CN115927687A - CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for Klebsiella pneumoniae and application thereof - Google Patents

Abstract

The invention relates to a CRISPR detection primer group for Klebsiella pneumoniae and application thereof, and relates to the technical field of gene detection based on CRISPR technology. The CRISPR detection primer group for Klebsiella pneumoniae comprises an amplification primer pair and crRNA; the amplification primer pair is used for amplifying the conserved sequence of the Klebsiella pneumoniae; crRNA includes an anchor sequence that binds cas protein and a guide sequence that matches the target DNA segment in the conserved sequence. By adopting the primer group, klebsiella pneumoniae can be rapidly detected on site by a gene detection technology based on CRISPR technology, and the primer group has the advantages of high specificity, high sensitivity and simple operation.

Description

CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for Klebsiella pneumoniae and application thereof

Technical Field

The invention relates to the technical field of gene detection based on a CRISPR technology, in particular to a CRISPR detection primer group for Klebsiella pneumoniae and application thereof.

Background

Klebsiella pneumoniae is gram-negative bacillus, and exudate in pathological changes is sticky and heavy, so that leaf gaps drop. The bacteria have a capsule that, when grown and propagated within the alveoli, causes tissue necrosis, liquefaction, and the formation of single or multiple abscesses. When the pleural and pericardial diseases are involved, exudative or purulent fluid accumulation may occur. The fibrous tissue of the focus is proliferated actively and is easy to organize; cellulosic pleural effusions can develop adhesions early. In hospital-infected septicemia, klebsiella, pseudomonas aeruginosa, serratia and the like are all important pathogenic bacteria, and the fatality rate is high.

At present, the diagnosis of klebsiella pneumoniae mainly depends on the detection of pathogens, and the common methods comprise smear staining microscopy, separation culture, immunological diagnosis, molecular biological diagnosis and the like. Among them, the isolation culture method is a gold standard, but the culture takes 4 to 8 weeks, which delays clinical diagnosis and treatment. The smear staining microscopy method is simple and rapid to operate, but the method has low sensitivity and poor specificity. The immunological diagnosis is caused by the fact that the existing antigen or antibody is crossed with other microorganisms, so that the specificity is poor, and the false positive rate is high. The molecular biology diagnosis is rapid and sensitive, and the specific DNA fragment can be used for distinguishing the strains in the Klebsiella pneumoniae bacteria. In recent years, various isothermal amplification techniques such as LAMP and RPA have appeared and are applicable to in-situ detection, but all of them have problems such as lack of effective means for detecting amplified products. Therefore, it is highly desirable to establish a detection technique that is simple, fast, and highly sensitive and applicable to the field.

Disclosure of Invention

Aiming at the problems, the invention provides a CRISPR detection primer group for Klebsiella pneumoniae, which can be used for rapidly detecting Klebsiella pneumoniae on site by a gene detection technology based on a CRISPR technology and has the advantages of high specificity, high sensitivity and simple operation.

The invention provides a CRISPR detection primer group for Klebsiella pneumoniae, which comprises an amplification primer pair and crRNA; the amplification primer pair is used for amplifying a conserved sequence of Klebsiella pneumoniae; the crRNA includes an anchor sequence that binds to cas protein and a guide sequence that matches a target DNA fragment in the conserved sequence.

The invention designs a crRNA sequence aiming at a conserved sequence of Klebsiella pneumoniae, detects by using CRISPR technology, in a CRISPR Cas system, cas protein under the guide of guide RNA recognizes a target sequence and then starts 'additional cutting' activity, simultaneously, a fluorescence reporter molecule is added into the system, the transformation of sequence information to be detected to a fluorescence signal is realized by using the additional cutting activity of Cas enzyme, and two-stage amplification of 'sequence amplification' (RPA completion) and 'enzymatic cascade' (Cas enzyme completion) can be realized by coupling RPA and Cas protein, so that the sensitivity of single-stage amplification of Q-PCR is surpassed. In addition, the RPA amplification mode does not need complex temperature change, so that the dependence on precision instruments such as a QPCR instrument is eliminated, and the CRISPR-Cas technology has wide application prospect in the field detection of Klebsiella pneumoniae.

In one embodiment, the conserved sequence is as set forth in SEQ ID NO:1 is shown.

Through a large number of screening and comparison tests, the inventor finds that the nucleotide sequence shown in SEQ ID NO: the conserved sequence shown in 1 can be specifically used for detecting Klebsiella pneumoniae and can realize high-efficiency detection of CRISPR technology.

In one embodiment, the crRNA sequence is selected from: SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

in one embodiment, the forward amplification primer of the amplification primer pair is selected from the group consisting of: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8;

the reverse amplification primer in the amplification primer pair is selected from the group consisting of: SEQ ID NO:9,SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

in one embodiment, the crRNA sequence is as set forth in SEQ ID NO:3, respectively.

Selecting the polypeptide as shown in SEQ ID NO:3 is a crRNA sequence, wherein the guide sequence (namely the detected target sequence) has better detection effect.

In one embodiment, the forward amplification primer is set forth in SEQ ID NO:7, the reverse amplification primer is shown as SEQ ID NO: shown at 9.

After a great deal of experimental research, the inventor finds that RPA amplification carried out by the amplification primer pair has better amplification efficiency and sensitivity when being matched with the crRNA.

The invention also provides application of the CRISPR detection primer group for Klebsiella pneumoniae in developing and/or preparing products with pneumonia diagnosis and/or prognosis evaluation purposes.

The product can be a kit or an integrated detection device.

The invention also provides a kit for detecting Klebsiella pneumoniae, which comprises the primer group for detecting the CRISPR of the Klebsiella pneumoniae.

In one embodiment, the method further comprises the following steps: cas12a protein and a signaling reporter probe.

In one embodiment, the cas12a protein is an Lbcas12a protein.

Compared with the prior art, the invention has the following beneficial effects:

the CRISPR detection primer group for Klebsiella pneumoniae is designed aiming at a conserved sequence of Klebsiella pneumoniae, and is detected by using a CRISPR technology, in a CRISPR Cas system, cas protein is guided by guide RNA, and after a target sequence is recognized, the 'incidental cleavage' activity is started, meanwhile, a fluorescent reporter molecule is added into the system, and the transformation of sequence information to be detected to a fluorescent signal is realized by virtue of the incidental cleavage activity of the Cas enzyme, and through the coupling of RPA and the Cas protein, the two-stage amplification of 'sequence amplification' (RPA completion) and 'enzymatic cascade' (Cas enzyme completion) can be realized, so that the sensitivity of single-stage amplification of Q-PCR is surpassed. In addition, the RPA amplification mode does not need complex temperature change, so that the dependence on precision instruments such as a QPCR instrument is eliminated, and the CRISPR-Cas technology has wide application prospect in the field diagnosis of Klebsiella pneumoniae.

Moreover, the inventor finally obtains a primer group which has high amplification efficiency, good sensitivity and strong specificity and can be applied to clinic by selecting a target sequence and designing and screening an amplification primer and crRNA (ribonucleic acid).

Drawings

FIG. 1 is a graph showing the results of the specificity screening in example 1;

FIG. 2 is a graph showing the results of the orthogonal amplification efficiency screening in example 1;

FIG. 3 is a graph showing the results of the sensitivity measurement in example 2;

FIG. 4 is a graph showing the results of the specificity detection in example 3.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Reagents, materials and equipment used in the embodiment are all commercially available sources unless otherwise specified; unless otherwise specified, all the experimental methods are routine in the field.

Example 1

Designing and screening CRISPR detection primer sequences of Klebsiella pneumoniae.

1. A target sequence is selected.

Based on earlier research, the inventor selects the nucleotide sequence shown as SEQ ID NO:1 as a target sequence, and can detect the Klebsiella pneumoniae. SEQ ID NO:1 sequence is shown below:

CGTGGCGTATTACGTTGAAGCCTCAACCCTGACCGAAGCGCAGTGGGCCGCGGTGGCG

GCGGAGCTGCACGACCGCATGATGGAGAGCGTCTTCGACGAGCTGGAAGCGGGCGAGA

AGCTGTTCGCTCACCATCAGCCGACGCCGGTCACCAGCGTCGACCTGCTGGGCGAAGG

GCGTCAGGCGCTGATTGACGCCAACCTCCGTCTGGGTCTGGCGCTGGCCGACGACGAA

ATTGACTACCTGCAGGACGCGTTTACCCGCCTGGGACGCAACCCGAACGATATCGAGCT

GTATATGTTCGCCCAGGCGAACTCAGAGCACTGTCGCCACAAGATTTTCAACGCCGACT

GGATCATCGACGGCGAACAGCAGCCGAAGTCGCTGTTCAAAATGATCAAAAACACCTTT

GAAAAAACGCCGGACTACGTGCTGTCGGCCTATAAAGATAATGCCGCGGTGATGGAAGG

GTCTGAAGTCGGGCGCTATTTCGCCGACCATCAGACCGGGCGCTACGACTTCCATCAGG

AGCCGGCGCACATTCTGATGAAGGTGGAAACCCATAACCACCCGACGGCCATCTCTCCA

TGGCCGGGCGCGGCAACCGGCTCCGGCGGCGAAATCCGCGATGAAGGCGCCACCGGCC

GCGGCGCGAAGCCGAAAGCGGGCCTGGTGGGCTTCTCGGTTTCCAACCTGCGTATCCCG

GGCTTCGAACAGCCGTGGGAAGAAGATTTCGGTAAACCGGATCGCATTGTCACCGCCCT

GGACATCATGACCGAAGGCCCGCTGGGCGGCGCGGCGTTTAACAACGAATTTGGTCGTCCGGCGCTGAACGGCTACTT。

2. RPA amplification primers and crRNA sequences were designed.

Multiple crRNA and RPA amplification primer pairs were designed for the conserved sequences described above, and the following table lists some exemplary primer sequences.

TABLE 1crRNA and amplification primer pairs

Note: the sequences of the crRNA-1, the crRNA-2 and the crRNA-3 are RNA sequences, wherein T is represented by letter specification in a WIPO Sequence list and is uracil U.

3. And (4) screening sequences.

1. The 3 crRNAs were specifically screened.

Specific operation of the specificity screening: a plasmid containing the target sequence of SEQ ID NO. 1 (which was synthesized by general biosystems (Anhui) Co., ltd.) was synthesized, and the plasmid was diluted to a concentration of 100pg/ul, and 4ul (1 uM) of crRNA-1, crRNA-2, crRNA-3 and negative control ddH were taken, respectively ₂ 0, adding crRNA specific screening reaction system species, wherein the reaction system solution comprises the following reagents: 18ul of peg in water (8%), 2ul of plasmid (100 pg/ul), 2ul of signaling reporter probe (10 uM), 4ul of Lbcas12a protein (2 uM).

The results of the specific screening are shown in FIG. 1, and the crRNA-2 has the best specific recognition ability for the target sequence.

2. And (3) carrying out orthogonal amplification efficiency screening on the 4 forward amplification primers and the 4 reverse amplification primers.

Specific operation of orthogonal amplification efficiency screening: diluting plasmids to the concentration of 10ag/ul, diluting 4 forward amplification primers and 4 reverse amplification primers to the concentration of 10uM, pairing 1ul of forward amplification primers and 1ul of reverse amplification primers in pairs to form 16 pairs of primer pairs, respectively adding 2ul of primer pairs into an amplification detection system, wherein the solution of the amplification detection system is as follows: 2ul plasmid (10 ag/ul), 2ul signal reporter probe (10 uM), 4ul crRNA-1 (1 uM), RPA enzyme premix 14.5ul,1.5ul mgAc (280 mM), 4ul LbCas12a protein (2 uM).

The results of the orthogonal amplification efficiency screening are shown in FIG. 2, and show that the amplification efficiency of prime-F3/R1 is the best when crRNA-2 is used as the amplification primer.

That is, in the CRISPR detection primer set for klebsiella pneumoniae in this example, the selected crRNA sequence is crRNA-2:5'-UAAUUUCUACUAAGUGUAGAUAUGGCCAGCGCCAGACCCAGACGGAGG UUGGC-3' (SEQ ID NO: 3);

the forward amplification primers selected were Prime-F3:5'-GAGCTGGAAGCGGGCGAGAAGCTGTTCGCTCACC-3' (SEQ ID NO: 7);

the reverse amplification primers selected were Prime-R1:5'-CCCAGGCGGGTAAACGCGTCCTGCAGGTAGT-3' (SEQ ID NO: 9).

Example 2

And (4) detecting the sensitivity.

The plasmids in example 1 were diluted with enzyme-free water to various concentrations and the sequence of crRNA-2 (SEQ ID NO: 3), prime-F3 (SEQ ID NO: 7) and Prime-R1 (SEQ ID NO: 9) in example 1 were selected for detection.

As shown in FIG. 3, the CRISPR detection primer set of the embodiment 1 can detect 500copies/mL Klebsiella pneumoniae at the lowest.

Example 3

And (4) detecting the specificity.

The CRISPR detection primer group (crRNA-2 sequence + Prime-F3+ Prime-R1) in the embodiment 1 is adopted to respectively perform RPA amplification on common pathogenic bacteria such as Klebsiella pneumoniae, mycobacterium tuberculosis, staphylococcus aureus, shigella, salmonella, mycoplasma pneumoniae, staphylococcus epidermidis, streptococcus pyogenes, candida albicans, acinetobacter baumannii, streptococcus pneumoniae and the like, and the streptococcus pneumoniae is used as a negative control to detect the specificity of the method.

The result is shown in fig. 4, the method only amplifies the klebsiella pneumoniae sample, and does not amplify other klebsiella pneumoniae, which shows that the CRISPR detection primer group in the example 1 has good specificity.

Example 4

A kit for rapidly detecting klebsiella pneumoniae.

The kit comprises CRISPR detection primer groups (crRNA-2, prime-F3 and Prime-R1) for Klebsiella pneumoniae, RPA enzyme premix, a signal report probe, lbcas12a protein, magnesium acetate, tris-HCl and DTT, which are obtained in example 1.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Claims (10)

1. A CRISPR detection primer group for Klebsiella pneumoniae is characterized by comprising an amplification primer pair and crRNA; the amplification primer pair is used for amplifying a conserved sequence of the klebsiella pneumoniae; the crRNA includes an anchor sequence binding to the cas protein and a guide sequence matching the target DNA fragment in the conserved sequence.

2. The CRISPR detection primer set for Klebsiella pneumoniae according to claim 1, wherein the conserved sequence is as shown in SEQ ID NO:1 is shown.

3. The CRISPR detection primer set for Klebsiella pneumoniae according to claim 1, wherein the crRNA sequence is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

4. the CRISPR detection primer set for Klebsiella pneumoniae of claim 3, wherein the forward amplification primer in the amplification primer pair is selected from the group consisting of: the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8;

the reverse amplification primer in the amplification primer pair is selected from the group consisting of: SEQ ID NO:9,SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

5. the CRISPR detection primer set for Klebsiella pneumoniae according to claim 4, wherein the crRNA sequence is as shown in SEQ ID NO:3, respectively.

6. The CRISPR detection primer set for Klebsiella pneumoniae according to claim 4, wherein the forward amplification primer is shown as SEQ ID NO:7, the reverse amplification primer is shown as SEQ ID NO: shown at 9.

7. Use of the CRISPR detection primer set for Klebsiella pneumoniae of any one of claims 1-6 in the development and/or preparation of products for pneumonia diagnosis and/or prognosis evaluation.

8. A kit for detecting klebsiella pneumoniae, comprising the CRISPR detection primer set for klebsiella pneumoniae of any one of claims 1 to 6.

9. The kit for detecting klebsiella pneumoniae according to claim 8, further comprising: cas12a protein and a signaling reporter probe.

10. The kit for detecting klebsiella pneumoniae according to claim 9, wherein the cas12a protein is an Lbcas12a protein.

Images