CN115927607A

CN115927607A - Application of biomarker in diagnosis of gastric cancer

Info

Publication number: CN115927607A
Application number: CN202110942431.XA
Authority: CN
Inventors: 张良禄; 张燕; 董兰兰; 吴志诚; 吴悦茨; 万康康; 李婷婷
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2021-08-17
Filing date: 2021-08-17
Publication date: 2023-04-07
Anticipated expiration: 2041-08-17
Also published as: CN115927607B

Abstract

The invention relates to the field of biomedicine, in particular to application of a biomarker in diagnosis of gastric cancer. Specifically, the marker is IRF4 gene region methylation. According to the invention, the methylation level of the IRF4 gene regions 1-24 in a gastric cancer sample is found to be obviously higher than that of a normal sample for the first time, so that the IRF4 gene regions can be used for gastric cancer diagnosis and can be used as a gastric cancer marker.

Description

Application of biomarker in diagnosis of gastric cancer

Technical Field

The invention relates to the field of biomedicine, in particular to application of a biomarker in diagnosis of gastric cancer.

Background

Worldwide, gastric cancer is a highly lethal malignancy. The prognosis of a gastric cancer patient is related to the pathological stages of the gastric cancer patient when the gastric cancer patient is diagnosed, the earlier the gastric cancer patient is found, the better the prognosis is, and the 5-year survival rate of the gastric cancer patient can exceed 70% in countries with the perfect popularization and implementation of the early gastric cancer screening project. Early gastric cancer is defined as cancer confined to the mucosa or submucosa, regardless of the presence or absence of lymph node metastasis, but only a few gastric cancers can be diagnosed at an early stage on a global scale due to nonspecific symptoms of gastric cancer and difficulty in distinguishing early gastric cancer from benign peptic ulcer and gastritis in an outpatient setting.

The endoscope is widely used for early diagnosis of gastric cancer due to high accuracy, but the accuracy depends on the observation ability of an endoscopist, the phenomenon that the endoscope neglects to diagnose the gastric cancer is common, and the false negative rate is between 5 and 19 percent. In addition, endoscopy is invasive and may require the use of anesthetic agents, and the operation is complicated, and therefore, in addition to technical improvement, a novel biomarker for early diagnosis is urgently required.

The occurrence of gastric cancer involves the combined action of multiple genes and multiple factors, wherein methylation level abnormality of some genes plays an important role, and the methylation level abnormality of genes is an early event of the occurrence of cancer, so that the methylation level abnormality can be used as an early gastric cancer detection target.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the invention is to provide an application of a reagent for detecting the methylation level of at least one of IRF4 gene partial regions 1-24 in the preparation of a gastric cancer diagnosis kit;

the partial region includes:

a) The regions 1 to 24 are sequentially Chr6:391205-391320 positive strand, chr6:391400-391488 positive strand, chr6:391469-391563 positive strand, chr6:391584-391703 positive strand, chr6:391890-392026 positive strand, chr6:392075-392186 positive strand, chr6:392462-392580 positive strand, chr6:392610-392744 positive strand, chr6:392786-392913 positive strand, chr6:393095-393220 positive strand, chr6:393302-393530 positive strand, chr6:393600-393788 positive strand, chr6:393788-393652 negative strand, chr6:393596-393416 negative strand, chr6:393380-393240 negative strand, chr6: 3222-393091, chr6: 3913970-39366 negative strand, chr 3913975-3970 negative strand, and Chr6: 397839896: 3970-3970 negative strand, and Chr6: 3970-3970 negative strand; or

b) Other regions comprising a) methylation sites in regions 1-24.

The second purpose of the invention is to provide a primer and probe combination product and a kit for detecting the methylation level of at least one of the IRF4 gene regions 1-24.

According to the invention, the methylation level of the IRF4 gene regions 1-24 in a gastric cancer sample is found to be obviously higher than that of a normal sample for the first time, so that the IRF4 gene regions can be used for gastric cancer diagnosis and can be used as a gastric cancer marker.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a ROC plot of regions 1-6 distinguishing gastric cancer plasma samples from normal samples in one embodiment of the present invention;

FIG. 2 is a ROC plot of regions 7-12 distinguishing gastric cancer plasma samples from normal samples in one embodiment of the present invention;

FIG. 3 is a ROC plot of regions 13-18 distinguishing gastric cancer plasma samples from normal samples in one embodiment of the present invention;

FIG. 4 is a ROC plot of regions 19-24 distinguishing gastric cancer plasma samples from normal samples in one embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless otherwise defined, all terms (including technical and scientific terms) used in disclosing the invention are to be interpreted as commonly understood by one of ordinary skill in the art to which this invention belongs. The following definitions serve to better understand the teachings of the present invention by way of further guidance. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

As used herein, the terms "comprising," "including," and "comprising" are synonymous, inclusive or open-ended, and do not exclude additional, unrecited members, elements, or method steps.

The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range, as well as the recited endpoints.

The invention relates to an application of a reagent for detecting the methylation level of at least one of IRF4 gene partial regions 1-24 in preparing a gastric cancer diagnosis kit;

the partial region includes:

b) Other regions comprising a) methylation sites in regions 1-24.

The term "methylation level" is understood as meaning, as is generally understood, whether or not a cytosine in one or more CpG dinucleotides in a DNA sequence is methylated or the frequency/ratio/percentage of methylation, and represents both a qualitative and a quantitative concept. For example, if cytosine (C) residues within a nucleic acid sequence are methylated, they may be referred to as "hypermethylated" or have "increased methylation" in practice, and DNA methylation levels may be compared using different detection indicators depending on the actual situation, such as in some cases, the comparison may be performed based on the Ct values detected by the sample, and in some cases, the methylation ratio of the marker in the sample, i.e., the number of methylated molecules/(the number of methylated molecules + the number of unmethylated molecules) × 100, may be calculated, and then the comparison may be performed, and in some cases, statistical analysis integration of each indicator may be performed to obtain the final determination indicator.

In the present invention, "methylation level of a CpG island region" refers to the methylation level of cytosine in one or more CpG dinucleotides within a CpG island. "methylation site" refers to at least one CpG dinucleotide site in a region, and more particularly to cytosine in at least one CpG dinucleotide site in a region.

In the present invention, IRF4 gene regions 1 to 24 are mapped according to the reference genome GRCh38. P13; it will be appreciated that although the sequences of the regions described above are derived from humans, the subject to which the regions of the invention are directed is not limited to humans, and may be any warm-blooded animal, such as mammals, like primates, and preferably humans. Non-human primates are also subjects. The term subject includes domesticated animals such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mice, rabbits, rats, gerbils, guinea pigs, etc.).

It is also understood that the altered regions corresponding to regions 1-24 or combinations thereof (i.e., the regions defined in b) are also within the scope of the present application and that the altered regions may suitably extend or shorten (particularly extend) a number of nucleic acids so long as they contain methylation sites within the exemplified regions described above, such as region 1, which methylation sites include at least one of the cytosines at the Chr6:391206, chr6:391208, chr6:391225, chr6:391240, chr6:391252, chr6:391297, chr6:391304, and Chr6:391316 positions.

In the present invention, the term "diagnosis" includes auxiliary diagnosis, evaluation of risk of recurrence, evaluation of risk and degree of canceration, prognosis, and the like.

In the present invention, the term "prognosis" has the meaning known to the person skilled in the art. In one embodiment of the invention, prognosis refers to probability of survival (PFS). Where the subject is a population (2 or more than 2 patients), prognosis can refer to median survival probability or mean survival probability.

In some embodiments, the reagent allows detection of the target area by one or more of the following methods:

methylation specific PCR, bisulfite sequencing, methylation specific microarray, whole genome methylation sequencing, pyrosequencing, methylation specific high performance liquid chromatography, methylation specific high resolution solubility curves, methylation sensitive restriction endonuclease methods, and fluorescence quantitation.

In some embodiments, the reagents comprise primer and probe combinations, and the primer and probe combinations corresponding to regions 1-24 are sequentially set forth in SEQ ID NO:1 to 3, SEQ ID NO:4 to 6, SEQ ID NO:7 to 9, SEQ ID NO:10 to 12, SEQ ID NO:13 to 15, SEQ ID NO:16 to 18, SEQ ID NO:19 to 21, SEQ ID NO:22 to 24, SEQ ID NO:25 to 27, SEQ ID NO:28 to 30, SEQ ID NO:31 to 33, SEQ ID NO:34 to 36, SEQ ID NO:37 to 39, SEQ ID NO:40-42, SEQ ID NO:43-45, SEQ ID NO:46 to 48, SEQ ID NO:49 to 51, SEQ ID NO:52 to 54, SEQ ID NO:55-57, SEQ ID NO:58-60, SEQ ID NO:61-63, SEQ ID NO:64 to 66, SEQ ID NO:67-69, SEQ ID NO:70 to 72.

In addition, it is contemplated that, in one aspect, useful primers and probes include those that are identical to SEQ ID NO: 1-72 have a nucleotide sequence that is greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. Such primer and probe modifications are also contemplated and may be made according to standard techniques.

The term "% identity" in the context of two or more nucleotide or amino acid sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example,% identity is relative to the entire length of the coding region of the sequences to be compared.

For sequence comparison, typically one sequence is used as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. Percent identity can be determined using search algorithms such as BLAST and PSI-BLAST (Altschul et al, 1990, J Mol Biol 215, altschul et al, 1997, nucleic Acids Res25, 17, 3389-402).

The primer and probe modification can be carried out by a known method. Modified versions of these primer and/or probe sequences may include, by way of non-limiting example, adding one or more nucleotides to the 5 'end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to the 5 'end and the 3' end, adding a tail, shortening the sequence, lengthening the sequence, moving the sequence several bases upstream and downstream, or any combination thereof.

Base modifications such as 3'P, 5-nitroindole, 2-aminopurine, 8-amino-2' -deoxyadenosine, C-5 propynyl-deoxycytidine, C-5 propynyl-deoxyuridine, 2-amino-2 '-deoxyadenosine-5' -triphosphate, 2, 6-diaminopurine (2-amino-dA), reverse dT, reverse dideoxy-T, hydroxymethyl dC, iso-dC, 5-methyl dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNA's), and including at least one base mismatch at one of the bases, or substitution of at least one of the bases as an RNA base, to achieve, for example, increased nucleic acid interaction at the 3' end of the mutant-specific primer to increase Tm. The addition of a double-stranded stable base modification has a positive effect on PCR, enabling it to be performed at higher temperatures, in the range where Taq polymerase is known to show the greatest activity. The modified probe should retain the ability to distinguish between the mutated site to be detected and the wild-type site.

In some embodiments, the reagents further comprise primers and probes for detecting an internal reference nucleic acid.

The reference gene can be selected from housekeeping genes known to those skilled in the art, such as Actin, tubulin, GAPDH; the internal reference gene exists in normal cells and cancer tissue cells, and sequence difference does not exist, so that the sample can be better detected, and the methylation ratio of the target gene in the sample can be reflected.

In some embodiments, the reference nucleic acid is a β -Actin gene, or fragment thereof.

In some embodiments, the probes are both self-quenching probes.

In some embodiments, the fluorescent emitting moiety of each probe is independently selected from any one of AMCA, pacific Blue, atto 425, BODIPY FL, FAM, alexa Fluor 488, TET, JOE, yakima Yellow, VIC, HEX, quasar 570, cy3, NED, TAMRA, ROX, aqua Phluor593, texas Red, atto 590, cy5, quasar 670, cy5.5, and Cy5.5.

In some embodiments, the quencher group of each probe is independently selected from any one of BHQ1, BHQ2, BHQ3, dabcyl, eclipse and MGB.

In some embodiments, the reagents further comprise DNA extraction reagents, amplification buffer, dntps, mg ²⁺ At least one of a DNA polymerase, a positive control, a negative control, water, and a sulfite sequencing reagent.

In some embodiments, the reagents are used to detect the methylation level of at least one of IRF4 gene regions 10, 11, 12, 21, and 22.

In some embodiments, the gastric cancer is a stage III or stage IV gastric cancer sample.

According to a further aspect of the invention, it also relates to a primer and probe combination as defined above.

According to a further aspect of the invention, it also relates to a kit comprising the reagents as defined above.

The term "kit" refers to any article of manufacture (e.g., a package or container) comprising at least one device, the kit may further comprise instructions for use, supplemental reagents, and/or components or assemblies for use in the methods described herein or steps thereof.

The present invention also relates to a method for detecting gastric cancer, comprising detecting the methylation level of at least one of the regions 1-24 in a sample of a subject.

In some embodiments, the subject sample may be from blood (whole blood, preferably peripheral blood), plasma, cell culture supernatant, stool, saliva, semen, alveolar lavage, amniotic fluid, villi, tissue or tissue lysate, bone, or hair.

As used herein, "tissue or tissue lysate" may also be used in common with the terms "lysate", "lysed sample", "tissue or cell extract", and the like, to denote a sample and/or biological sample material comprising lysed tissue or cells, i.e., where the structural integrity of the tissue or cells has been disrupted. To release the contents of a cell or tissue sample, the material is typically treated with enzymes and/or chemical reagents to lyse, degrade, or disrupt the cell walls and membranes of such tissues or cells. The skilled artisan is well familiar with suitable methods for obtaining lysates. This process is encompassed by the term "lysis". Preferred tissues are lung tissue, more preferably cancerous tissue or para-cancerous tissue from the lung.

One skilled in the art is aware of the ideal scenario for diagnosis is a situation where a single event or process can cause a variety of diseases, especially when the etiology of the disease is not fully understood, as in the case of many cancer types, or gastric cancer as described herein. As the skilled artisan will appreciate, diagnosis without biochemical markers is 100% specific and 100% sensitive for a given multifactorial disease, but it is within the ability of the skilled artisan to use multiple disease markers in combination, or a combination of detection methods to increase the accuracy of the detection.

Determination of whether a subject has a significant difference compared to the initial state (baseline) of a healthy population/benign tumor control group/subject can be performed using statistical methods well known in the art and confirmed using confidence intervals and/or p-values. In some embodiments, the confidence interval may be 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, or 99.99% and the p value may be 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001.

Embodiments of the present invention will be described in detail with reference to examples.

Example 1

The present embodiment provides a method for diagnosing gastric cancer.

This example provides nucleotide combinations useful for diagnosis or diagnosis assistance of gastric cancer, and the regions to be detected, and the corresponding primers and probes are shown in table 1.

TABLE 1

/>

/>

The information of each region on the IRF4 gene is as follows:

the positive strand base sequence of region 1 (Chr 6: 391205-391320) is as follows (5 '-3'):

CCGCGGAGAGGCAGGGTTCCCGGTGATGGCCTTGCCGAGGGTGCTCCCGCAACCTCCACCTCCAGTTCTCTTTGGACCATTCCTCCGTCTTCCGTTACACGCTCTGCAAAGCGAAG。

the amino acid sequence of SEQ ID NO:1-3 can detect methylation of cytosine at the Chr6:391206, chr6:391208, chr6:391225, chr6:391240, chr6:391252, chr6:391297, chr6:391304, and Chr6:391316 positions located on the plus strand of the region.

The plus-strand base sequence of region 2 (Chr 6: 391400-391488) is as follows (5 '-3'):

TGGCCTCCTGAGGTCCTGGCGCAAAGGCGAGATTCGCATTTCGCACCTCGCCCTTCGCGGGAAACGGCCCCAGTGACAGTCCCCGAAGC。

SEQ ID NO:4-6 can detect methylation of cytosine at the Chr6:391419, chr6:391427, chr6:391434, chr6:391441, chr6:391448, chr6:391464, chr6:391483 and Chr6:391488 positions on the plus strand of the region.

The positive strand base sequence of region 3 (Chr 6: 391469-391563) is as follows (5 '-3'):

CCAGTGACAGTCCCCGAAGCGGCGCGCGCCCGGCTGGAGGTGCGCTCTCCGGGCGCGGCGCGCGGAGGGTCGCCAAGGGCGCGGGAACCCCACCC。

the amino acid sequence of SEQ ID NO: the nucleotides shown in FIGS. 7-9 detect methylation of cytosines at the Chr6:391483, chr6:391488, chr6:391491, chr6:391493, chr6:391499, chr6:391511, chr6:391518, chr6:391539, chr6:391548 and Chr6:391550 positions on the plus strand of the region.

The positive strand base sequence of region 4 (Chr 6: 391584-391703) is as follows (5 '-3'):

CTTCACGCCGGCCCTGAGGCTCGCCCGCCCGGCCGGCCCCGGCTCTCGGCTTGCAAAGTCCCTCTCCCCAGTCCAACCCCCGGCCCCCACAGGCCTCGGCGCCCCGCCCCGCCCCAGGCC。

SEQ ID NO: the nucleotides shown in 10-12 can detect the methylation of cytosine at the positions of Chr6:391589, chr6:391592, chr6:391605, chr6:391613, chr6:391617, chr6:391623, chr6:391630, chr6:391683, chr6:391688 and Chr6:391693 on the positive strand of the region.

The positive strand base sequence of region 5 (Chr 6: 391890-392026) is as follows (5 '-3'):

TCCAGGGCAGCGCAGGGTACCCCGGCTTCGGAGCGGGAAGGGAGCGCGCCCCGTCCTGGAGCTCCGACTCCCACCCCATCTGCGCTGAGCCGGAGGCGCTGGTTTGGGCTCCAAGGCCCGCCTCCTTGGCTCTGCCC。

SEQ ID NO: the nucleotides shown in FIGS. 13-15 detect methylation of cytosines at the Chr6:391900, chr6:391912, chr6:391934, chr6:391936, chr6:391941, chr6:391954, chr6:392008 and Chr6:392026 positions on the positive strand of the region.

The positive strand base sequence of region 6 (Chr 6: 392075-392186) is as follows (5 '-3'):

CTGGACGGGATGAGCTAACCGGACTGTCGGGGCCCCAGGAGTGGCTGAGGCGGGGCCGTCCAAGGCACCCACACAAGACGGCACAACTGCCTGCGAGAAACAGGCCCGGCCC。

SEQ ID NO:16-18 can detect the methylation of cytosine at the Chr6:392080, chr6:392094, chr6:392125, chr6:392131, chr6:392168 and Chr6:392181 positions on the positive strand of the region.

The positive strand base sequence of region 7 (Chr 6: 392462-392580) is as follows (5 '-3'):

CCGTACTGGGGCTGCAGCCCCCGCGTCTGCGCCACTTGTCGTTTGCAGAGCCCACTTAGTGCGCGCTAGCTGGGCAGGGATAGGGGTCCTATTCGGGGCGAAGGGTCTGGATGCGAGCA。

SEQ ID NO: the nucleotides shown in 19-21 can detect the methylation of cytosine at the Chr6:392463, chr6:392483, chr6:392523, chr6:392525 and Chr6:392575 positions on the plus strand of the region.

The plus-strand base sequence of region 8 (Chr 6: 392610-392744) is as follows (5 '-3'):

CTGCGCCCCTGGAACGCCCGGCCGCAGGCGAGGTCCTCCGCGCGTGGAGGCCGCCAGGGGAGTGGAAACTGACAGAGTCGCGGGGAAGGGGCGAGAAGCGGGTTGGGAGTGAGCGAAGGCAAGCGAGAGCTGCGA。

SEQ ID NO:22-24 can detect methylation of cytosine at the Chr6:392613, chr6:392624, chr6:392628, chr6:392648, chr6:392650, chr6:392652, chr6:392661, chr6:392733 and Chr6:392742 positions on the positive strand of the region.

The plus strand base sequence of region 9 (Chr 6: 392786-392913) is as follows (5 '-3'):

GGGAGAGAGGGTGCAAGACGAGCGGCGCGTGTCGGGAGCCTTTGGGCTGCGGGTGCGTTACAGGAGAGCAGGCGGGTAGGAGCCTTCGCGGGGGCCGAGCTCGGAAGGCGGACGGCTGTGCCCGCCCA。

SEQ ID NO: the nucleotides shown in 25-27 can detect the methylation of cytosine at the Chr6:392804, chr6:392835, chr6:392841, chr6:392894, chr6:392898 and Chr6:392908 positions on the positive strand of the region.

The plus strand base sequence of region 10 (Chr 6: 393095-393220) is as follows (5 '-3'):

CAGTGCAGAGCAGAGCGGGCGGAGGACCCCGGGCGCGGGCGCGGACGGCACGCGGGGCATGAACCTGGAGGGCGGCGGCCGAGGCGGAGAGTTCGGCATGAGCGCGGTGAGCTGCGGCAACGGGAA。

SEQ ID NO:28-30 can detect methylation of cytosine at the Chr6:393110, chr6:393114, chr6:393140, chr6:393145, chr6:393147, chr6:393209 and Chr6:393215 positions on the positive strand of the region.

The positive strand base sequence of region 11 (Chr 6: 393302-393530) is as follows (5 '-3'):

CCGCATCCCCTGGAAGCACGCGGGCAAGCAGGACTACAACCGCGAGGAGGACGCCGCGCTCTTCAAGGTCTCCGGCCTCGGGAGCCGGCGGGGGCGCGCCGGGGAGGGCCCAGAGACAGAGCCCGGGGTCCCCGGCGCCGCCTCCGAGGCGAGCCCAGGGGACCGCGCGGGGCGGACGGGCGGGCGGCGGAGGCATCAGGTGGCGTCGCCGGAGCCGCAGGAGGAGGAA。

SEQ ID NO:31-33 can detect methylation of cytosine at the Chr6:393303, chr6:393320, chr6:393322, chr6:393342, chr6:393344, chr6:393353, chr6:393511 and Chr6:393517 positions on the positive strand of the region.

The plus strand base sequence of region 12 (Chr 6: 393600-393788) is as follows (5 '-3'):

GAAACCGCTGAAGGCCCGGCCGGGCCCGGGGAAGGGCGGCCAAAGGCTTGAGGGGTTTTGCGCGTTCGTCCGTGCGTTCTCGTTTCCACGCAAGCCTCCCGCCCTTCCTCCGGGCTCCCGTCTGCCGCCTCCGTCCGTGGGTCCCCCTCGCCCTCTCCGTGCGTCCGCGCCTGTGCCGGCGGCTGTTTT。

SEQ ID NO:34-36 can detect the methylation of cytosine at the Chr6:393605, chr6:393616, chr6:393620, chr6:393660, chr6:393662, chr6:393776 and Chr6:393779 positions on the positive strand of the region.

The minus strand base sequence of region 13 (Chr 6: 393788-393652) is as follows (5 '-3'):

AAAACAGCCGCCGGCACAGGCGCGGACGCACGGAGAGGGCGAGGGGGACCCACGGACGGAGGCGGCAGACGGGAGCCCGGAGGAAGGGCGGGAGGCTTGCGTGGAAACGAGAACGCACGGACGAACGCGCAAAACCC。

SEQ ID NO: the nucleotides shown in 37-39 can detect the methylation of cytosine at the Chr6:393661, chr6:393663, chr6:393667, chr6:393671, chr6:393736, chr6:393749, chr6:393768, chr6:393777 and Chr6:393780 positions on the negative strand of the region.

The minus-strand base sequence of the region 14 (Chr 6: 393596-393416) is as follows (5 '-3'):

GCAGCCTCCACGCGCCCAGGACCCGGCTCCCGGCCCCCGCGGTCCCGCTGAGAGCCGAGGCCTCCTTTCCTCCTCCTGCGGCTCCGGCGACGCCACCTGATGCCTCCGCCGCCCGCCCGTCCGCCCCGCGCGGTCCCCTGGGCTCGCCTCGGAGGCGGCGCCGGGGACCCCGGGCTCTGTC。

SEQ ID NO:40-42 can detect methylation of cytosine at the positions Chr6:393426, chr6:393435, chr6:393483, chr6:393487, chr6:393490, chr6:393506, chr6:393573, chr6:393584 and Chr6:393586 located on the minus strand of the region.

The minus strand base sequence of region 15 (Chr 6: 393380-393240) is as follows (5 '-3'):

GAGGCCGGAGACCTTGAAGAGCGCGGCGTCCTCCTCGCGGTTGTAGTCCTGCTTGCCCGCGTGCTTCCAGGGGATGCGGAAGATGCTCTTCTCCTCGTTCTCCCACACCAGCCCGGGGTACTTGCCGCTGTCGATCTGGTC。

the amino acid sequence of SEQ ID NO:43-45 can detect the methylation of cytosine at the Chr6:393240, chr6:393249, chr6:393255, chr6:393323, chr6:393343, chr6:393345, chr6:393359 and Chr6:393375 positions on the minus strand of the region.

The minus strand base sequence of the region 16 (Chr 6: 393222-393091) is as follows (5 '-3'):

GCTTCCCGTTGCCGCAGCTCACCGCGCTCATGCCGAACTCTCCGCCTCGGCCGCCGCCCTCCAGGTTCATGCCCCGCGTGCCGTCCGCGCCCGCGCCCGGGGTCCTCCGCCCGCTCTGCTCTGCACTGCGGG。

the amino acid sequence of SEQ ID NO:46-48 can detect methylation of a cytosine at the Chr6:393094, chr6:393111, chr6:393141, chr6:393146, chr6:393148, chr6:393198, chr6:393200, chr6:393210, and Chr6:393216 positions on the minus strand of the region.

The nucleotide sequence of the minus strand of region 17 (Chr 6: 393075-392956) is as follows (5 '-3'):

TCAGCCACGAGGCACCGCACTCCGGGCACCCCGCCCCGATCCCCTGCGCCAGTGACCACGAGGCCCCGGAGTCTTTGAGGCTGCGAAGCGCGCGCGTGCCGTGTCAGGGTCGTCCGGGCC。

the amino acid sequence of SEQ ID NO: the nucleotides shown in 49-51 can detect the methylation of cytosine at the positions of Chr6:392961, chr6:392965, chr6:393009, chr6:393017, chr6:393029, chr6:393053, chr6:393060 and Chr6:393068 on the minus strand of the region.

The minus strand nucleotide sequence of region 18 (Chr 6: 392906-392801) is as follows (5 '-3'):

GCACAGCCGTCCGCCTTCCGAGCTCGGCCCCCGCGAAGGCTCCTACCCGCCTGCTCTCCTGTAACGCACCCGCAGCCCAAAGGCTCCCGACACGCGCCGCTCGTCT。

SEQ ID NO:52-54 can detect methylation of cytosine at the Chr6:392805, chr6:392809, chr6:392812, chr6:392814, chr6:392819, chr6:392859, chr6:392873, chr6:392875, chr6:392882, chr6:392888, chr6:392895 and Chr6:392899 positions on the minus strand of the region.

The nucleotide sequence of the minus strand of region 19 (Chr 6: 392646-392505) is as follows (5 '-3'):

AGGACCTCGCCTGCGGCCGGGCGTTCCAGGGGCGCAGCCCCGGGTTCCTCCACCCTCCGCTTTCTCTGCTCGCATCCAGACCCTTCGCCCCGAATAGGACCCCTATCCCTGCCCAGCTAGCGCGCACTAAGTGGGCTCTGCA。

SEQ ID NO:55-57 detect methylation of cytosines at the Chr6:392524, chr6:392526, chr6:392606, chr6:392614, chr6:392629, chr6:392633 and Chr6:392639 positions on the minus strand of the region.

The minus strand base sequence of region 20 (Chr 6: 392478-392329) is as follows (5 '-3'):

CTGCAGCCCCAGTACGGGGGATTCCGCGCGCAGAGCGTCCGCCGGACCCCGGAGCAGGCCCGGGAGAGCGGAGGCGGGGAGGGCGCGGGAGAGGGCGACGACAGCTGCGGAGCCTGGGAGGCAGGGACCGCGCCAGGCCGGCTAGGCCAC。

SEQ ID NO: the nucleotides shown in 58-60 can detect methylation of cytosine at the Chr6:392340, chr6:392348, chr6:392350, chr6:392429, chr6:392436, chr6:392439, chr6:392443, chr6:392454 and Chr6:392464 positions on the negative strand of the region.

The minus-strand base sequence of region 21 (Chr 6: 392219-391988) is as follows (5 '-3'):

AGCAGGGGAAGGAGCCTCGGATTGGGGTCCACAGGGCCGGGCCTGTTTCTCGCAGGCAGTTGTGCCGTCTTGTGTGGGTGCCTTGGACGGCCCCGCCTCAGCCACTCCTGGGGCCCCGACAGTCCGGTTAGCTCATCCCGTCCAGCTTGTGGCGACCCCGTCGCAGGAGCGCGGAGGGCAGGCGGGGAGGCTCGGGCAGAGCCAAGGAGGCGGGCCTTGGAGCCCAAACCAG。

the amino acid sequence of SEQ ID NO: the nucleotides 61-63 detect methylation of cytosines at the Chr6:392009, chr6:392169, chr6:392182 and Chr6:392202 positions on the minus strand of the region.

The minus strand base sequence of the region 22 (Chr 6: 391891-391703) is as follows (5 '-3'):

GAGGTCGAACCTCTGGTTCGCGCTCCGGGTCCTCTCTGGTATCAGCCTCACACCCCTCCTCCTGCCCGACTCCAGCCCTTACCTCGCCCTGGACTCGGAGCTGAGGGCAGCGGTGGGTCCCAAGATCGAGCGGTGAAACTGAGAGTGCGAGGTGGGAAAGAGGAACTTTATAGAACTCTCTGGGGCGGG。

SEQ ID NO: the nucleotides shown at 64-66 detect methylation of cytosines at positions Chr6391706, chr6391796, chr6391807, chr6391871, chr6391873 and Chr6391886 in the minus strand of the region.

The minus-strand base sequence of region 23 (Chr 6: 391653-391501) is as follows (5 '-3'):

TGGGGAGAGGGACTTTGCAAGCCGAGAGCCGGGGCCGGCCGGGCGGGCGAGCCTCAGGGCCGGCGTGAAGGCTGGGGGCTGCCGCGGCCGGGGTGGGGTTCCCGCGCCCTTGGCGACCCTCCGCGCGCCGCGCCCGGAGAGCGCACCTCCAGC。

SEQ ID NO:67-69 can detect methylation of cytosines at the Chr6:391512, chr6:391519, chr6:391523, chr6:391590, chr6:391593 and Chr6:391631 positions on the minus strand of the region.

The minus strand base sequence of region 24 (Chr 6: 391478-391283) is as follows (5 '-3'):

CTGTCACTGGGGCCGTTTCCCGCGAAGGGCGAGGTGCGAAATGCGAATCTCGCCTTTGCGCCAGGACCTCAGGAGGCCAGTCAATCACTAAACTGCAGCGATGTGGCCAGGGCGGGAAATGGGGGGCGTGTAGTAGCGGGAATCTGGTGCGAAGGGGACTTCGCTTTGCAGAGCGTGTAACGGAAGACGGAGGAAT。

SEQ ID NO: the nucleotides shown by 70-72 can detect the methylation of cytosine at the Chr6:391291, chr6:391298, chr6:391420, chr6:391428, chr6:391435, chr6:391458 and Chr6:391465 positions on the minus strand of the region.

The detection method comprises the following steps:

1. extraction of DNA template:

when the sample is a Tissue sample, the genome is extracted using QIAamp DNA FFPE Tissue Kit, for details see Kit instructions.

When the used sample is a feces sample, human IRF4 gene in the feces is extracted by adopting nucleic acid extraction kit (20200225, ehan instruments) of Wuhan Amison Life technologies, inc., the kit captures a target fragment in the feces by adopting a capture probe, biotin is marked on the capture probe, and probes in different areas of 10 mu M and streptavidin magnetic beads of 10mg/mL are mixed in equal ratio to form a capture agent. And (3) separately capturing and extracting the positive strand region and the negative strand region, namely adding a positive strand capture probe when extracting a positive strand genome, adding a negative strand capture probe when extracting a negative strand region, and replacing a capture agent carried by the kit with a capture agent formed by mixing the capture probe in the table 2 and streptavidin when using. See table 2 for positive and negative strand capture probe sequences and for specific procedures see kit instructions.

TABLE 2

The used sample is a blood sample, and the blood plasma cfDNA is extracted by a magnetic bead method serum/blood plasma free DNA extraction kit (DP 709) of Tiangen Biochemical technology (Beijing) Co., ltd.

2. Conversion of sulphites

And (3) carrying out bisulfite conversion on the extracted genome, wherein the nucleic acid conversion kit is a nucleic acid purification reagent (20500843, ehan instruments) of Wuhan Amison Life technologies, ltd.

3. Methylation specific PCR reactions

Carrying out methylation specific PCR reaction on DNA converted by bisulfite to detect the methylation state of IRF4 gene regions 1-24, wherein each region is independently detected, namely, only one region detection primer and probe are added in one PCR tube at a time, and simultaneously, a reference gene detection probe is added. The PCR reaction system using ACTB (i.e.,. Beta. -actin) as an internal reference gene is shown in Table 3. Wherein the ACTB upstream primer is: AAGGTGGTTGGGTGGTTGTTTTG; the ACTB downstream primer is: AATAACACCCCCCACCTGC; the ACTB probe was: GGAGTGGTTTTTGGGTTTG.

And a reporter group at the 5 'end of the probe in the detection target region is FAM, a quenching group at the 3' end is MGB, a reporter group at the 5 'end of the ACTB probe is VIC, and a quenching group at the 3' end is BHQ1.

Invitrogen Platinum II Taq hot start DNA polymerase is adopted for PCR amplification, and a PCR reaction solution configuration system is as follows:

TABLE 3

Components	Specification of	Volume (mu L)
			Platinum II PCR buffer	5×	5
dNTPs	2.5mM each	3
			Region upstream primer	10μM	0.5
Region downstream primer	10μM	0.5
			Area probe	10μM	0.5
ACTB upstream primer	10μM	0.5
			ACTB downstream primer	10μM	0.5
ACTB probes	10μM	0.5
			Taq enzyme	/	0.5
DNA of sample to be tested	/	5
			Purified water	/	Supplement to 25

As shown in Table 3, when detecting the methylation state of any one of the IRF4 region 1-region 24 in a sample, only the primer probe corresponding to the one region, ACTB primer probe, buffer, dNTP, DNase, sample DNA, etc. are added to the reaction system in the volume indicated in the table. For the fecal sample, the added sample DNA to be tested is formed by converting the extracted plus strand DNA when detecting the area 1-12, and the added sample DNA to be tested is formed by converting the extracted minus strand DNA when detecting the area 13-24; for the blood sample, the DNA of the sample to be tested is converted into the extracted cfDNA in the detection areas 1-24.

The PCR reaction conditions are as follows:

TABLE 4

Ct value reading: and after the PCR is finished, adjusting a base line, setting a fluorescence value of the sample in the primary PCR before the minimum Ct value is advanced by 1-2 cycles as a base line value, and setting a threshold value at an inflection point of an S-shaped amplification curve to obtain the Ct value of each gene of the sample.

Quality control: the negative control and the positive control were tested simultaneously at each test.

The negative control was purified water.

The preparation method of the positive control comprises the following steps: and (3) artificially synthesizing a sequence which corresponds to an amplified region of ACTB and is completely converted by bisulfite, and cloning the sequence onto a vector to form an artificially synthesized plasmid. And (3) artificially synthesizing sequences which correspond to the completely methylated regions 1-24 and are converted by bisulfite, and cloning the sequences to a vector to form an artificially synthesized plasmid. Positive control for zones 1-24 was 10 ³ Copy/microliter ACTB Artificial Synthesis plasmid and 10 ³ Artificial copy/microliter of regions 1-24Synthesis of plasmid 1:1, e.g. zone 1 positive control 10 ³ Copy/microliter ACTB Artificial Synthesis plasmid and 10 ³ Copy/microliter of region 1 synthetic plasmid 1:1 by mixing.

The negative control needs no amplification, the positive control needs obvious exponential increase, the Ct value of the positive control is 26-30, the Ct value of the reference gene of the sample to be detected is not more than 35, and after the negative control, the positive control and the reference gene all meet the requirements, the experiment is effective, and the next step of sample result judgment can be carried out. Otherwise, when the experiment is invalid, the detection should be performed again.

Results analysis and interpretation methods: regarding the tissue sample and the feces sample, when the Ct value of a certain area is less than or equal to 38, the area is considered to be detected to be methylated in the sample; for plasma samples, use 2 ^-ΔΔCt ROC analysis is carried out on gastric cancer samples and healthy human samples by the method, and the sensitivity, specificity and AUC value of the maximum Yowden index are recorded, wherein delta Ct = (Ct) _{Area to be examined} -Ct _ACTB ) _Sample(s) -(Ct _{Area to be inspected} -Ct _ACTB ) _{Positive control} 。

Example 2

Cancer tissue samples from 10 patients with gastric cancer and corresponding 10 tissue samples from nearby cancers were collected in a Wuhan Hospital, all of which were formalin-fixed, paraffin-embedded tissue samples. Of the 10 cancer tissue samples, 4 were stage I/II samples, and 6 were stage III/IV samples. The method described in example 1 was used to perform genome extraction, bisulfite conversion, PCR amplification on regions 1-24, detect the methylation status of each region in each sample, and when the PCR Ct value of a region is less than or equal to 38, the region was detected in the sample, and the detection rate of each region in each sample was counted, with the results shown in table 5.

TABLE 5

/>

As can be seen from Table 5, the detection effects of the regions 1 to 24 on the stage I/II gastric cancer samples, the stage III/IV gastric cancer samples and the paracarcinoma samples are different, and the detection rates of the 24 regions in the stage III/IV gastric cancer samples are higher than those of the stage I/II gastric cancer samples. In general, the detection effect of the region 10, the region 11, the region 12, the region 21 and the region 22 is obviously better than that of other regions, the detection rates of the regions in the stage I/II samples are not lower than 75%, the detection rates of the regions in the stage III/IV samples are all higher than 80%, and the detection rates of the regions 10, the regions 12, the regions 21 and the regions 22 in the stage III/IV samples are all 100%. The detection rates of the region 10, the region 11, the region 12, the region 21 and the region 22 in the paracancer sample were not higher than 10%, indicating that the specificity was not lower than 90%.

Example 3

Plasma samples of gastric cancer patients and plasma samples of healthy people confirmed to be diagnosed by tissue biopsy are collected in a certain Wuhan hospital, 5mL of each human is collected, and 64 plasma samples of gastric cancer patients (including 19 samples of gastric cancer patients in stage I/II and 45 samples of gastric cancer patients in stage III/IV) and 53 plasma samples of healthy people are collected. Plasma DNA extraction and bisulfite conversion were performed according to the method provided in example 1, PCR was performed using the 24 region-based specific primer and probe combinations for IRF4 in example 1, and PCR results were used as 2 ^-ΔΔCt The method carries out ROC analysis, and counts the sensitivity, specificity and AUC value of each region to the gastric cancer patient.

TABLE 6 detection sensitivity and specificity of regions 1-24 in plasma samples

/>

As can be seen from Table 6, the regions 1 to 24 can well distinguish the gastric cancer plasma sample from the normal sample, but the detection effects of the regions are different, and on the whole, the detection sensitivity of the regions 1 to 24 on the gastric cancer is more than 60%, and the specificity is more than 80%. The AUC values detected by the regions 10, 11, 12, 21 and 22 are all significantly better than those detected by other regions, and the methylation level of the regions in the plasma sample is increased by over 80 percent and the specificity is more than 90 percent.

Example 4

Feces samples confirmed to be gastric cancer patients and healthy people through tissue biopsy are collected in a certain Wuhan hospital, one feces is collected from each person, a collection device is a Wuhan Amison feces specimen collection and storage tube (No. 20191654 Ehan instruments), and 20 gastric cancer feces samples and 50 feces samples of healthy people are collected. DNA extraction and bisulfite conversion were performed according to the method provided in example 1, PCR detection was performed by using the specific primer and probe combination based on 24 regions for IRF4 in example 1, the methylation state of each region in each sample was detected, when the PCR Ct value of a certain region is less than or equal to 38, the region was detected in the sample, and the detection rate of each region in each sample was counted, with the results shown in Table 7.

TABLE 7 detection sensitivity and specificity of regions 1-24 in fecal samples

As shown in table 7, the regions 10, 11, 12, 21 and 22 were able to distinguish between the stomach cancer sample and the healthy human sample in the stool sample, and when Ct value =38 was taken as a cutoff value, the detection sensitivity of these five regions for stomach cancer was 55%, 65%, 55%, 60% and 60%, respectively, and the specificity was 98%, 96%, 100%, 98% and 96%, respectively.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Wuhan Amisen Life technologies Ltd

<120> application of biomarker in diagnosis of gastric cancer

<160> 72

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> artificial sequence

<400> 1

tcgcggagag gtagggtttt c 21

<210> 2

<211> 24

<212> DNA

<213> artificial sequence

<400> 2

cttcgcttta caaaacgtat aacg 24

<210> 3

<211> 25

<212> DNA

<213> artificial sequence

<400> 3

tgatggtttt gtcgagggtg ttttc 25

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

tggttttttg aggttttggc 20

<210> 5

<211> 25

<212> DNA

<213> artificial sequence

<400> 5

gcttcgaaaa ctatcactaa aaccg 25

<210> 6

<211> 25

<212> DNA

<213> artificial sequence

<400> 6

aggcgagatt cgtatttcgt atttc 25

<210> 7

<211> 25

<212> DNA

<213> artificial sequence

<400> 7

ttagtgatag ttttcgaagc ggcgc 25

<210> 8

<211> 25

<212> DNA

<213> artificial sequence

<400> 8

aaataaaatt cccgcgccct taacg 25

<210> 9

<211> 22

<212> DNA

<213> artificial sequence

<400> 9

ttcggttgga ggtgcgtttt tc 22

<210> 10

<211> 22

<212> DNA

<213> artificial sequence

<400> 10

ttttacgtcg gttttgaggt tc 22

<210> 11

<211> 22

<212> DNA

<213> artificial sequence

<400> 11

aacctaaaac gaaacgaaac gc 22

<210> 12

<211> 21

<212> DNA

<213> artificial sequence

<400> 12

ttcggtcggt ttcggttttc g 21

<210> 13

<211> 23

<212> DNA

<213> artificial sequence

<400> 13

tttagggtag cgtagggtat ttc 23

<210> 14

<211> 21

<212> DNA

<213> artificial sequence

<400> 14

gaacaaaacc aaaaaaacga a 21

<210> 15

<211> 25

<212> DNA

<213> artificial sequence

<400> 15

cgaaactcca aaacgaaacg cgctc 25

<210> 16

<211> 21

<212> DNA

<213> artificial sequence

<400> 16

ttggacggga tgagttaatc g 21

<210> 17

<211> 21

<212> DNA

<213> artificial sequence

<400> 17

aaaccgaacc tatttctcgc a 21

<210> 18

<211> 22

<212> DNA

<213> artificial sequence

<400> 18

tggttgaggc ggggtcgttt aa 22

<210> 19

<211> 22

<212> DNA

<213> artificial sequence

<400> 19

tcgtattggg gttgtagttt tc 22

<210> 20

<211> 20

<212> DNA

<213> artificial sequence

<400> 20

tactcgcatc caaacccttc 20

<210> 21

<211> 25

<212> DNA

<213> artificial sequence

<400> 21

tttatttagt gcgcgttagt tgggt 25

<210> 22

<211> 19

<212> DNA

<213> artificial sequence

<400> 22

ttgcgttttt ggaacgttc 19

<210> 23

<211> 21

<212> DNA

<213> artificial sequence

<400> 23

tcgcaactct cgcttacctt c 21

<210> 24

<211> 20

<212> DNA

<213> artificial sequence

<400> 24

tttcgcgcgt ggaggtcgtt 20

<210> 25

<211> 21

<212> DNA

<213> artificial sequence

<400> 25

gggagagagg gtgtaagacg a 21

<210> 26

<211> 20

<212> DNA

<213> artificial sequence

<400> 26

taaacgaaca caaccgtccg 20

<210> 27

<211> 22

<212> DNA

<213> artificial sequence

<400> 27

tttgggttgc gggtgcgtta ta 22

<210> 28

<211> 21

<212> DNA

<213> artificial sequence

<400> 28

tagtgtagag tagagcgggc g 21

<210> 29

<211> 20

<212> DNA

<213> artificial sequence

<400> 29

ttcccgttac cgcaactcac 20

<210> 30

<211> 21

<212> DNA

<213> artificial sequence

<400> 30

acggtacgcg gggtatgaat t 21

<210> 31

<211> 22

<212> DNA

<213> artificial sequence

<400> 31

tcgtattttt tggaagtacg cg 22

<210> 32

<211> 21

<212> DNA

<213> artificial sequence

<400> 32

ttcctcctcc tacgactccg a 21

<210> 33

<211> 25

<212> DNA

<213> artificial sequence

<400> 33

taggattata atcgcgagga ggacg 25

<210> 34

<211> 21

<212> DNA

<213> artificial sequence

<400> 34

gaaatcgttg aaggttcggt c 21

<210> 35

<211> 21

<212> DNA

<213> artificial sequence

<400> 35

aaaacaaccg ccgacacaaa c 21

<210> 36

<211> 22

<212> DNA

<213> artificial sequence

<400> 36

aggtttgagg ggttttgcgc gt 22

<210> 37

<211> 22

<212> DNA

<213> artificial sequence

<400> 37

aaaatagtcg tcggtatagg cg 22

<210> 38

<211> 20

<212> DNA

<213> artificial sequence

<400> 38

aaattttacg cgttcgtccg 20

<210> 39

<211> 20

<212> DNA

<213> artificial sequence

<400> 39

agagggcgag ggggatttac 20

<210> 40

<211> 25

<212> DNA

<213> artificial sequence

<400> 40

gtagttttta cgcgtttagg attcg 25

<210> 41

<211> 20

<212> DNA

<213> artificial sequence

<400> 41

aacaaaaccc gaaatccccg 20

<210> 42

<211> 25

<212> DNA

<213> artificial sequence

<400> 42

cgttatttga tgttttcgtc gttcg 25

<210> 43

<211> 22

<212> DNA

<213> artificial sequence

<400> 43

gaggtcggag attttgaaga gc 22

<210> 44

<211> 24

<212> DNA

<213> artificial sequence

<400> 44

gaccaaatcg acaacgacaa atac 24

<210> 45

<211> 25

<212> DNA

<213> artificial sequence

<400> 45

tcgcggttgt agttttgttt gttcg 25

<210> 46

<211> 25

<212> DNA

<213> artificial sequence

<400> 46

gtttttcgtt gtcgtagttt atcgc 25

<210> 47

<211> 21

<212> DNA

<213> artificial sequence

<400> 47

cccgcaatac aaaacaaaac g 21

<210> 48

<211> 25

<212> DNA

<213> artificial sequence

<400> 48

tttaggttta tgtttcgcgt gtcgt 25

<210> 49

<211> 25

<212> DNA

<213> artificial sequence

<400> 49

ttagttacga ggtatcgtat ttcgg 25

<210> 50

<211> 20

<212> DNA

<213> artificial sequence

<400> 50

aacccgaacg accctaacac 20

<210> 51

<211> 25

<212> DNA

<213> artificial sequence

<400> 51

tttgcgttag tgattacgag gtttc 25

<210> 52

<211> 25

<212> DNA

<213> artificial sequence

<400> 52

gtatagtcgt tcgtttttcg agttc 25

<210> 53

<211> 20

<212> DNA

<213> artificial sequence

<400> 53

aaacgaacga cgcgtatcga 20

<210> 54

<211> 23

<212> DNA

<213> artificial sequence

<400> 54

tcgcgaaggt ttttattcgt ttg 23

<210> 55

<211> 19

<212> DNA

<213> artificial sequence

<400> 55

aggatttcgt ttgcggtcg 19

<210> 56

<211> 24

<212> DNA

<213> artificial sequence

<400> 56

tacaaaaccc acttaatacg cgct 24

<210> 57

<211> 22

<212> DNA

<213> artificial sequence

<400> 57

tttaggggcg tagtttcggg tt 22

<210> 58

<211> 25

<212> DNA

<213> artificial sequence

<400> 58

ttgtagtttt agtacggggg atttc 25

<210> 59

<211> 23

<212> DNA

<213> artificial sequence

<400> 59

ataacctaac cgacctaacg cga 23

<210> 60

<211> 24

<212> DNA

<213> artificial sequence

<400> 60

agcgttcgtc ggatttcgga gtag 24

<210> 61

<211> 22

<212> DNA

<213> artificial sequence

<400> 61

agtaggggaa ggagtttcgg at 22

<210> 62

<211> 24

<212> DNA

<213> artificial sequence

<400> 62

ctaatttaaa ctccaaaacc cgcc 24

<210> 63

<211> 25

<212> DNA

<213> artificial sequence

<400> 63

tttatagggt cgggtttgtt tttcg 25

<210> 64

<211> 21

<212> DNA

<213> artificial sequence

<400> 64

gaggtcgaat ttttggttcg c 21

<210> 65

<211> 22

<212> DNA

<213> artificial sequence

<400> 65

cccgccccaa aaaattctat aa 22

<210> 66

<211> 25

<212> DNA

<213> artificial sequence

<400> 66

tttcgttttg gattcggagt tgagg 25

<210> 67

<211> 23

<212> DNA

<213> artificial sequence

<400> 67

tggggagagg gattttgtaa gtc 23

<210> 68

<211> 23

<212> DNA

<213> artificial sequence

<400> 68

actaaaaata cgctctccga acg 23

<210> 69

<211> 22

<212> DNA

<213> artificial sequence

<400> 69

agttttaggg tcggcgtgaa gg 22

<210> 70

<211> 22

<212> DNA

<213> artificial sequence

<400> 70

ttgttattgg ggtcgttttt cg 22

<210> 71

<211> 22

<212> DNA

<213> artificial sequence

<400> 71

attcctccgt cttccgttac ac 22

<210> 72

<211> 25

<212> DNA

<213> artificial sequence

<400> 72

atgcgaattt cgtttttgcg ttagg 25

Claims

1. The application of a reagent for detecting the methylation level of at least one of IRF4 gene partial areas 1-24 in preparing a gastric cancer diagnostic kit;

the partial region includes:

b) Other regions comprising a) methylation sites in regions 1-24.

2. The use according to claim 1, wherein the reagent is used for detecting the target area by one or more of the following methods:

3. The use of claim 2, wherein the reagent comprises a primer and probe combination product, and the primer and probe combinations corresponding to the regions 1-24 are sequentially represented by SEQ ID NO:1 to 3, SEQ ID NO:4 to 6, SEQ ID NO:7 to 9, SEQ ID NO:10 to 12, SEQ ID NO:13 to 15, SEQ ID NO:16 to 18, SEQ ID NO:19 to 21, SEQ ID NO:22 to 24, SEQ ID NO:25 to 27, SEQ ID NO:28 to 30, SEQ ID NO:31 to 33, SEQ ID NO:34-36, SEQ ID NO:37 to 39, SEQ ID NO:40-42, SEQ ID NO:43-45, SEQ ID NO:46 to 48, SEQ ID NO:49-51, SEQ ID NO:52 to 54, SEQ ID NO:55-57, SEQ ID NO:58-60, SEQ ID NO:61-63, SEQ ID NO:64-66, SEQ ID NO:67 to 69, SEQ ID NO:70 to 72.

4. The use of claim 3, wherein the reagent further comprises primers and probes for detecting reference nucleic acid.

5. The use of claim 4, wherein the reference nucleic acid is β -Actin gene or a fragment thereof.

6. The use of any one of claims 3 to 5, wherein the probes are self-quenching probes.

7. The use of any one of claims 3 to 5, wherein the reagents further comprise DNA extraction reagents, amplification buffer, dNTPs, mg ²⁺ At least one of a DNA polymerase, a positive control, a negative control, water, and a sulfite sequencing reagent.

8. Use according to any one of claims 1 to 5, wherein the reagent is for detecting the methylation level of at least one of the IRF4 gene regions 10, 11, 12, 21 and 22.

9. The use according to any one of claims 1 to 5, wherein the sample to be tested in the gastric cancer diagnostic kit is a tissue lysate, a blood sample or a stool sample.

10. A primer and probe combination as defined in any one of claims 3 to 6.

11. A kit comprising a reagent as defined in any one of claims 3 to 7.