid, pst1.G. Ura3 plasmid are assembled by the plasmid construction method of GoldenGate, and the prediction and selection of gRNA involved is performed by website https: and/www.atum.bio/category/vectors/grna-design. For the POS5 over-expression plasmid pPOS, the vector plasmid used was pUGG.

In the invention, the GoldenGate method is adopted for plasmid construction. Firstly, preparing a GoldenGate reaction system, adding a plasmid vector according to 17ng/kb, adding a DNA fragment according to a molar ratio of 1:1 with the vector, adding 0.4 mu l T DNA ligase, 2 mu l T ligase buffer solution and 1.6 mu l BsaI restriction endonuclease, and finally adding water to 20 mu l. The reaction system was reacted according to the following procedure: 30min at 37 ℃;37 ℃ for 10min;16 ℃ for 5min; returning to the step 2, and carrying out 15 cycles; 30min at 16 ℃; 30min at 37 ℃;80 ℃ for 5min; maintained at 4 ℃. After completion of the reaction, 4. Mu.l of the reaction mixture was taken and subjected to large intestine transformation.

All yeast strains are constructed by adopting an electric shock transformation method. The specific method for preparing the electrotransformation competence is as follows: first, a single colony of yeast on a plate is inoculated to 5mL of YPD medium and cultured overnight at 30℃in a 50mL centrifuge tube at 200 rpm; pre-cultured cells were inoculated into 50mL YPD medium in 250mL shake flasks at an initial OD ₆₀₀ of 0.3, cultured at 30 ℃ until OD ₆₀₀ reached 1.2-1.6; centrifugation at 3000rpm for 3 min at 4℃and collection of yeast cells in 50mL centrifuge tubes; washing with 20ml of precooled sorbitol once; the cells were resuspended in 16mL 1M sorbitol and 2mL 10 XTE solution and 2mL 10 XLiOAc solution were added; after shaking the tube at 30℃for 30 minutes, 200. Mu.l of 1M DTT was added to the mixture and the tube was shaken at 30℃for 15 minutes; centrifuging at 3000rpm at 4deg.C for 3 min, collecting the supernatant, and washing twice with 20ml pre-cooled sorbitol solution; after centrifugation again, all liquid was aspirated as much as possible and the yeast cell pellet was resuspended in 180 μl 1M sorbitol; the cell suspension was dispensed at 50 μl per tube.

The steps of the electric conversion are as follows: for chromosomal gene insertion or promoter replacement, 100ng pCas plasmid and about 2000ng donor DNA fragment were gently mixed with competent cells and shocked. Cells were incubated in 3mL YPD and 3mL1M sorbitol mixture for 3-5 hours after shock. The cells were then washed once with water and resuspended in 1ml of sterile water. Wherein 100 μl was directly plated onto SC-URA plates, and the remaining liquid was transferred to SC-URA liquid medium for further culturing for 24 hours, and plated again. Verification was performed by colony PCR and sequencing methods. In addition, the transformation of the plasmid into yeast cells according to the present invention was also performed by electrotransformation, and the plasmid was uniformly mixed with competent cells, then shocked, transferred to a mixture of 3mL YPD and 3mL1M sorbitol, cultured for 1 hour, and screened on SC-URA plates.

The culture medium used for culturing, constructing and screening the strain in the invention comprises YPD culture medium and SC-URA culture medium. The medium used for fermentation was Delft medium. The composition of the culture medium is as follows: YPD medium comprises 10g/L yeast extract, 20g/L peptone, 20g/L glucose; the SC-URA medium comprises 5g/L ammonium sulfate, 1.7g/L YNB (without ammonium sulfate and amino acids), 1.914g/L amino acid mixture (without uracil), 20g/L glucose, pH was adjusted to 6 with NaOH; delft medium contains 5g/L(NH₄)₂SO₄、3g/L KH₂PO₄、0.5g/L MgSO₄·7H₂O、 trace metals (15mg/L EDTA、4.5mg/L ZnSO₄·7H₂O、0.3mg/L CoCl₂·6H₂O、1mg/L MnCl₂·4H₂O、0.3mg/L CuSO₄·5H₂O、4.5mg/L CaCl₂·2H₂O、3mg/L FeSO₄·7H₂O、0.4mg/L NaMoO₄·2H₂O、1mg/L H₃BO₄、0.1mg/L KI)、 vitamins (0.05 mg/L biotin, 1mg/L calcium pantothenate, 1mg/L niacin, 25mg/L inositol, 1mg/L thiamine hydrochloride, 1mg/L pyridoxine hydrochloride, 0.2mg/L para aminobenzoic acid), 20g/L glucose, and the pH is adjusted to 6.5 with KOH.

In the present invention, 3-HP concentration was detected by high performance liquid chromatography HPLC (Shimadzu LC-20 AT) using an Aminex HPX-87H (Bio-Rad) column and a UV detector AT 210 nm. 1mL of the fermentation broth was filtered through a water-based filter membrane having a pore size of 0.22mm into a liquid-phase vial as a test sample. The mobile phase was 0.5mM H ₂SO₄, the column oven temperature was set at 65℃and the detection time for each sample was set at 20 minutes. 3-HP standard substances with different concentration gradients are prepared, the mixture is filtered into a clean liquid phase vial, and a standard curve of peak area and concentration correlation is obtained according to a sample detection program. After the samples were again tested by HPLC, the concentration of 3-HP in each sample was calculated by substituting the standard curve.

III. Examples

The present invention will be specifically described below by way of specific examples. The experimental methods described below, unless otherwise specified, are all laboratory routine methods. The experimental materials described below, unless otherwise indicated, are commercially available or conventional.

Example 1: modification of MCR and Saccharomyces cerevisiae mitochondrial localization

Mitochondrial localized MCR plasmid pMCR1 was first constructed. pUGG1 is taken as a vector, CAT2m mitochondrial localization sequence is added at the 5' end of the MCR gene, the promoter is TDH3p, and the terminator is CYC1t.

The yeast genome is used as a template for amplification to obtain a TDH3p fragment, and CAT2m sequences are added to primers to connect the fragment, wherein the amplified primer sequences are as follows:

P124：aaaGGTCTCaATCTTCATTATCAATACTGCCATTTCAAAGAATACG

P125：aaaGGTCTCagagagagttctcgaatgacagatcctcatTTTGTTTGTTTATGTGTGTTTATTCGAAAC

In addition, the pYC1(Chen Y,et al.Coupled incremental precursor and co-factor supply improves 3-hydroxypropionic acid production in Saccharomyces cerevisiae[J].Metabolic Engineering,2014,22：104-109.) is used as a template for PCR amplification to obtain MCR and CYC1t fragments, and the primer sequences used for amplification are as follows:

P126：AGGTCTCATCTCAAACTTAAAGGATCTTCCGATAACGTCAAGGAGAGCAAGTGGTACAGGTAGATTAGCAGG

P127：AAAGGTCTCACCTAGGTTCTTCAGCTCTGGC

P128：aaaGGTCTCatagGgacccacacgaaagacaac

P129：aaaGGTCTCaCGACcttcgagcgtcccaaaacc

the 3 DNA fragments obtained by the PCR amplification were ligated with vector pUGG1 by Golden Gate method to construct plasmid pMCR1.

On this basis, resolved pMCR-N and pMCR-C plasmids were constructed for mitochondrial localization, respectively.

The pMCR-N construction process comprises the steps of firstly carrying out PCR amplification by taking PYC1 as a template to respectively obtain a promoter PGK1p and a terminator ADH1t fragment, wherein the amplified primer sequences are as follows:

P140：aaaGGTCTCacagatcttatcgtcgtcatc

P141：aaaGGTCTCaATCTcctggaagtaccttcaaag

P144：aaaGGTCTCatgagctcttaattaacaattcttcg

P145：aaaGGTCTCaCGACcagctggataaaggcg

Then, PMCR is taken as a template to amplify fragments connected with the MCR-N by CAT2m, and the sequence of the used primers is as follows:

P142：aaaGGTCTCatctgatgaggatctgtcattcgag

P143：aaaGGTCTCactcagatgttggctggtatgttc

the fragments were ligated together sequentially using pUGG A as a vector by the Golden Gate method to obtain plasmid pMCR-N.

PMCR-C construction, namely, respectively carrying out PCR amplification on two sections of TDH3p-CAT2m and MCR-C-CYC1t by taking pMCR1 as a template, wherein the sequences of the used primers are as follows:

P124：aaaGGTCTCaATCTTCATTATCAATACTGCCATTTCAAAGAATACG

P139：aaaGGTCTCacggaTGCTCTCCTTGACGTTATC

P138：aaaGGTCTCatccgctaccactggtg

P129：aaaGGTCTCaCGACcttcgagcgtcccaaaacc

The fragments were ligated together sequentially using pUGG A as a vector by the Golden Gate method to obtain plasmid pMCR-C.

The modification of partial amino acid mutations by Golden Gate on the basis of pMCR-C included N940V, K1106W, S1114R, resulting in plasmid pMCR-mC. Wherein MCR-mC is divided into three sections, pMCR-C is taken as a template, and the MCR-mC is obtained through PCR amplification, and the primers used are respectively:

P124：aaaGGTCTCaATCTTCATTATCAATACTGCCATTTCAAAGAATACG

P134：aaaGGTCTCacaactctgtcagctaagtaatagacag

P135：aaaGGTCTCagttgtttccggtgaaacttttc

P146：aaaGGTCTCaagacaaagcaatccatctggcgactctgaag

P137：aaaGGTCTCagtctgatggtgctcgattagcattggtaacccc

P129：aaaGGTCTCaCGACcttcgagcgtcccaaaacc

Simultaneous insertion of MCR-N and MCR-mC at the XI-3 site of the yeast chromosome requires simultaneous transformation of Cas9 plasmid pCas9_XI-3.3 with a fragment of MCR donor DNA with 50bp homology arms on both sides of the XI-3.3 site into Saccharomyces cerevisiae cells.

Wherein, the donor DNA of MCR-N is obtained by using pMCR-N as a template for amplification, and the primer sequences are as follows:

XI-3.3-MCR_N-up：

ACTGATTAGTTTTCCGTTTTAGGATATTGACGCCAAGCGTGCGTCTGATTCTGGAAGTACCTTCAAAGAATGGG

P155：

CGGAACGGTCGACCAGCTGGATAAAGGCGCGCCAAACGACCTAGGAATTGGAGCGACCTCATGCTATACCTG in addition, the donor DNA of MCR-C was obtained by amplification using pMCR-mC as a template, and the primer sequences were:

XI-3.3-CaMCR-dw：

CAGCCCAATCCTCAAAAATAAAATGGCCCTTCCAAAATTAGAGACATATCcttcgagcgtcccaaaacc

P156：

caattcctaggtcgtttggcgcgcctttatccagctgGTCGACCGTTccgTCATTATCAATACTGCCATTTCAAAGAATACG

competent cells of Saccharomyces cerevisiae strain CEN.PK113-5D were prepared, the donor DNA and the plasmid were simultaneously electrotransferred into the cells, and the strain with single copy integration of MCR-N and MCR-mC (shown in FIG. 2) was obtained after screening.

Similarly, with the above recombinant strain as a background strain, one copy of MCR-N and MCR-mC (as shown in FIG. 2) were inserted into the chromosome X-4 site, and the resulting recombinant strain was designated as NmC2. Wherein the Cas9 plasmid used is pCas _x4, the two donor DNA fragments are obtained by PCR amplification and purification, and the amplification primer sequences are as follows:

X-4-MCR-N-up：

CCAACTACCAAGGTTGTTGAGGGAACACTGGGGCAATAGGCTGTCGCCATCTGGAAGTACCTTCAAAGAATGGG

P155：

cggAACGGTCGACcagctggataaaggcgcgccaaacgacctaggaattggagcgacctcatgctatacctg

X-4-CaMCR-dw：

CAGACATCAGACATACTATTGTAATTCAAAAAAAAAAAGCGAATCTTCCCcttcgagcgtcccaaaacc

P156：

caattcctaggtcgtttggcgcgcctttatccagctgGTCGACCGTTccgTCATTATCAATACTGCCATTTCAAAGAATACG

Example 2: construction of high-yield 3-HP Strain

On the basis of the recombinant strain NmC2 constructed in example 1, the metabolic pathway thereof was further modified to increase the supply amount of NADPH, including both strategies of up-regulating the IDP1 gene and the POS5 gene.

As shown in fig. 3, the up-regulation of IDP1 was achieved by replacing the promoter of IDP1 on the chromosome with the strong promoter TEF1p, using the CRISPR/Cas9 system for gene manipulation. First, it is necessary to construct a Cas9 plasmid with the gRNA within IDP1 p. The fragments with gRNA are obtained by PCR with pCas-LacZ plasmid as a vector and pST1.G.Ura3 plasmid as a template, and assembled by a plasmid construction method of GoldenGate.

The primers used for the construction of pCas9_idp1p were:

IDP1p_g：

aaaGGTCTCtgatcTGTGAGACAACAGACGCACAGTTTTAGAGCTAGAAATAGCAAGTTA

Ura3_Bsa1：

aaaGGTCTCaaaacACACAGGGTAATAACTGATATAATTAAATTGAAGC

In addition, the donor DNA of the TEF1p used for replacement is obtained by PCR amplification by taking a yeast genome as a template, and the amplification primers are as follows:

IDP1_TEF1p-f2：

CCATATAAAGAGGGACTCATATGATCTTATGAAATCTTCCTTCAAGCAATTTCAAAATGTTTCTACTCCTTTTTTAC

IDP1_TEF1p-r：

AAAGCAGCAAGGCGAGAGGTGGAAAATAATCTTCTAGATAACATACTCATCTAGAAAACTTAGATTAGATTGCTATG

As shown in FIG. 4, up-regulation of POS5 was achieved by constructing a high copy plasmid for overexpression of POS 5. pPOS5 was also constructed by the Golden Gate method. pUGG1 is used as a vector, a yeast genome is used as a template, and a fragment of a strong promoter TDH3p and a POS5 gene fragment are obtained through PCR amplification, wherein the primer sequences used are as follows:

TDH3p-GG-r：AAAGGTCTCATTTGTTTGTTTATGTGTGTTTATTCG

TDH3p-GG-f：AAAGGTCTCAATCTACCTCGAGATAAAAAACACGC

POS5t-GG-r：AAAGGTCTCACGACACGAAACATAGTCTCTCTCCA

POS5-GG-f：AAAGGTCTCACAAAATGTTTGTCAGGGTTAAATTGAAT

Based on the NmC2 strain, the replacement IDP1 promoter is TEF1p promoter, and the obtained new recombinant bacterial group is named as NmC2IDP 1. The pPOS plasmid was transformed into the strain based on the NmC2 strain, and the resulting new recombinant group was designated nmc2+ pPOS. The pPOS plasmid is transformed into the strain on the basis of the NmC2IDP1 strain, and the obtained novel recombinant bacterial group is named as NmC2IDP1+ pPOS.

Example 3: 3-HP fermentation production of recombinant strains

The fermentation yield of the recombinant strain was first tested by shake flask fermentation. Empty plasmid pUGG1 was transformed in NmC2 strain to provide URA3 deleted in the background strain. And (3) streaking the saccharomyces cerevisiae recombinant strain with the URA3 marker plasmid on an SC-URA solid culture medium to obtain a monoclonal, and inoculating the monoclonal into an SC-URA liquid culture medium for activation to obtain seed liquid. Three clones were selected for each strain and used as replicates for fermentation experiments. The activated seed solution was inoculated into Delft medium at an initial OD ₆₀₀ of 0.1 and cultured in shake flasks at 30℃with shaking at 200 rpm.

After fermentation, 1ml of fermentation broth is taken, the supernatant is taken after centrifugation and filtered by a 0.22 mu m filter membrane, and the concentration of 3-HP is detected by high performance liquid chromatography. The detection was carried out at a flow rate of 0.5ml/min with a 0.5mM dilute sulfuric acid solution as the mobile phase and a column oven set at 65 ℃. The peak time of the 3-HP standard was 15.5min at 210nm with an UV detector.

As shown in FIG. 5, the 3-HP yields obtained from shake flask fermentation of each recombinant strain after testing were as follows: nmC2+ pUGG1 reaches 3.8g/L, nmC2+ pPOS5 reaches 4.8g/L, and NmC2IDP1+ pPOS5 reaches 5.2g/L. The results of shake flask fermentation experiments show that the introduction of mitochondria-localized MCR in Saccharomyces cerevisiae can significantly improve the yield of 3-HP, and on the basis, the synthesis of 3-HP can be further promoted by improving the supply of NADPH in mitochondria through over-expression of POS5 and IDP 1.

The recombinant yeast strain with high 3-HP yield is subjected to fed-batch fermentation in a 5L fermentation tank. The culture medium for batch fermentation comprises 5g/L(NH₄)₂SO₄、14.4g/L KH₂PO₄、0.5g/L MgSO₄·7H₂O、 trace metal elements, vitamins and 20g/L glucose, and the feed culture medium comprises 67.5g/L(NH₄)₂SO₄、27g/L KH₂PO₄、4.5g/L MgSO₄·7H₂O、 trace metal elements, vitamins and 300g/L glucose.

Similarly, the single clone was inoculated into SC-URA broth and activated by shaking culture in shaking tube as primary seed, when OD ₆₀₀ reached 1-2, the primary seed liquid was re-transferred into Delft broth and cultured in shaking flask as secondary seed liquid, when OD ₆₀₀ reached 1-2, the primary OD ₆₀₀ =0.1 was inoculated into the fermenter. The temperature in the tank was set to 30℃and the pH was maintained at 5. The dissolved oxygen limit was 30%, aeration was maintained at 0.5VVm, and stirring was set at 400-1200rpm. Stirring was maintained at 400rpm at DO > 30% and after DO decreased below 30%, stirring was increased to maintain 30% DO. Feeding begins when the glucose in the tank is depleted. After the NmC2 IDP1+ pPOS5 strain is fermented for 86 hours under the fed-batch culture, the yield of the 3-hydroxy propionic acid reaches 36.3g/L by HPLC.

The 3-hydroxypropionic acid genetically engineered bacterium is subjected to 10-generation subculture, so that the strain has stable properties and no reversion mutation.

It should be noted that the above-described embodiments are only for explaining the present invention and do not constitute any limitation of the present invention. The invention has been described with reference to exemplary embodiments, but it is understood that the words which have been used are words of description and illustration, rather than words of limitation. Modifications may be made to the invention as defined in the appended claims, and the invention may be modified without departing from the scope and spirit of the invention. Although the invention is described herein with reference to particular means, materials and embodiments, the invention is not intended to be limited to the particulars disclosed herein, as the invention extends to all other means and applications which perform the same function.

Sequence listing

<110> University of Beijing chemical industry

<120> Genetically engineered bacterium producing 3-hydroxypropionic acid and application thereof

<130> RB2102811-FF

<160> 46

<170> SIPOSequenceListing 1.0

<210> 1

<211> 66

<212> DNA

<213> (Mitochondrial localization sequence CAT2 m)

<400> 1

atgaggatct gtcattcgag aactctctca aacttaaagg atcttccgat aacgtcaagg 60

agagca 66

<210> 2

<211> 1650

<212> DNA

<213> （MCR-N）

<400> 2

agtggtacag gtagattagc aggtaaaata gcattgataa caggtggtgc cggtaacata 60

ggttccgaat taacaagaag atttttggca gaaggtgcca ccgttattat ctctggtaga 120

aacagagcaa agttaactgc cttggctgaa agaatgcaag cagaagccgg tgtccctgct 180

aagagaattg atttggaagt tatggatggt tctgacccag tcgctgtaag agcaggtatt 240

gaagccatag tagctagaca tggtcaaatc gatatcttgg ttaacaacgc aggttcagct 300

ggtgcacaaa gaagattggc tgaaattcct ttaactgaag cagaattggg tccaggtgcc 360

gaagaaacat tacatgcatc cattgccaat ttgttgggta tgggttggca tttgatgaga 420

atagctgcac cacacatgcc tgttggtagt gcagttataa acgtctccac catcttcagt 480

agagctgaat attacggtag aattccttat gttactccaa aagccgcttt aaatgcattg 540

tctcaattag cagccagaga attaggtgct agaggtatta gagttaacac catatttcca 600

ggtcctatcg aatcagatag aattagaact gtcttccaaa gaatggatca attaaagggt 660

agacctgaag gtgacacagc tcatcacttt ttaaacacca tgagattgtg tagagcaaac 720

gatcaaggtg ccttggaaag aagatttcca tctgtaggtg acgttgctga cgctgcagtc 780

ttcttagcct ccgctgaaag tgccgctttg tcaggtgaaa ctattgaagt tacacatggt 840

atggaattgc cagcctgctc tgaaacatca ttgttagcaa gaaccgattt gagaactatt 900

gacgcttctg gtagaactac attgatctgt gctggtgacc aaattgaaga agtcatggct 960

ttgacaggca tgttaagaac ctgcggttct gaagtaatca ttggttttag atcagcagcc 1020

gctttagctc aattcgaaca agcagttaat gaatcaagaa gattggcagg tgccgatttt 1080

acaccaccta tagctttacc attagatcca agagatccag caaccatcga tgccgtattc 1140

gactggggtg ctggtgaaaa tacaggtggt atacatgcag ccgttatctt accagctacc 1200

tctcacgaac cagcaccttg tgtcatagaa gtagatgacg aaagagtttt gaacttctta 1260

gctgatgaaa tcacaggtac cattgtcata gcttccagat tagcaagata ttggcaaagt 1320

caaagattga ctcctggtgc tagagcaaga ggtccaagag taatcttttt gtctaatggt 1380

gctgatcaaa acggtaacgt ttacggtaga attcaatcag ctgcaatagg tcaattaatc 1440

agagtttgga gacatgaagc tgaattggat taccaaagag catctgccgc tggtgaccac 1500

gtcttaccac ctgtatgggc caatcaaatt gttagatttg ctaacagatc cttggaaggt 1560

ttagaattcg cctgtgcttg gactgctcaa ttgttgcata gtcaaagaca catcaacgaa 1620

atcacattga acataccagc caacatctga 1650

<210> 3

<211> 2013

<212> DNA

<213> （MCR-mC）

<400> 3

tccgctacca ctggtgctag atctgcatca gttggttggg ctgaaagttt gatcggtttg 60

catttgggta aagtcgcatt gatcacaggt ggttccgccg gtatcggtgg tcaaattggt 120

agattgttag cattaagtgg tgccagagtt atgttggcag ccagagatag acataagtta 180

gaacaaatgc aagctatgat tcaatcagaa ttggcagaag ttggttacac tgatgttgaa 240

gacagagtcc acatagctcc aggttgcgat gtctcttcag aagcccaatt ggctgactta 300

gtagaaagaa ctttgtctgc tttcggtaca gttgattatt tgattaataa cgcaggtata 360

gccggtgtag aagaaatggt tatagatatg cctgttgaag gttggagaca tacattgttc 420

gcaaatttga tctccaacta cagtttgatg agaaagttgg ctccattaat gaaaaagcaa 480

ggttccggtt acatattgaa cgtttccagt tacttcggtg gtgaaaaaga tgctgcaata 540

ccatatccta acagagctga ctacgcagtc tctaaggcag gtcaaagagc aatggccgaa 600

gtatttgcta gattcttagg tcctgaaatc caaattaatg ctattgcacc aggtcctgtt 660

gaaggtgaca gattaagagg tactggtgaa agaccaggtt tgtttgccag aagagctaga 720

ttgatcttgg aaaataagag attgaacgaa ttacatgccg ctttgattgc agccgctaga 780

acagatgaaa gatctatgca cgaattagta gaattgttgt tgcctaatga cgttgcagcc 840

ttggaacaaa accctgctgc accaactgcc ttgagagaat tagctagaag attcagatct 900

gaaggtgacc cagccgcttc ttcatccagt gcattgttga acagatcaat agcagccaag 960

ttattggcta gattacataa cggtggttat gttttgcctg ctgatatttt tgcaaatttg 1020

cctaacccac ctgacccatt tttcacaaga gcccaaattg atagagaagc tagaaaggtt 1080

agagacggta tcatgggcat gttgtacttg caaagaatgc caaccgaatt tgatgttgcc 1140

atggctactg tctattactt agctgacaga gttgtttccg gtgaaacttt tcatcctagt 1200

ggtggtttga gatatgaaag aactccaaca ggtggtgaat tgttcggttt accatctcct 1260

gaaagattgg ctgaattagt cggttcaaca gtatacttaa taggtgaaca tttgaccgaa 1320

cacttaaatt tgttggcaag agcctatttg gaaagatacg gtgcaagaca agttgtcatg 1380

attgttgaaa ccgaaactgg tgctgaaaca atgagaagat tattgcatga tcacgttgaa 1440

gctggtagat tgatgaccat tgttgctggt gaccaaatag aagctgcaat cgaccaagct 1500

attactagat atggtagacc aggtcctgta gtttgtactc cttttagacc attacctaca 1560

gttccattgg tcggtagaaa agattctgac tggtcaacag ttttatcaga agcagaattt 1620

gccgaattat gcgaacatca attgactcat cacttcagag tcgccagatg gattgctttg 1680

tctgatggtg ctcgattagc attggtaacc ccagaaacaa ccgctacttc cactacagaa 1740

caattcgctt tggcaaactt catcaagacc actttgcatg ccttcacagc taccattggt 1800

gtagaaagtg aaagaactgc tcaaagaata ttaatcaacc aagttgattt gacaagaaga 1860

gccagagctg aagaacctag ggacccacac gaaagacaac aagaattaga aagattcatt 1920

gaagcagtat tgttggttac tgccccattg ccaccagaag cagacacaag atacgcaggt 1980

agaatccaca gaggtagagc cattacagtc taa 2013

<210> 4

<211> 694

<212> DNA

<213> (Promoter TDH3 p)

<400> 4

ataaaaaaca cgctttttca gttcgagttt atcattatca atactgccat ttcaaagaat 60

acgtaaataa ttaatagtag tgattttcct aactttattt agtcaaaaaa ttagcctttt 120

aattctgctg taacccgtac atgcccaaaa tagggggcgg gttacacaga atatataaca 180

tcgtaggtgt ctgggtgaac agtttattcc tggcatccac taaatataat ggagcccgct 240

ttttaagctg gcatccagaa aaaaaaagaa tcccagcacc aaaatattgt tttcttcacc 300

aaccatcagt tcataggtcc attctcttag cgcaactaca gagaacaggg gcacaaacag 360

gcaaaaaacg ggcacaacct caatggagtg atgcaacctg cctggagtaa atgatgacac 420

aaggcaattg acccacgcat gtatctatct cattttctta caccttctat taccttctgc 480

tctctctgat ttggaaaaag ctgaaaaaaa aggttgaaac cagttccctg aaattattcc 540

cctacttgac taataagtat ataaagacgg taggtattga ttgtaattct gtaaatctat 600

ttcttaaact tcttaaattc tacttttata gttagtcttt tttttagttt taaaacacca 660

agaacttagt ttcgaataaa cacacataaa caaa 694

<210> 5

<211> 402

<212> DNA

<213> (Promoter TEF1 p)

<400> 5

ttcaaaatgt ttctactcct tttttactct tccagatttt ctcggactcc gcgcatcgcc 60

gtaccacttc aaaacaccca agcacagcat actaaatttc ccctctttct tcctctaggg 120

tgtcgttaat tacccgtact aaaggtttgg aaaagaaaaa agagaccgcc tcgtttcttt 180

ttcttcgtcg aaaaaggcaa taaaaatttt tatcacgttt ctttttcttg aaaatttttt 240

tttttgattt ttttctcttt cgatgacctc ccattgatat ttaagttaat aaacggtctt 300

caatttctca agtttcagtt tcatttttct tgttctatta caactttttt tacttcttgc 360

tcattagaaa gaaagcatag caatctaatc taagttttct ag 402

<210> 6

<211> 46

<212> DNA

<213> (Primer P124)

<400> 6

aaaggtctca atcttcatta tcaatactgc catttcaaag aatacg 46

<210> 7

<211> 69

<212> DNA

<213> (Primer P125)

<400> 7

aaaggtctca gagagagttc tcgaatgaca gatcctcatt ttgtttgttt atgtgtgttt 60

attcgaaac 69

<210> 8

<211> 72

<212> DNA

<213> (Primer P126)

<400> 8

aggtctcatc tcaaacttaa aggatcttcc gataacgtca aggagagcaa gtggtacagg 60

tagattagca gg 72

<210> 9

<211> 31

<212> DNA

<213> (Primer P127)

<400> 9

aaaggtctca cctaggttct tcagctctgg c 31

<210> 10

<211> 33

<212> DNA

<213> (Primer P128)

<400> 10

aaaggtctca tagggaccca cacgaaagac aac 33

<210> 11

<211> 33

<212> DNA

<213> (Primer P129)

<400> 11

aaaggtctca cgaccttcga gcgtcccaaa acc 33

<210> 12

<211> 30

<212> DNA

<213> (Primer P140)

<400> 12

aaaggtctca cagatcttat cgtcgtcatc 30

<210> 13

<211> 33

<212> DNA

<213> (Primer P141)

<400> 13

aaaggtctca atctcctgga agtaccttca aag 33

<210> 14

<211> 35

<212> DNA

<213> (Primer P144)

<400> 14

aaaggtctca tgagctctta attaacaatt cttcg 35

<210> 15

<211> 30

<212> DNA

<213> (Primer P145)

<400> 15

aaaggtctca cgaccagctg gataaaggcg 30

<210> 16

<211> 34

<212> DNA

<213> (Primer P142)

<400> 16

aaaggtctca tctgatgagg atctgtcatt cgag 34

<210> 17

<211> 33

<212> DNA

<213> (Primer P143)

<400> 17

aaaggtctca ctcagatgtt ggctggtatg ttc 33

<210> 18

<211> 46

<212> DNA

<213> (Primer P124)

<400> 18

aaaggtctca atcttcatta tcaatactgc catttcaaag aatacg 46

<210> 19

<211> 33

<212> DNA

<213> (Primer P139)

<400> 19

aaaggtctca cggatgctct ccttgacgtt atc 33

<210> 20

<211> 26

<212> DNA

<213> (Primer P138)

<400> 20

aaaggtctca tccgctacca ctggtg 26

<210> 21

<211> 33

<212> DNA

<213> (Primer P129)

<400> 21

aaaggtctca cgaccttcga gcgtcccaaa acc 33

<210> 22

<211> 46

<212> DNA

<213> (Primer P124)

<400> 22

aaaggtctca atcttcatta tcaatactgc catttcaaag aatacg 46

<210> 23

<211> 37

<212> DNA

<213> (Primer P134)

<400> 23

aaaggtctca caactctgtc agctaagtaa tagacag 37

<210> 24

<211> 32

<212> DNA

<213> (Primer P135)

<400> 24

aaaggtctca gttgtttccg gtgaaacttt tc 32

<210> 25

<211> 41

<212> DNA

<213> (Primer P146)

<400> 25

aaaggtctca agacaaagca atccatctgg cgactctgaa g 41

<210> 26

<211> 43

<212> DNA

<213> (Primer P137)

<400> 26

aaaggtctca gtctgatggt gctcgattag cattggtaac ccc 43

<210> 27

<211> 33

<212> DNA

<213> (Primer P129)

<400> 27

aaaggtctca cgaccttcga gcgtcccaaa acc 33

<210> 28

<211> 74

<212> DNA

<213> (Primer XI-3-MCR-N-up)

<400> 28

actgattagt tttccgtttt aggatattga cgccaagcgt gcgtctgatt ctggaagtac 60

cttcaaagaa tggg 74

<210> 29

<211> 72

<212> DNA

<213> (Primer P155)

<400> 29

cggaacggtc gaccagctgg ataaaggcgc gccaaacgac ctaggaattg gagcgacctc 60

atgctatacc tg 72

<210> 30

<211> 69

<212> DNA

<213> (Primer XI-3-CaMCR-dw)

<400> 30

cagcccaatc ctcaaaaata aaatggccct tccaaaatta gagacatatc cttcgagcgt 60

cccaaaacc 69

<210> 31

<211> 82

<212> DNA

<213> (Primer P156)

<400> 31

caattcctag gtcgtttggc gcgcctttat ccagctggtc gaccgttccg tcattatcaa 60

tactgccatt tcaaagaata cg 82

<210> 32

<211> 74

<212> DNA

<213> (Primer X-4-MCR-N-up)

<400> 32

ccaactacca aggttgttga gggaacactg gggcaatagg ctgtcgccat ctggaagtac 60

cttcaaagaa tggg 74

<210> 33

<211> 72

<212> DNA

<213> (Primer P155)

<400> 33

cggaacggtc gaccagctgg ataaaggcgc gccaaacgac ctaggaattg gagcgacctc 60

atgctatacc tg 72

<210> 34

<211> 69

<212> DNA

<213> (Primer X-4-CaMCR-dw)

<400> 34

cagacatcag acatactatt gtaattcaaa aaaaaaaagc gaatcttccc cttcgagcgt 60

cccaaaacc 69

<210> 35

<211> 82

<212> DNA

<213> (Primer P156)

<400> 35

caattcctag gtcgtttggc gcgcctttat ccagctggtc gaccgttccg tcattatcaa 60

tactgccatt tcaaagaata cg 82

<210> 36

<211> 60

<212> DNA

<213> (Primer IDP1p_g)

<400> 36

aaaggtctct gatctgtgag acaacagacg cacagtttta gagctagaaa tagcaagtta 60

<210> 37

<211> 49

<212> DNA

<213> (Primer Ura3_Bs1)

<400> 37

aaaggtctca aaacacacag ggtaataact gatataatta aattgaagc 49

<210> 38

<211> 77

<212> DNA

<213> (Primer IDP1_TEF1p-f 2)

<400> 38

ccatataaag agggactcat atgatcttat gaaatcttcc ttcaagcaat ttcaaaatgt 60

ttctactcct tttttac 77

<210> 39

<211> 77

<212> DNA

<213> (Primer IDP1_TEF1p-r)

<400> 39

aaagcagcaa ggcgagaggt ggaaaataat cttctagata acatactcat ctagaaaact 60

tagattagat tgctatg 77

<210> 40

<211> 36

<212> DNA

<213> (Primer TDH3 p-GG-r)

<400> 40

aaaggtctca tttgtttgtt tatgtgtgtt tattcg 36

<210> 41

<211> 35

<212> DNA

<213> (Primer TDH3 p-GG-f)

<400> 41

aaaggtctca atctacctcg agataaaaaa cacgc 35

<210> 42

<211> 35

<212> DNA

<213> (Primer POS5 t-GG-r)

<400> 42

aaaggtctca cgacacgaaa catagtctct ctcca 35

<210> 43

<211> 38

<212> DNA

<213> (Primer POS 5-GG-f)

<400> 43

aaaggtctca caaaatgttt gtcagggtta aattgaat 38

<210> 44

<211> 1287

<212> DNA

<213> (Mitochondrial NADP-specific isocitrate dehydrogenase-encoding gene IDP 1)

<400> 44

atgagtatgt tatctagaag attattttcc acctctcgcc ttgctgcttt cagtaagatt 60

aaggtcaaac aacccgttgt cgagttggac ggtgatgaaa tgacccgtat catttgggat 120

aagatcaaga agaaattgat tctaccctac ttggacgtag atttgaagta ctacgactta 180

tctgtcgaat ctcgtgacgc cacctccgac aagattactc aggatgctgc tgaggcgatc 240

aagaagtatg gtgttggtat caaatgtgcc accatcactc ctgatgaagc tcgtgtgaag 300

gaattcaacc tgcacaagat gtggaaatct cctaatggta ccatcagaaa cattctcggc 360

ggtacagtgt tcagagagcc cattgtgatt cctagaattc ctagactggt cccacgttgg 420

gaaaaaccaa tcattattgg aagacacgcc cacggtgatc aatataaagc tacggacaca 480

ctgatcccag gcccaggatc tttggaactg gtctacaagc catccgaccc tacgactgct 540

caaccacaaa ctttgaaagt gtatgactac aagggcagtg gtgtggccat ggccatgtac 600

aatactgacg aatccatcga agggtttgct cattcgtctt tcaagctggc cattgacaaa 660

aagctaaatc ttttcttgtc aaccaagaac actattttga agaaatatga cggtcggttc 720

aaagacattt tccaagaagt ttatgaagct caatataaat ccaaattcga acaactaggg 780

atccactatg aacaccgttt aattgatgat atggtcgctc aaatgataaa atctaaaggt 840

ggctttatca tggcgctaaa gaactatgac ggtgatgtcc aatctgacat cgtcgctcaa 900

ggatttggct ccttaggttt gatgacttct atcttagtta caccagacgg taaaactttc 960

gaaagtgaag ctgctcatgg taccgtgaca agacattata gaaagtacca aaagggtgaa 1020

gaaacttcta caaactccat tgcatccatt ttcgcgtggt cgagaggtct attgaagaga 1080

ggtgaattgg acaatactcc tgctttgtgt aaatttgcca atattttgga atccgccact 1140

ttgaacacag ttcagcaaga cggtatcatg acgaaggact tggctttggc ttgcggtaac 1200

aacgaaagat ctgcttatgt taccacagaa gaatttttgg atgccgttga aaaaagacta 1260

caaaaagaaa tcaagtcgat cgagtaa 1287

<210> 45

<211> 1245

<212> DNA

<213> (Mitochondrial NADH kinase encoding gene POS 5)

<400> 45

atgtttgtca gggttaaatt gaataaacca gtaaaatggt ataggttcta tagtacgttg 60

gattcacatt ccctaaagtt acagagcggc tcgaagtttg taaaaataaa gccagtaaat 120

aacttgagga gtagttcatc agcagatttc gtgtccccac caaattccaa attacaatct 180

ttaatctggc agaacccttt acaaaatgtt tatataacta aaaaaccatg gactccatcc 240

acaagagaag cgatggttga attcataact catttacatg agtcataccc cgaggtgaac 300

gtcattgttc aacccgatgt ggcagaagaa atttcccagg atttcaaatc tcctttggag 360

aatgatccca accgacctca tatactttat actggtcctg aacaagatat cgtaaacaga 420

acagacttat tggtgacatt gggaggtgat gggactattt tacacggcgt atcaatgttc 480

ggaaatacgc aagttcctcc ggttttagca tttgctctgg gcactctggg ctttctatca 540

ccgtttgatt ttaaggagca taaaaaggtc tttcaggaag taatcagctc tagagccaaa 600

tgtttgcata gaacacggct agaatgtcat ttgaaaaaaa aggatagcaa ctcatctatt 660

gtgacccatg ctatgaatga catattctta cataggggta attcccctca tctcactaac 720

ctggacattt tcattgatgg ggaatttttg acaagaacga cagcagatgg tgttgcattg 780

gccactccaa cgggttccac agcatattca ttatcagcag gtggatctat tgtttcccca 840

ttagtccctg ctattttaat gacaccaatt tgtcctcgct ctttgtcatt ccgaccactg 900

attttgcctc attcatccca cattaggata aagataggtt ccaaattgaa ccaaaaacca 960

gtcaacagtg tggtaaaact ttctgttgat ggtattcctc aacaggattt agatgttggt 1020

gatgaaattt atgttataaa tgaggtcggc actatataca tagatggtac tcagcttccg 1080

acgacaagaa aaactgaaaa tgactttaat aattcaaaaa agcctaaaag gtcagggatt 1140

tattgtgtcg ccaagaccga gaatgactgg attagaggaa tcaatgaact tttaggattc 1200

aattctagct ttaggctgac caagagacag actgataatg attaa 1245

<210> 46

<211> 2013

<212> DNA

<213> （MCR-C）

<400> 46

tccgctacca ctggtgctag atctgcatca gttggttggg ctgaaagttt gatcggtttg 60

catttgggta aagtcgcatt gatcacaggt ggttccgccg gtatcggtgg tcaaattggt 120

agattgttag cattaagtgg tgccagagtt atgttggcag ccagagatag acataagtta 180

gaacaaatgc aagctatgat tcaatcagaa ttggcagaag ttggttacac tgatgttgaa 240

gacagagtcc acatagctcc aggttgcgat gtctcttcag aagcccaatt ggctgactta 300

gtagaaagaa ctttgtctgc tttcggtaca gttgattatt tgattaataa cgcaggtata 360

gccggtgtag aagaaatggt tatagatatg cctgttgaag gttggagaca tacattgttc 420

gcaaatttga tctccaacta cagtttgatg agaaagttgg ctccattaat gaaaaagcaa 480

ggttccggtt acatattgaa cgtttccagt tacttcggtg gtgaaaaaga tgctgcaata 540

ccatatccta acagagctga ctacgcagtc tctaaggcag gtcaaagagc aatggccgaa 600

gtatttgcta gattcttagg tcctgaaatc caaattaatg ctattgcacc aggtcctgtt 660

gaaggtgaca gattaagagg tactggtgaa agaccaggtt tgtttgccag aagagctaga 720

ttgatcttgg aaaataagag attgaacgaa ttacatgccg ctttgattgc agccgctaga 780

acagatgaaa gatctatgca cgaattagta gaattgttgt tgcctaatga cgttgcagcc 840

ttggaacaaa accctgctgc accaactgcc ttgagagaat tagctagaag attcagatct 900

gaaggtgacc cagccgcttc ttcatccagt gcattgttga acagatcaat agcagccaag 960

ttattggcta gattacataa cggtggttat gttttgcctg ctgatatttt tgcaaatttg 1020

cctaacccac ctgacccatt tttcacaaga gcccaaattg atagagaagc tagaaaggtt 1080

agagacggta tcatgggcat gttgtacttg caaagaatgc caaccgaatt tgatgttgcc 1140

atggctactg tctattactt agctgacaga aatgtttccg gtgaaacttt tcatcctagt 1200

ggtggtttga gatatgaaag aactccaaca ggtggtgaat tgttcggttt accatctcct 1260

gaaagattgg ctgaattagt cggttcaaca gtatacttaa taggtgaaca tttgaccgaa 1320

cacttaaatt tgttggcaag agcctatttg gaaagatacg gtgcaagaca agttgtcatg 1380

attgttgaaa ccgaaactgg tgctgaaaca atgagaagat tattgcatga tcacgttgaa 1440

gctggtagat tgatgaccat tgttgctggt gaccaaatag aagctgcaat cgaccaagct 1500

attactagat atggtagacc aggtcctgta gtttgtactc cttttagacc attacctaca 1560

gttccattgg tcggtagaaa agattctgac tggtcaacag ttttatcaga agcagaattt 1620

gccgaattat gcgaacatca attgactcat cacttcagag tcgccagaaa gattgctttg 1680

tctgatggtg cttcattagc attggtaacc ccagaaacaa ccgctacttc cactacagaa 1740

caattcgctt tggcaaactt catcaagacc actttgcatg ccttcacagc taccattggt 1800

gtagaaagtg aaagaactgc tcaaagaata ttaatcaacc aagttgattt gacaagaaga 1860

gccagagctg aagaacctag ggacccacac gaaagacaac aagaattaga aagattcatt 1920

gaagcagtat tgttggttac tgccccattg ccaccagaag cagacacaag atacgcaggt 1980

agaatccaca gaggtagagc cattacagtc taa 2013

Claims (8)

1. A genetically engineered bacterium for producing 3-hydroxy propionic acid, which is a recombinant saccharomyces cerevisiae with exogenous modified malonyl-coa reductase gene MCR in the genome;

The recombinant saccharomyces cerevisiae takes wild saccharomyces cerevisiae as host bacteria, positions an exogenous modified malonyl-CoA reductase gene MCR in the mitochondria of the saccharomyces cerevisiae, and expresses the modified malonyl-CoA reductase gene on a chromosome in two copies;

the MCR gene is split into two sections of MCR-N and MCR-C, and the MCR-C is subjected to N940V, K1106W, S1114R point mutation transformation;

the exogenous modified malonyl-coa reductase gene MCR is malonyl-coa reductase gene MCR from green-flex orange (Chloroflexus aurantiacus);

wherein the nucleotide sequence of the MCR-N is shown in SEQ No.2, and the nucleotide sequence of the MCR-C modified by N940V, K1106W, S1114R point mutation is shown in SEQ No. 3.

2. The genetically engineered bacterium of claim 1, wherein MCR-N is expressed using a promoter PGK1p, MCR-C is expressed using a promoter TDH3p, and each segment of gene has a mitochondrial localization sequence CAT2m attached to the 5' end, and MCR-N is linked to MCR-C and inserted into one copy at each of chromosome XI-3 and X-4 positions.

3. The genetically engineered bacterium of claim 1 or 2, wherein the genetically engineered bacterium further overexpresses an endogenous mitochondrial NADP-specific isocitrate dehydrogenase encoding gene IDP1 and a mitochondrial NADH kinase encoding gene POS5.

4. The genetically engineered bacterium of claim 3, wherein mitochondrial NADP-specific isocitrate dehydrogenase encoding gene IDP1 is overexpressed by replacing its original promoter on the chromosome as promoter TEF1 p; and/or, the overexpression of the mitochondrial NADH kinase encoding gene POS5 is achieved by replacing the promoter thereof with a TDH3p promoter and introducing the same into the strain in the form of a high-copy plasmid.

5. The use of the genetically engineered bacterium of any one of claims 1-4 in the synthesis of 3-hydroxypropionic acid.

6. The use according to claim 5, wherein the use comprises fermentation culture of the genetically engineered bacterium to produce 3-hydroxypropionic acid.

7. The use according to claim 6, wherein the shake flask fermentation culture conditions are: the temperature is 30 ℃, the rotation speed of the shaking table is 200rpm, and the culture medium consists of 5g/L (NH ₄)₂SO₄、3g/L KH₂PO₄、0.5g/LMgSO₄·7H₂ O, trace metal elements, vitamins and 20g/L glucose).

8. The use according to claim 6, wherein the fermenter feed batch fermentation culture conditions are: the pH is maintained at 5, the temperature is maintained at 30 ℃, the dissolved oxygen limit value is 30%, the ventilation is maintained at 0.5VVm, the stirring is set at 400-1200rpm, and the composition of the feed medium is 67.5g/L(NH₄)₂SO₄、27g/LKH₂PO₄、4.5g/L MgSO₄·7H₂O、 trace metal elements, vitamins and 300g/L glucose.