CN105802984B - Method for producing propionic acid by microorganisms - Google Patents
Method for producing propionic acid by microorganisms Download PDFInfo
- Publication number
- CN105802984B CN105802984B CN201610227348.3A CN201610227348A CN105802984B CN 105802984 B CN105802984 B CN 105802984B CN 201610227348 A CN201610227348 A CN 201610227348A CN 105802984 B CN105802984 B CN 105802984B
- Authority
- CN
- China
- Prior art keywords
- mseed
- gene
- plasmid
- microorganism
- propionic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/52—Propionic acid; Butyric acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01075—Malonyl CoA reductase (malonate semialdehyde-forming)(1.2.1.75)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/01—Hydro-lyases (4.2.1)
- C12Y402/01116—3-Hydroxypropionyl-CoA dehydratase (4.2.1.116)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y602/00—Ligases forming carbon-sulfur bonds (6.2)
- C12Y602/01—Acid-Thiol Ligases (6.2.1)
- C12Y602/01036—3-Hydroxypropionyl-CoA synthase (6.2.1.36)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/59—Biological synthesis; Biological purification
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for producing propionic acid by microorganisms, and belongs to the field of production of renewable energy sources, biomass energy sources and chemical raw materials. Introducing exogenous genes, namely malonyl coenzyme A reductase gene, malonate semialdehyde reductase gene, 3-hydroxypropionyl coenzyme A synthetase gene, 3-hydroxypropionyl coenzyme A dehydratase gene and acrylyl coenzyme A reductase gene, into a microorganism so as to catalyze the malonyl coenzyme A of the microorganism to obtain propionic acid; the microorganism is escherichia coli. The invention realizes that the reformed microorganism directly utilizes the carbon dioxide to synthesize the propionic acid, does not need to utilize petroleum resources to carry out chemical synthesis, reduces the consumption of petroleum and the pollution to the environment, is a reproducible, low-consumption and environment-friendly technology, and can relieve the current greenhouse effect. The invention can be directly applied to industrial production by fixing carbon dioxide through microorganisms to produce propionic acid.
Description
the invention relates to a divisional application of an invention patent with the application number of '2014100355846', the application date of the original application is '24/1/2014', the application number is '2014100355846', and the invention name is 'a method for producing 3-hydroxypropionic acid, acrylic acid and propionic acid by fixing carbon dioxide in a microorganism body'.
Technical Field
the invention belongs to the field of production of renewable energy sources, biomass energy sources and chemical raw materials, and particularly relates to a method for producing 3-hydroxypropionic acid, acrylic acid and propionic acid by fixing carbon dioxide in a microorganism.
Background
Almost all autotrophs in the biological world are required carbon sources obtained through the carbon fixation process, and the fixation of carbon dioxide in the atmosphere is crucial and is considered as one of the most important life processes on the earth. Among the ways in which carbon dioxide can be fixed that have been discovered to date are: the calvin cycle, the citric acid reduction cycle, the acetyl-coenzyme a reduction cycle and the 3-hydroxypropionic acid cycle, and in 2007, the Georg Fuchs group discovered a fifth carbon dioxide fixation mode in the archaea metalosphaea sedula: the 3-hydroxypropionic acid/4-hydroxybutyric acid cycle (Berg I A, Kockelkorn D, Buckel W, et al, A3-hydroxyproprionate/4-hydroxybutryate autographic carbon dioxide assaying pathway in Archaea science,2007,318(5857):1782 and 1786) is characterized in that two molecules of carbon dioxide are fixed through one cycle to form one sub-acetyl-CoA, and 3-hydroxypropionic acid and 4-hydroxybutyric acid intermediate metabolites exist in the cycle, so the cycle is called 3-hydroxypropionic acid/4-hydroxybutyric acid cycle.
The 3-hydroxypropionic acid has two functional groups of hydroxyl and carboxyl, is a precursor of a plurality of optically active substances, and is an important chemical platform product. The energy department of the united states of 2004 listed it as one of the 12 most potential chemical products in the world today. Acrylic acid is an important organic synthetic raw material and a synthetic resin monomer, is an ethylene monomer with a very high polymerization speed, and a polymer of the acrylic acid is used in industrial departments such as synthetic resin, adhesives, synthetic rubber, synthetic fibers, super absorbent resin, pharmacy, building materials, oil exploitation, coatings and the like. Meanwhile, acrylic acid is one of important raw materials of water-soluble polymers, and can be copolymerized with starch to prepare the super-absorbent. The main application of propionic acid is as follows: used as esterifying agent, solvent of nitrocellulose, plasticizer, chemical kit, food material, etc. The propionic acid has the antifungal and mildew-proof effects superior to benzoic acid at the pH value of below 6 and the price lower than sorbic acid, and is one of ideal food preservatives, so that the propionic acid has a huge potential market in China as the food preservative. Propionic acid can be used for producing propionamide, and then produce some herbicide varieties. In the pharmaceutical industry, the main derivatives of propionic acid include vitamin B6, naproxen, Naemarrhena, etc. Propionic acid can also be made into perfume, and can be used for food, cosmetic, and soap. In addition, propionic acid can be used to prepare biodegradable plastics. At present, 3-hydroxypropionic acid, acrylic acid and propionic acid are mainly synthesized by a chemical method, but the current chemical synthesis method has high cost, causes environmental pollution and consumes precious petroleum resources.
There are many successful examples of products produced by fermentation using microorganisms in the industry today. The production of 3-hydroxypropionic acid, acrylic acid and propionic acid, by microbial immobilization of carbon dioxide is of great significance.
disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a method for producing 3-hydroxypropionic acid, acrylic acid and propionic acid by fixing carbon dioxide in a microorganism.
it is also an object of the present invention to provide a microorganism producing 3-hydroxypropionic acid, acrylic acid and propionic acid.
the purpose of the invention is realized by the following technical scheme:
a method for producing 3-hydroxypropionic acid, acrylic acid, and propionic acid by immobilizing carbon dioxide in a microorganism, comprising the steps of: transferring at least one of the genes encoding the following functional proteins into a microorganism: malonyl-coa reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-coa synthetase or a functional equivalent thereof, 3-hydroxypropionyl-coa dehydratase or a functional equivalent thereof, and acrylyl-coa reductase or a functional equivalent thereof, so that the microorganism can express the corresponding functional protein. Malonyl coenzyme A reductase can change malonyl coenzyme A into malonic semialdehyde, malonic semialdehyde reductase can change malonic semialdehyde into 3-hydroxypropionic acid, 3-hydroxypropionyl coenzyme A synthetase can change 3-hydroxypropionic acid into 3-hydroxypropionyl coenzyme A, 3-hydroxypropionyl coenzyme A dehydratase can change 3-hydroxypropionyl coenzyme A into acrylyl coenzyme A, acrylyl coenzyme A reductase can change acrylyl coenzyme A into acrylyl coenzyme A.
Preferably, 3-hydroxypropionic acid is produced by transferring at least one of the genes encoding malonyl-CoA reductase or a functional equivalent thereof and malonate semialdehyde reductase or a functional equivalent thereof into a microorganism;
Transferring at least one of genes encoding malonyl-CoA reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-CoA synthetase or a functional equivalent thereof, and 3-hydroxypropionyl-CoA dehydratase or a functional equivalent thereof into a microorganism to produce acrylic acid;
Propionic acid can be produced by transferring at least one of genes encoding malonyl-CoA reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-CoA synthetase or a functional equivalent thereof, 3-hydroxypropionyl-CoA dehydratase or a functional equivalent thereof, and acrylyl-CoA reductase or a functional equivalent thereof into a microorganism.
preferably, the malonyl-coa reductase or a functional equivalent thereof is: 1) protein composed of amino acid sequence shown in SEQ ID No. 1; or, 2) protein which is formed by inserting, substituting and/or adding one or more amino acids into the amino acid shown in SEQ ID No.1 and has the same function with the amino acid; the malonate semialdehyde reductase or a functional equivalent thereof is as follows: 1) protein composed of amino acid sequence shown in SEQ ID No. 2; or, 2) protein which is formed by inserting, substituting and/or adding one or more amino acids into the amino acid shown in SEQ ID No.2 and has the same function with the amino acid; the 3-hydroxypropionyl coenzyme A synthetase or a functional equivalent thereof is as follows: 1) a protein consisting of an amino acid sequence shown in SEQ ID No. 3; or, 2) protein which is formed by inserting, substituting and/or adding one or more amino acids into the amino acid shown in SEQ ID No.3 and has the same function with the amino acid; the 3-hydroxypropionyl coenzyme A dehydratase or a functional equivalent thereof is: 1) protein consisting of an amino acid sequence shown in SEQ ID No. 4; or, 2) protein which is formed by inserting, substituting and/or adding one or more amino acids into the amino acid shown in SEQ ID No.4 and has the same function with the amino acid; the acrylyl coenzyme A reductase or a functional equivalent thereof is: 1) protein consisting of an amino acid sequence shown in SEQ ID No. 5; or, 2) protein which is formed by inserting, substituting and/or adding one or more amino acids into the amino acid shown in SEQ ID No.5 and has the same function with the amino acid.
more preferably, the genes encoding malonyl-coa reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-coa synthetase or a functional equivalent thereof, 3-hydroxypropionyl-coa dehydratase or a functional equivalent thereof, and acrylyl-coa reductase or a functional equivalent thereof are the metallohalopharmala sedales _0709, Msed _1993, Msed _1456, Msed _2001, and Msed _1426 genes.
The microorganism comprises at least one of prokaryotic microorganism or eukaryotic microorganism (autotrophic microorganism or heterotrophic microorganism); preferably, the microorganism is at least one selected from the group consisting of bacteria, fungi, algae, actinomycetes, spirochetes, mycoplasma, chlamydia, rickettsia, viruses and yeasts; more preferably, the microorganism is yeast or E.coli.
the expression mode of the gene is induced or self-expressed.
The carbon dioxide may be environmental or produced by microbial metabolism.
In addition, the method further comprises the steps of: optimizing at least one of the genes encoding malonyl-coa reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-coa synthetase or a functional equivalent thereof, 3-hydroxypropionyl-coa dehydratase or a functional equivalent thereof, and acrylyl-coa reductase or a functional equivalent thereof according to codon preference of the microorganism to increase the production of 3-hydroxypropionic acid, acrylic acid, and propionic acid; or engineering a metabolic pathway of the microorganism to increase the amount of acetyl-coa and/or malonyl-coa to increase the production of 3-hydroxypropionic acid, acrylic acid and propionic acid, such as: knock out the other pathway of consuming acetyl-CoA to increase the amount of acetyl-CoA, overexpress acetyl-CoA carboxylase to increase the amount of malonyl-CoA.
A microorganism producing 3-hydroxypropionic acid, acrylic acid and propionic acid comprising at least one gene encoding malonyl-coa reductase or a functional equivalent thereof, malonate semialdehyde reductase or a functional equivalent thereof, 3-hydroxypropionyl-coa synthetase or a functional equivalent thereof, 3-hydroxypropionyl-coa dehydratase or a functional equivalent thereof, and acrylyl-coa reductase or a functional equivalent thereof.
the gene is cloned on a vector and then transformed into a microorganism for expression.
the microorganism may overexpress acetyl-coa and/or malonyl-coa.
The invention has the advantages that exogenous genes are introduced into microorganisms to realize the purpose of producing 3-hydroxypropionic acid, acrylic acid and propionic acid by fixing carbon dioxide, petroleum resources are not needed for chemical synthesis, the consumption of precious petroleum resources is reduced, the pollution to the environment is reduced, more importantly, the carbon dioxide is used for producing chemicals, the sustainable development is really realized, and on the other hand, the greenhouse benefit can be greatly relieved, and the invention has important significance for the quality of life of human beings. Meanwhile, as most of microorganisms grow fast, the method is easy to reform and is not influenced by weather, seasons and the like, and continuous production can be realized. The surface modification of microorganisms to fix carbon dioxide for industrial production is feasible.
Drawings
FIG. 1 is a schematic diagram of plasmid pYW1, and the Mseed _0709 gene is cloned on pER28a plasmid through NdeI and EcoRI restriction enzyme sites at both ends.
FIG. 2 is a schematic diagram of plasmid pYW2, and the Mseed _1456 gene was cloned on pER28a plasmid via NdeI and EcoRI restriction endonuclease sites at both ends.
FIG. 3 is a schematic representation of plasmid pYW3, in which the Mseed _2001 gene was cloned on pER28a by NdeI and EcoRI restriction endonuclease sites at both ends.
FIG. 4 is a schematic representation of plasmid pYW4, the Mseed-1993 gene cloned on pER28a plasmid through NdeI and HindIII restriction sites on both ends.
FIG. 5 is a schematic representation of plasmid pYW5, in which the Mseed _1426 gene was cloned on pER28a plasmid via NdeI and EcoRI restriction endonuclease sites at both ends.
FIG. 6 is a schematic diagram of plasmid pYW6, which is prepared by cleaving the Mseed _1456 gene fragment on plasmid pYW2 and then ligating it to the rear end of the Mseed _0709 gene on pYW1 to express the Mseed _1456 and Mseed _0709 genes.
FIG. 7 is a schematic diagram of plasmid pYW7, which is prepared by cleaving the Mseed _2001 gene fragment on plasmid pYW3 and ligating it to pYW2 at the rear end of the Mseed _1456 gene and expressing the Mseed _1456, Mseed _0709 and Mseed _2001 genes.
FIG. 8 is a schematic diagram of plasmid pZL31, wherein the Mseed _1993 gene fragment on plasmid pYW4 is cut off by enzyme and then is connected to the rear end of the Mseed _0709 gene on pYW1, and the Mseed _1993 and Mseed _0709 genes are expressed at the same time.
FIG. 9 is a schematic diagram of plasmid pZL32, which is prepared by cleaving the Mseed _1993 gene fragment on plasmid pYW4 and then ligating it to pYW7 at the rear end of the Mseed _2001 gene, and expressing the Mseed _1993, Mseed _1456, Mseed _0709 and Mseed _2001 genes.
FIG. 10 is a schematic diagram of plasmid pZL33, wherein the Mseed _1426 gene fragment on plasmid pYW5 is cut off by enzyme and then ligated to the rear end of the Mseed _2001 gene on pYW7, and the Mseed _1426, Mseed _1456, Mseed _0709 and Mseed _2001 genes are expressed at the same time.
FIG. 11 is a schematic diagram of plasmid pZL34, wherein the Mseed _1993 gene fragment on plasmid pYW4 is cut off and then ligated to the rear end of the Mseed _1426 gene on pZL33, and the Mseed _1993, Mseed _1426, Mseed _1456, Mseed _0709 and Mseed _2001 genes are expressed at the same time.
FIG. 12 is a schematic representation of plasmid pDG001, replacing the inducible promoters GAL1 and GAL10 on the Saccharomyces cerevisiae two-gene co-expression vector pESC-URA with the constitutive promoters TEF1 and HXT7, respectively.
FIG. 13 is a schematic representation of plasmid pZL35, the Mseed-1993 gene cloned on the pDG001 plasmid.
FIG. 14 is a schematic representation of plasmid pZL36, cloning of the Mseed _0709 gene on pZL35 plasmid, with expression of the Mseed _1993 and Mseed _0709 genes.
FIG. 15 is a graph showing the co-expression of pZL31 and pMSD8 plasmids in E.coli, and the identification of the production of 3-hydroxypropionic acid by GC-MS after fermentation and extraction of the product.
FIG. 16 is a graph showing the co-expression of pZL32 and pMSD8 plasmids in E.coli, and the identification of the production of acrylic acid by GC-MS after fermentation and extraction of the product.
FIG. 17 is a graph showing the co-expression of pZL34 and pMSD8 plasmids in E.coli, and the identification of propionic acid production by GC-MS after fermentation and extraction of the product.
FIG. 18 is a graph showing the expression of pZL36 plasmid in Saccharomyces cerevisiae, and the identification of the production of 3-hydroxypropionic acid by GC-MS after fermentation and extraction of the product.
Detailed Description
the object of the invention is achieved by the following measures:
exogenous genes, namely malonyl-CoA reductase gene and malonate semialdehyde reductase gene, are introduced into a microorganism body, so that the self malonyl-CoA is catalyzed to obtain the 3-hydroxypropionic acid.
Exogenous genes, namely malonyl coenzyme A reductase gene, malonate semialdehyde reductase gene, 3-hydroxypropionyl coenzyme A synthetase gene and 3-hydroxypropionyl coenzyme A dehydratase gene, are introduced into a microorganism body so as to catalyze the malonyl coenzyme A of the microorganism body to obtain acrylic acid.
Exogenous genes, namely malonyl coenzyme A reductase gene, malonate semialdehyde reductase gene, 3-hydroxypropionyl coenzyme A synthetase gene, 3-hydroxypropionyl coenzyme A dehydratase gene and acrylyl coenzyme A reductase gene, are introduced into a microorganism so as to catalyze the malonyl coenzyme A of the microorganism to obtain propionic acid.
The following examples are intended to further illustrate the invention but should not be construed as limiting it.
In the examples, Escherichia coli BL21(DE3) was selected as a production strain, and its expression vector pET28a was selected. Meanwhile, uracil-deficient saccharomyces cerevisiae CEN.PK2-1C is selected, and meanwhile, an expression double-gene co-expression vector pESC-URA is selected, and two promoters of the vector are modified into a constitutive type.
genes encoding Metallosphaera sedula malonyl coenzyme A reductase, 3-hydroxypropionyl coenzyme A synthetase, 3-hydroxypropionyl coenzyme A dehydratase, malonate semialdehyde reductase and acrylyl coenzyme A reductase were Msed _0709, Msed _1456, Msed _2001, Msed _1993 and Msed _1426(GenBank: CP000682.1) were constructed into expression vector pET28a to obtain plasmids pYW1, pYW2, pYW3, pYW4 and pYW5, respectively, and the schematic diagrams of the plasmids are shown in FIGS. 1 to 5.
Each gene fragment was PCR amplified using the genome of metalosphaera sedula as template, with the restriction sites underlined:
An Mseed _0709 upstream primer GGA CATATG AGGAGAACGCTAAAGGCCG,
The Mseed _0709 downstream primer is CTT GAATTCACTAGT TCATCTCTTGTCTATGTAGCCCTTCTCC;
An Mseed-1456 upstream primer GGT CATATG TTTATGCGATATATTATGGTTGAGGAA,
The Mseed-1456 downstream primer is CTT GAATTCACTAGT CTAGGAGGTCTTTAACTCCTTCTTTAGTTCC;
an Mseed _2001 upstream primer CGC CATATG GAATTTGAAACAATAGAAACTAAAAAAGAA,
mseed _2001 downstream primer CTT GAATTCACTAGT CTATTTTCCCTTAAACGTAGGCTCTCTCT;
mseed _1993 upstream primer CGC CATATG ACTGAAAAGGTATCTGT,
mseed _1993 downstream primers CCC AAGCTT TTATTTTTCCCAAACTAGTT;
an Mseed _1426 upstream primer CGC CATATG AAAGCTGTCGTAGTGAA,
the Mseed _1426 downstream primer is CTT GAATTCACTAGT TTACGTGGTAAGGAGTACTT.
each gene fragment obtained by amplification was cloned on pET28a by restriction endonuclease.
The Mseed _1456 gene fragment on the plasmid pYW2 is cut by XbaI and XhoI enzyme and then is connected to the rear end of the Mseed _0709 gene on pYW1, so that a plasmid pYW6 for simultaneously expressing the Mseed _0709 and the Mseed _1456 genes is obtained, and the schematic diagram is shown in the attached figure 6.
The Mseed _2001 gene fragment on the plasmid pYW3 is digested by XbaI and XhoI, and then ligated to the rear end of the Mseed _1456 gene on pYW6, and a plasmid pYW7 expressing the Mseed _0709, Mseed _1456 and Mseed _2001 genes is shown in the schematic diagram of FIG. 7.
EXAMPLE 1 Escherichia coli for production of 3-hydroxypropionic acid
The Mseed _1993 gene fragment on the plasmid pYW4 is cut by XbaI and HindIII and then is connected to the rear end of the Mseed _0709 gene on pYW1 to construct a plasmid which expresses two genes of Mseed _0709 and Mseed _1993 and is named as pZL31, and the plasmid is shown in an attached figure 8.
Plasmid pMSD8 constructed by the subject group of the teaching of John Cronan may overexpress Acetyl-CoA Carboxylase ACC in E.coli (Davis M S, solubility J, Cronan J E. over-expression of Acetyl-CoA Carboxylase Activity activities the Rate of fat Acid Biosynthesis in Escherichia coli. journal of Biological Chemistry 2000,275(37): 28593. 28598.). In this example, the plasmid was used to increase the amount of malonyl-coa.
pMSD8 and pZL31 are co-transformed into escherichia coli BL21(DE3), transformants which are successfully screened by kanamycin and carbenicillin are selected, monocloned in 5mL M9 minimal medium at 37 ℃ and 200rpm for 12h, 2mL of bacterial liquid is transferred into 200mL M9 minimal medium at 37 ℃ and 200rpm for culture, and when OD600 reaches about 0.6, 0.1mM of IPTG is added for induction expression.
the qualitative analysis experiment was as follows:
after 24h of induction expression, 200mL of fermentation liquor is taken for 3-hydroxypropionic acid extraction.
The extraction method comprises the following steps: adding 200mL of chloroform into 200mL of fermentation liquor, performing rotary extraction for 10min, standing for layering, transferring the lower organic layer into a 500mL round-bottom flask, and performing rotary evaporation. After the organic layer was spin-dried, it was dissolved in 1mL of chloroform and transferred to a sample bottle.
The treated sample was detected by gas chromatography-mass spectrometry (Agilent 7890-: maintaining at 50 deg.C for 2min, heating to 240 deg.C at 10 deg.C/min, and maintaining at 240 deg.C for 9 min.
The quantitative analysis experiment was as follows:
after IPTG induction expression was added, the fermentation broth was taken out every 2 hours and the yield of 3-hydroxypropionic acid was quantified by HPLC (Agilent 1260). The HPLC conditions were as follows, the detector was a DAD detector, the column was an ODS column, the mobile phase was a 0.1% H 3 PO 4 aqueous solution, methanol (in terms of volume ratio) 97:3, and the column temperature was 30 ℃.
Qualitative and quantitative analysis of the experimental results: the results of the gas chromatography-mass spectrometer (see figure 15) show that the 3-hydroxypropionic acid is produced by the escherichia coli when the plasmids pZL31 and pMSD8 are co-expressed; the amount of 3-hydroxypropionic acid produced was 3.93. + -. 0.12g/L as determined by HPLC quantitative analysis.
the results of this example demonstrate that expression of Msed _0709Msed _1993 and the genes malonyl-CoA reductase and malonate semialdehyde reductase in prokaryotic microorganisms can fix carbon dioxide production to 3-hydroxypropionic acid.
EXAMPLE 2 Escherichia coli for acrylic acid production
The Mseed _1993 gene fragment on the plasmid pYW4 is cut by XbaI and HindIII and then is connected to the rear end of the Mseed _2001 gene on pYW7 to construct a plasmid which simultaneously expresses four genes of Mseed _0709, Mseed _1456, Mseed _2001 and Mseed _1993 and is named as pZL32, as shown in figure 9.
Plasmid pMSD8 constructed by the subject group of the teaching of John Cronan may be used to overexpress Acetyl-CoA carboxylase ACC in E.coli (Davis M S, solubility J, Cronan J E. over-expression of Acetyl-Coarbor Activity activities of the Rate of Fatty Acid Biosynthesis in Escherichia coli. journal of Biological Chemistry 2000,275(37):28593-28598.) in this example, this plasmid is used to increase the amount of malonyl-CoA.
pMSD8 and pZL32 are co-transformed into escherichia coli BL21(DE3), transformants which are successfully screened by kanamycin and carbenicillin are selected, monocloned in 5mL M9 minimal medium at 37 ℃ and 200rpm for 12h, 2mL of bacterial liquid is transferred into 200mL M9 minimal medium at 37 ℃ and 200rpm for culture, and when OD600 reaches about 0.6, 0.1mM of IPTG is added for induction expression.
the qualitative analysis experiment was as follows:
After 24h of induction expression, 200mL of fermentation liquor is taken for acrylic acid extraction.
The extraction method comprises the following steps: adding 200mL of chloroform into 200mL of fermentation liquor, performing rotary extraction for 10min, standing for layering, transferring the lower organic layer into a 500mL round-bottom flask, and performing rotary evaporation. After the organic layer was spin-dried, it was dissolved in 1mL of chloroform and transferred to a sample bottle.
The treated sample was detected by gas chromatography-mass spectrometry (Agilent 7890-: maintaining at 50 deg.C for 2min, heating to 240 deg.C at 10 deg.C/min, and maintaining at 240 deg.C for 9 min.
The quantitative analysis experiment was as follows:
After IPTG induction expression was added, the fermentation broth was taken out every 2 hours and the yield of acrylic acid was quantified by HPLC (Agilent 1260). The HPLC conditions were as follows, detector DAD detector, chromatographic column ODS column, mobile phase 0.1% H 3 PO 4 aqueous solution: methanol (vol.) -97: 3, column temperature: 30 ℃.
Qualitative and quantitative analysis of the experimental results: the results of the gas chromatograph-mass spectrometer (see figure 16) show that the colibacillus generates acrylic acid by co-expressing pZL32 and pMSD8 plasmids; the amount of acrylic acid produced was 4.02. + -. 0.17mg/L as determined by HPLC quantitative analysis.
The results of this example demonstrate that expression of the Mseed _0709, Mseed _1456, Mseed _2001, and Mseed _1993 genes, i.e., malonyl-CoA reductase, 3-hydroxypropionyl-CoA synthetase, 3-hydroxypropionyl-CoA dehydratase, and malonate semialdehyde reductase, in prokaryotic microorganisms can fix carbon dioxide production to acrylic acid.
EXAMPLE 3 Escherichia coli for propionic acid production
The Mseed _1426 gene fragment on the plasmid pYW5 is cut by XbaI and XhoI and then is connected to the rear end of the Mseed _2001 gene on pYW7, and a plasmid which simultaneously expresses four genes of Mseed _0709, Mseed _1456, Mseed _2001 and Mseed _1426 is constructed and named as pZL33, and is shown in an attached figure 10.
The Mseed _1993 gene fragment on the plasmid pYW4 is cut by XbaI and HindIII and then is connected to the rear end of the Mseed _1426 gene on pZL33 to construct a plasmid which simultaneously expresses Mseed _0709, Mseed _1456, Mseed _2001, Mseed _1426 and Mseed _1993 five genes and is named as pZL34, and the plasmid is shown in an attached figure 11.
Plasmid pMSD8 constructed by the subject group of the teaching of John Cronan may be used to overexpress Acetyl-CoA carboxylase ACC in E.coli (Davis M S, solubility J, Cronan J E. over-expression of Acetyl-Coarbor Activity activities of the Rate of Fatty Acid Biosynthesis in Escherichia coli. journal of Biological Chemistry 2000,275(37):28593-28598.) in this example, this plasmid is used to increase the amount of malonyl-CoA.
pMSD8 and pZL34 are co-transformed into escherichia coli BL21(DE3), transformants which are successfully screened by kanamycin and carbenicillin are selected, monocloned in 5mL M9 minimal medium at 37 ℃ and 200rpm for 12h, 2mL of bacterial liquid is transferred into 200mL M9 minimal medium at 37 ℃ and 200rpm for culture, and when OD600 reaches about 0.6, 0.1mM of IPTG is added for induction expression.
The qualitative analysis experiment was as follows:
After 24h of induction expression, 200mL of fermentation liquor is taken for propionic acid extraction.
The extraction method comprises the following steps: adding 200mL of chloroform into 200mL of fermentation liquor, performing rotary extraction for 10min, standing for layering, transferring the lower organic layer into a 500mL round-bottom flask, and performing rotary evaporation. After the organic layer was spin-dried, it was dissolved in 1mL of chloroform and transferred to a sample bottle.
The treated sample was detected by gas chromatography-mass spectrometry (Agilent 7890-: maintaining at 50 deg.C for 2min, heating to 240 deg.C at 10 deg.C/min, and maintaining at 240 deg.C for 9 min.
The quantitative analysis experiment was as follows:
After IPTG induction expression was added, the fermentation broth was taken out every 2 hours and the propionic acid yield was quantified by HPLC (Agilent 1260). The HPLC conditions were as follows, detector DAD detector, chromatographic column ODS column, mobile phase 0.1% H 3 PO 4 aqueous solution: methanol (vol.) -97: 3, column temperature: 30 ℃.
Qualitative and quantitative analysis of the experimental results: the results of the gas chromatography-mass spectrometer (see figure 17) show that the colibacillus generates propionic acid by co-expressing pZL34 and pMSD8 plasmids; the amount of propionic acid produced was 186.03. + -. 0.63mg/L by quantitative HPLC analysis.
The results of this example demonstrate that expressing the Mseed _0709, Mseed _1456, Mseed _2001, Mseed _1426, and Mseed _1993 genes in prokaryotic microorganisms, i.e., malonyl-CoA reductase, 3-hydroxypropionyl-CoA synthetase, 3-hydroxypropionyl-CoA dehydratase, acrylyl-CoA reductase, and malonate semialdehyde reductase, can immobilize carbon dioxide to produce propionic acid.
EXAMPLE 4 Saccharomyces cerevisiae producing 3-hydroxypropionic acid
Inducible promoters GAL1 and GAL10 on a saccharomyces cerevisiae double-gene co-expression vector pESC-URA are respectively replaced by a grouped promoter TEF1 and HXT7 to obtain a plasmid pDG001, and a schematic diagram of the plasmid pDG001 is shown in an attached figure 12. The specific construction process is as follows:
The promoter TEF1 and HXT7 fragments were PCR amplified using the genome of Saccharomyces cerevisiae as template by using the following primers:
HXT7 upstream primer: TATGGCCGGCCCCGTGGAAATGAGGGGTATGC the flow of the air in the air conditioner,
HXT7 downstream primer: GCGGCGGCCGCTTTTTGATTAAAATTAAAAAAACTTTTTGTTTTTG, respectively;
TEF1 upstream primer: TCCACGGGGCCGGCCATAGCACACACCATAGCTTCAAAATGTTTC the flow of the air in the air conditioner,
TEF1 downstream primer: CGGATCCTTGTAATTAAAACTTAGATTAGATTGC are provided.
And then, using two PCR fragments as templates, amplifying by using a downstream primer HXT7 and a downstream primer TEF1 to obtain a fragment simultaneously containing promoters TEF1 and HXT7, cutting the obtained PCR fragment by BamHI and NotI enzyme, and connecting the PCR fragment to a pESC-URA plasmid to obtain a plasmid pDG 001.
Each gene fragment was PCR amplified using the genome of metalosphaera sedula as template, with the restriction sites underlined:
Mseed _0709 upstream primer' ATAAGAAT GCGGCCGC ATGAGGAGAACGCTAAAGGCCG,
The Mseed _0709 downstream primer' is GA AGATCT TCATCTCTTGTCTATGTAGCCCTTCTCC;
Mseed _1993 upstream primer' CG GGATCC ATGACTGAAAAGGTATCTGT,
Mseed _1993 downstream primer' CCC AAGCTT TTATTTTTCCCAAACTAGTT.
the Mseed-1993 gene was cloned into pDG001 with BamHI and HindIII to obtain plasmid pZL35, which is schematically shown in FIG. 13.
Then, the Mseed _0709 gene is constructed by cloning in pZL35 through NotI and BglII, and a saccharomyces cerevisiae constitutive plasmid which simultaneously expresses the Mseed _1993 and Mseed _0709 genes is obtained and is named as pZL36, and is shown in an attached figure 14.
The selected saccharomyces cerevisiae CEN.PK2-1C is uracil-deficient, and the pZL36 plasmid carries uracil expression genes, and the constructed plasmid pZL36 is transformed into the saccharomyces cerevisiae to be screened by using an SC-ura culture medium.
After selecting a single clone and culturing the single clone in 5mL of SC minimal medium at 30 ℃ and 200rpm for 12 hours, 2mL of bacterial liquid is inoculated into 200mL of SC minimal medium at 30 ℃ and 200rpm for culture.
The qualitative analysis experiment was as follows:
After 24h of culture, 200mL of fermentation broth was taken for 3-hydroxypropionic acid extraction.
the extraction method comprises the following steps: adding 200mL of chloroform into 200mL of fermentation liquor, performing rotary extraction for 10min, standing for layering, transferring the lower organic layer into a 500mL round-bottom flask, and performing rotary evaporation. After the organic layer was spin-dried, it was dissolved in 1mL of chloroform and transferred to a sample bottle.
The treated sample was detected by gas chromatography-mass spectrometry (Agilent 7890-: maintaining at 50 deg.C for 2min, heating to 240 deg.C at 10 deg.C/min, and maintaining at 240 deg.C for 9 min.
The quantitative analysis experiment was as follows:
After inoculation, the fermentation broth was removed every 2H and the yield of 3-hydroxypropionic acid was quantified by HPLC (Agilent 1260) under the following HPLC conditions, DAD detector, ODS column, mobile phase, 0.1% aqueous H 3 PO 4 solution in methanol (vol.) -97: 3, column temperature: 30 ℃.
Qualitative and quantitative analysis of the experimental results: the results of the gas chromatography-mass spectrometer (see figure 18) show that the 3-hydroxypropionic acid is produced by the saccharomyces cerevisiae when the pZL36 plasmid is expressed; as a result of quantitative analysis by HPLC, the amount of produced 3-hydroxypropionic acid was 1.535. + -. 0.138 g/L.
The results of this example demonstrate that expression of Msed _0709Msed _1993 and the genes, malonyl-CoA reductase and malonate semialdehyde reductase, in eukaryotic microorganisms can fix carbon dioxide production to 3-hydroxypropionic acid. The results also show that acrylic acid and propionic acid can be produced by eukaryotic microorganisms according to the above method.
the above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Claims (1)
1. A propionic acid-producing microorganism characterized in that: the microorganism is Escherichia coli BL21 containing plasmid pZL34, and the plasmid pZL34 is prepared by a method comprising the following steps:
Mseed _0709, a DNA fragment of Metallophaera sedula was amplified by PCR using the following primers,
mseed _1456, Mseed _2001, Mseed _1993, Mseed _1426 gene fragments, underlined are restriction sites:
An Mseed _0709 upstream primer GGA CATATG AGGAGAACGCTAAAGGCCG,
The Mseed _0709 downstream primer is CTT GAATTCACTAGT TCATCTCTTGTCTATGTAGCCCTTCTCC;
An Mseed-1456 upstream primer GGT CATATG TTTATGCGATATATTATGGTTGAGGAA,
The Mseed-1456 downstream primer is CTT GAATTCACTAGT CTAGGAGGTCTTTAACTCCTTCTTTAGTTCC;
An Mseed _2001 upstream primer CGC CATATG GAATTTGAAACAATAGAAACTAAAAAAGAA,
mseed _2001 downstream primer CTT GAATTCACTAGT CTATTTTCCCTTAAACGTAGGCTCTCTCT;
Mseed _1993 upstream primer CGC CATATG ACTGAAAAGGTATCTGT,
mseed _1993 downstream primers CCC AAGCTT TTATTTTTCCCAAACTAGTT;
an Mseed _1426 upstream primer CGC CATATG AAAGCTGTCGTAGTGAA,
Mseed _1426 downstream primer CTT GAATTCACTAGT TTACGTGGTAAGGAGTACTT;
Cloning each amplified gene fragment on pET28a by restriction endonuclease to obtain plasmids pYW1, pYW2, pYW3, pYW4 and pYW 5;
digesting the Mseed _1456 gene fragment on the plasmid pYW2 by XbaI and XhoI, and then connecting the digested Mseed _1456 gene fragment to the rear end of the Mseed _0709 gene pYW1 to obtain a plasmid pYW6 for simultaneously expressing the Mseed _0709 gene and the Mseed _1456 gene;
digesting the Mseed _2001 gene fragment on the plasmid pYW3 by XbaI and XhoI, and then connecting the digested Mseed _2001 gene fragment to the rear end of the Mseed _1456 gene on pYW6 to obtain a plasmid pYW7 for simultaneously expressing the Mseed _0709, the Mseed _1456 and the Mseed _2001 gene;
the Mseed _1426 gene fragment on the plasmid pYW5 is cut down by XbaI and XhoI enzyme and then is connected to the rear end of the Mseed _2001 gene on pYW7, so that a plasmid pZL33 capable of simultaneously expressing four genes of Mseed _0709, Mseed _1456, Mseed _2001 and Mseed _1426 is obtained;
the Mseed _1993 gene fragment on the plasmid pYW4 is cut down by XbaI and HindIII and then is connected to the rear end of the Mseed _1426 gene on pZL33 to obtain a plasmid pZL34 which simultaneously expresses five genes of Mseed _0709, Mseed _1456, Mseed _2001, Mseed _1426 and Mseed _ 1993;
The amino acid sequence of the protein coded by the Mseed _0709 gene is shown as SEQ ID No.1, the amino acid sequence of the protein coded by the Mseed _1993 gene is shown as SEQ ID No.2, the amino acid sequence of the protein coded by the Mseed _1456 gene is shown as SEQ ID No.3, the amino acid sequence of the protein coded by the Mseed _2001 gene is shown as SEQ ID No.4, and the amino acid sequence of the protein coded by the Mseed _1426 gene is shown as SEQ ID No. 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610227348.3A CN105802984B (en) | 2014-01-24 | 2014-01-24 | Method for producing propionic acid by microorganisms |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410035584.6A CN103805641B (en) | 2014-01-24 | 2014-01-24 | A kind of method that stabilizing carbon dioxide is produced 3-hydracrylic acid, acrylic acid and propionic acid in microbial body |
| CN201610227348.3A CN105802984B (en) | 2014-01-24 | 2014-01-24 | Method for producing propionic acid by microorganisms |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410035584.6A Division CN103805641B (en) | 2014-01-24 | 2014-01-24 | A kind of method that stabilizing carbon dioxide is produced 3-hydracrylic acid, acrylic acid and propionic acid in microbial body |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802984A CN105802984A (en) | 2016-07-27 |
| CN105802984B true CN105802984B (en) | 2019-12-10 |
Family
ID=50703026
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410035584.6A Active CN103805641B (en) | 2014-01-24 | 2014-01-24 | A kind of method that stabilizing carbon dioxide is produced 3-hydracrylic acid, acrylic acid and propionic acid in microbial body |
| CN201610227348.3A Active CN105802984B (en) | 2014-01-24 | 2014-01-24 | Method for producing propionic acid by microorganisms |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410035584.6A Active CN103805641B (en) | 2014-01-24 | 2014-01-24 | A kind of method that stabilizing carbon dioxide is produced 3-hydracrylic acid, acrylic acid and propionic acid in microbial body |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN103805641B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789516B (en) * | 2015-04-22 | 2017-12-22 | 天津大学 | A kind of genetic engineering bacterium of cytoalgae 6803 for producing trihydroxy propionic acid and construction method and application |
| CN115948264A (en) * | 2022-01-29 | 2023-04-11 | 北京化工大学 | Genetically engineered bacterium for producing 3-hydroxypropionic acid and application thereof |
| CN116478893B (en) * | 2023-03-02 | 2024-05-10 | 天津大学 | Construction and application of engineering probiotics for producing propionic acid |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1343874B1 (en) * | 2000-11-20 | 2012-10-03 | Cargill, Incorporated | Cells comprising lactyl-coa dehydratase, 3-hydroxypropionyl-coa dehydratase or a multienzyme complex isolated from megasphaera elsdenii and chloroflexus aurantiacus for the production of 3-hydroxypropionic acid |
| CN102695799A (en) * | 2009-09-27 | 2012-09-26 | Opx生物工艺学公司 | Method for producing 3-hydroxypropionic acid and other products |
-
2014
- 2014-01-24 CN CN201410035584.6A patent/CN103805641B/en active Active
- 2014-01-24 CN CN201610227348.3A patent/CN105802984B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| "ACCESSION NO.CP000682，Metallosphaera sedula DSM 5348,Complete genome";Copeland A et al;《GenBank》;20070428;全文 * |
| Construction of a Part of a 3-Hydroxypropionate Cycle for Heterologous Polyketide Biosynthesis in Escherichia coli;Satoshi Yuzawa et al;《BioChemistry》;20121126;第51卷(第49期);第9779-9781页 * |
| Construction of a Part of a 3-Hydroxypropionate Cycle for Heterologous Polyketide Biosynthesis in Escherichia coli;Satoshi Yuzawa et al;《BioChemistry》;20121126;第51卷(第49期);第9779页 摘要，右栏第2段-第9781页 右栏第1段，图1-图3 * |
| Overproduction of acetyl-CoA carboxylase activity increases the rate of fatty acid biosynthesis in Escherichia coli.;Mark S.Davis et al;《The Journal of Biological Chemistry》;20000915;第275卷(第37期);第28593-28598页 摘要，实验步骤，结果和讨论 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103805641A (en) | 2014-05-21 |
| CN103805641B (en) | 2016-05-11 |
| CN105802984A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104312987B (en) | A kind of method of biosynthesis glucuronic acid and glucaric acid | |
| CA2429039A1 (en) | 3-hydroxypropionic acid and other organic compounds | |
| CN104312935B (en) | A kind of method for building recombination yeast fermenting and producing glucaric acid | |
| WO2018069418A2 (en) | Production of citronellal and citronellol in recombinant hosts | |
| CN110438056A (en) | The building and application of the colibacillus engineering of one plant of production n-butyric acie | |
| Wang et al. | Metabolic engineering of Yarrowia lipolytica for the biosynthesis of crotonic acid | |
| US20080182307A1 (en) | Method for preparing para-hydroxystyrene by biocatalytic decarboxylation of para-hydroxycinnamic acid in a biphasic reaction medium | |
| CN105802984B (en) | Method for producing propionic acid by microorganisms | |
| CN107384847B (en) | Recombinant bacterium for producing ethylene glycol by efficiently converting xylose and application thereof | |
| JP2007525942A (en) | Process for the production of para-hydroxystyrene by biocatalytic decarboxylation of para-hydroxycinnamic acid in a two-phase reaction medium | |
| WO2019008131A1 (en) | Recombinant pseudomonas putida for the production of d-xylonate from d-xylose | |
| CN107400652A (en) | A kind of engineering bacteria construction method of the hydracrylic acid of dynamic regulation 3 synthesis | |
| Wetzel et al. | Fed-batch production and secretion of streptavidin by Hansenula polymorpha: evaluation of genetic factors and bioprocess development | |
| CN108913724A (en) | It is a kind of using malonate as the preparation method of Material synthesis 3- hydracrylic acid and its corresponding recombinant cell and application | |
| CA3172057A1 (en) | Production of ethanol with one or more co-products in yeast | |
| CN116096857A (en) | Biosynthesis of commodity chemicals from oil palm empty fruit cluster lignin | |
| CN102827880B (en) | Method for biologically synthesizing fatty alcohol from fatty acyl ACP (acyl carrier protein) reductase | |
| CN103937841A (en) | Application of enoyl coenzyme A hydratase in adipic acid biosynthesis | |
| US20220127648A1 (en) | Genetically engineered yeast yarrowia lipolytica and methods for producing bio-based glycolic acid | |
| JP6622564B2 (en) | Method for producing 1,4-butanediol | |
| CN108004275A (en) | A kind of Escherichia coli recombinant strain for producing adipic acid and its application | |
| CN105624179A (en) | System for producing aliphatic-terminated alkene and application thereof | |
| Jeong et al. | Influence of Vitreoscilla hemoglobin gene expression on 2, 3-butanediol production in Klebsiella oxytoca | |
| CN114276970B (en) | Genetically engineered bacterium for producing 1, 3-propylene glycol | |
| CN104531786A (en) | Method for synthesizing poly 3-hydroxypropionic acid by using acetyl coenzyme A |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |