CN115927602A

CN115927602A - Application of methylated CpG sites and kit

Info

Publication number: CN115927602A
Application number: CN202211724395.0A
Authority: CN
Inventors: 龚春梅; 洪文旭; 杨慧; 徐远飞; 胡黎明; 李雅琪; 彭爱宇
Original assignee: Shenzhen Chronic Disease Prevention And Control Center Shenzhen Skin Disease Prevention And Control Institute Shenzhen Lung Disease Prevention And Control Institute
Current assignee: Shenzhen Chronic Disease Prevention And Control Center Shenzhen Skin Disease Prevention And Control Institute Shenzhen Lung Disease Prevention And Control Institute
Priority date: 2022-12-30
Filing date: 2022-12-30
Publication date: 2023-04-07
Anticipated expiration: 2042-12-30
Also published as: CN115927602B

Abstract

The application relates to the technical field of biomedical detection, and provides an application of a methylated CpG locus and a kit. The application relates to an application of a methylated CpG locus as a biomarker for diagnosing and/or prognostically evaluating diabetic retinopathy, wherein the methylated CpG locus is selected from any one or more than two of the following methylated CpG loci as the biomarker: chr18:75209739, chr18:75209656, chr18:75211921, chr18:75211929, chr18:75211936, chr18:75211939, chr18:75211952, chr18:75211955, chr18:75212006, chr18:75212008, chr18:75208861, and Chr18:75208794.

Description

Application of methylated CpG sites and kit

Technical Field

The application belongs to the technical field of biomedical detection, and particularly relates to application of a methylated CpG locus and a kit.

Background

Diabetes mellitus is a chronic metabolic disease caused by multiple causes and is one of the chronic diseases with the fastest growing prevalence rate in the 21 st century. The diabetic patients have microangiopathy of each organ of the whole body due to abnormal insulin metabolism. Diabetes is statistically the most complicated disease, and is as high as 100. Clinical data show that about 10 years after the diabetes mellitus happens, 30-40% of patients can have at least one complication, once the complication is generated, the drug treatment is difficult to reverse, and therefore the diabetes mellitus can be prevented and controlled as soon as possible while the diabetes mellitus is prevented and treated.

Diabetic Retinopathy (DR) is the most characteristic microvascular complication of diabetes, and is the leading cause of blindness and blindness in the elderly. Diabetic retinopathy is classified into non-proliferative retinopathy and proliferative retinopathy. The proliferative diabetic retinopathy is also defined as diabetic retinopathy threatening vision, is easy to cause vision loss, and reduces the life quality of patients. Therefore, early detection and intervention are of great clinical significance.

The pathogenesis of the diabetic retinopathy is unknown, and no effective cure method exists at present. DR can effectively improve vision prognosis through early screening, early discovery, and early intervention. The current early screening means mainly comprises blood sugar and glycosylated hemoglobin level measurement and regular fundus examination, but the compliance of patients is low because the patients need to be admitted to hospital regularly for examination, so that the early screening and early diagnosis of DR face huge challenges and become the main burden of hygiene prevention and control in China. Therefore, active search for factors for early diagnosis of DR is a major and urgent issue in the prevention and treatment of diabetic retinopathy at present.

Disclosure of Invention

The application aims to provide a methylated CpG locus related to diabetic retinopathy and application thereof, and aims to solve the problem that the technology for early diagnosis of diabetic retinopathy cannot be effectively realized at present.

In order to achieve the purpose of the application, the technical scheme adopted by the application is as follows:

in one aspect, the present application provides a methylated CpG site as a biomarker for diagnosing and/or prognostically assessing diabetic retinopathy. The methylated CpG sites are derived from the TSHZ1 gene, and are selected from any one or the combination of more than two of the following methylated CpG sites as biomarkers: chr18:75209739, chr18:75209656, chr18:75211921, chr18:75211929, chr18:75211936, chr18:75211939, chr18:75211952, chr18:75211955, chr18:75212006, chr18:75212008, chr18:75208861, and Chr18:75208794.

In another aspect of the application, a primer for detecting methylated CpG sites. The methylated CpG sites are the methylated CpG sites of the application; wherein, the upstream primer of Chr18:75209739 and/or Chr18:75209656 is SEQ ID No.1, and the downstream primer is SEQ ID No.2;

the upstream primer of Chr18:75211921 and/or Chr18:75211929 and/or Chr18:75211936 and/or Chr18:75211939 and/or Chr18:75211952 and/or Chr18:75211955 and/or Chr18:75212006 and/or Chr18:75212008 is SEQ ID No.3, and the downstream primer is SEQ ID No.4;

the upstream primer of Chr18:75208861 and/or Chr18:75208794 is SEQ ID No.5, and the downstream primer is SEQ ID No.6.

And the application of the reagent for detecting the methylation level of the methylated CpG sites in the preparation of products for early diagnosis and/or prognosis evaluation of diabetic retinopathy, wherein the methylated CpG sites are the methylated CpG sites of the application.

And a kit for early diagnosis and/or prognosis evaluation of diabetic retinopathy. The kit comprises a reagent for detecting the methylation level of the methylated CpG sites, and the methylated CpG sites are the methylated CpG sites of the application.

Experimental analysis proves that the methylation of the TSHZ1 genes of diabetic retinopathy patients and diabetic patients is different, 12 differential methylation sites exist on the TSHZ1 genes of the diabetic retinopathy patients, and the methylation level of the 12 CpG sites is lower than that of a diabetic group. Therefore, according to the application, through 12 methylated CpG sites on the TSHZ1 gene, SNPs related to TSHZ1 differential methylated sites can be found, so that diagnosis and prognosis biomarkers of diabetic retinopathy patients can be found, and sensitivity and specificity of diabetic retinopathy diagnosis are greatly improved. The methylated CpG locus markers are closely related to diabetic retinopathy, dynamic monitoring of disease progress of patients with diabetic retinopathy can be realized by detecting the methylated CpG locus markers, evaluation of treatment effect is facilitated, and scientific basis is provided for doctors to rapidly and accurately master disease conditions of patients and timely adopt more individualized and accurate treatment schemes.

The application designs related primers capable of specifically detecting the methylated CpG sites based on the methylated CpG sites, has high specificity to the corresponding TSHZ1 gene of the application, can be used for quantitatively and accurately detecting, and provides a product for early diagnosis and/or prognosis evaluation of diabetic retinopathy through methylation analysis, so that the early diagnosis of the diabetic retinopathy is realized, and a new thought and way is provided for the prediction of the diabetic retinopathy.

The application provides a kit for early diagnosis and/or prognosis evaluation of diabetic retinopathy, and the kit can perform early diagnosis, diagnosis and prognosis evaluation on whether diabetic patients suffer from retinopathy at an early stage by detecting the methylation level of the methylated CpG sites, so that a basis is provided for further and deep inspection of clinicians, and support is provided for rapidly and accurately mastering the disease state and the disease severity of the patients and taking treatment measures in time.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a study route for differential methylation sites in patients with diabetic retinopathy provided by the examples of the present application;

FIG. 2 is a flow chart of the detection of methylation levels at CpG sites provided in the examples herein;

FIG. 3 is a graph of the results of TSHZ1-7 methylation levels for different genotypic populations provided in the examples of this application.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present application more clearly apparent, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are merely illustrative of and not restrictive on the broad application.

In this application, the term "and/or" describes an association relationship of associated objects, meaning that there may be three relationships, e.g., a and/or B, which may mean: a alone, A and B together, and B alone. Wherein A and B can be singular or plural. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.

In this application, "at least one" means one or more, "a plurality" means two or more. "at least one of the following" or similar expressions refer to any combination of these items, including any combination of the singular or plural items. For example, "at least one (one) of a, b, or c," or "at least one (one) of a, b, and c," may each represent: a, b, c, a-b (i.e., a and b), a-c, b-c, or a-b-c, wherein a, b, and c may be single or plural, respectively.

It should be understood that, in various embodiments of the present application, the sequence numbers of the above-mentioned processes do not mean the execution sequence, some or all of the steps may be executed in parallel or executed sequentially, and the execution sequence of each process should be determined by its function and inherent logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.

The terminology used in the embodiments of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in the examples of this application and the appended claims, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

The weight of the related components mentioned in the description of the embodiments of the present application may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, the content of the related components is scaled up or down within the scope disclosed in the description of the embodiments of the present application as long as it is scaled up or down according to the description of the embodiments of the present application. Specifically, the mass described in the specification of the embodiments of the present application may be a mass unit known in the chemical industry field such as μ g, mg, g, kg, etc.

The terms "first" and "second" are used for descriptive purposes only and are used for distinguishing purposes such as substances from one another, and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature.

In a first aspect, the embodiments of the present application provide a use of methylated CpG sites as a biomarker for the diagnosis and/or prognostic evaluation of diabetic retinopathy. The methylated CpG sites are derived from TSHZ1 genes, and the methylated CpG sites are selected from any one or a combination of more than two of the following methylated CpG sites as biomarkers: chr18:75209739, chr18:75209656, chr18:75211921, chr18:75211929, chr18:75211936, chr18:75211939, chr18:75211952, chr18:75211955, chr18:75212006, chr18:75212008, chr18:75208861, and Chr18:75208794.

Experimental analysis proves that the methylation of the TSHZ1 gene of a diabetic retinopathy patient and a diabetic patient has difference, 12 differential methylation sites exist on the TSHZ1 gene of the diabetic retinopathy patient, and the methylation level of the 12 CpG sites is lower than that of a diabetic group. Therefore, the application can find SNPs related to TSHZ1 differential methylation sites through 12 methylation CpG sites on the TSHZ1 gene, further find diagnosis and prognosis biomarkers of diabetic retinopathy patients, and greatly improve the sensitivity and specificity of diabetic retinopathy diagnosis. The methylated CpG locus markers are closely related to diabetic retinopathy, and the detection of the methylated CpG locus markers can dynamically monitor the disease progress of patients with diabetic retinopathy, is beneficial to the evaluation of treatment effect, and provides scientific basis for doctors to quickly and accurately master the disease condition of patients and timely adopt more individualized and accurate treatment schemes.

In some embodiments, the meQTL for the methylated CpG site Chr18:75211952 includes rs1132845, rs11307633 and rs7237736.

Specifically, according to the research, the 3 SNP loci have no direct association with diabetic retinopathy, but are related to the methylation level of the TSHZ1 gene.

In a second aspect of the embodiments herein, primers are provided for detecting methylated CpG sites. The methylated CpG sites are the methylated CpG sites of the application; wherein, the upstream primer of Chr18:75209739 and/or Chr18:75209656 is SEQ ID No.1, and the downstream primer is SEQ ID No.2;

The primer for methylation test of TSHZ1 gene has high specificity to the corresponding TSHZ1 gene on the basis of the performance of general primers.

Specifically, the TSHZ1 gene has 3 CpG islands and 86 CpG sites, wherein the CGI-1 comprises 253 basic groups and 31 CpG sites; CGI-2 comprises 161 bases, 21 CpG sites; CGI-3 contains 253 bases and 34 CpG sites.

Chr18:75209739 and Chr18:75209656 are positioned on CGI-1, wherein the nucleotide sequence of CGI-1 is shown in SEQ ID No.7, and the underlined bases are CpG sites.

SEQ ID No.7：

GGGTTCCGGGGACAGGAAGCCACCAGCCTGGGGAGCGGGAGGCACTGGACATTTCCCCGCCCCGCGGTCGGTACGGGTGCGCGTGCGGCAGCGGCGGCAGGGGCTCCCCGCCCTGCCCGGGGTCCCCGGTCGTGCCCCGCCGCCCGGGCCGCGCTCGGGGTTGATTCGTACCACCTTGCAAGGAAGTGAACGCTTCGCACGGGAAGGGGAGGCGCCTGCGCCGGCCGCCGCGCAGCTCCGGGGACGCCCGGGG。

The upstream primer SEQ ID No.1: GGGTTTYGGGGATAGGAAGTTATT.

The downstream primer SEQ ID No.2: cccacarccccaactac.

The Chr18:75211921, the Chr18:75211929, the Chr18:75211936, the Chr18:75211939, the Chr18:75211952, the Chr18:75211955, the Chr18:75212006 and the Chr18:75212008 are positioned on the CGI-2, wherein the nucleotide sequence of the CGI-2 is shown as SEQ ID No.8, and underlined bases are CpG sites.

SEQ ID No.8：

TGCCGAGGAGGAAGCAGCAGGCCCCCCGGCGCTCGGCAGGTAACGGGCGCGCGGCCCGCGCCGGGGAGTGGGCGCCGGGAGGAGCAGGAGGAGGGGGCTTCGCGGGCCGAGGTGCGGGACGTGGGCCGCGGGCCGCCCCAAGCTGGGGAGGGGAGGCCC。

The upstream primer SEQ ID No.3: TGTYGAGGAGGAAGTAGTAGTTT.

The downstream primer SEQ ID No.4: AAACCTCCCTCCCCAACT.

Chr18:75208861 and Chr18:75208794 are located on CGI-3, wherein the nucleotide sequence of CGI-3 is shown as SEQ ID No.9, and the underlined bases are CpG sites.

SEQ ID No.9：

GGGACTGCCCGGTGCCGCTCCCCGGGGACGGAGACCTCCTCGTCCGGAACCGGTGAGCCCGGCGCCCCCCAACCCCACGCCCCCGTTCTCGCCCCGGGCT CGCGCCGCGCCGCGCCGCTCCCGCAGTCCCCAGCCCGCCCGCGTGCCCACACTCCGGCGCGCGCTCGGGCGCACAGCCTGAGTTTGCGAGATCCCGGGAAGTTGAACCCGCCGCCATCTGGCGAAGGCGAATGTGATGTGACTGTTGCTGGTG。

The upstream primer SEQ ID No.5: GGGATTGTTYGGGTGTYGTTT.

The downstream primer SEQ ID No.6: caccaacaacatca, acatcaca.

In a third aspect of the embodiments of the present application, there is provided a use of a reagent for detecting methylation level of methylated CpG sites in the preparation of a product for early diagnosis and/or prognosis evaluation of diabetic retinopathy. Because the methylated CpG sites have the advantages and effects, the reagent for detecting the methylation level of the methylated CpG sites can be used for preparing products for early diagnosis and/or prognosis evaluation of diabetic retinopathy. Among these, the products are understood to be related products that can be developed using the methylation levels of the above-mentioned specific methylated CpG site markers and the advantages and effects thereof as described above.

In some embodiments, the product for early diagnosis and/or prognosis of diabetic retinopathy further comprises a primer for detecting methylated CpG sites, wherein the primer is a primer of the embodiments of the present application.

In some embodiments, an early diagnosis and/or prognosis evaluation product for diabetic retinopathy comprises an early diagnosis reagent, an early diagnosis kit, a prognosis evaluation reagent, or a prognosis evaluation kit.

In a fourth aspect, the present application provides a kit for the early diagnosis and/or prognosis evaluation of diabetic retinopathy. The kit comprises a reagent for detecting the methylation level of the methylated CpG sites, and the methylated CpG sites are the methylated CpG sites of the application.

In some embodiments, the kit further comprises a primer for detecting methylated CpG sites, the primer being a primer of the embodiments of the present application.

Based on the methylation level of the methylated CpG sites and the primers designed according to the methylated CpG sites, the kit provided by the embodiment of the invention can provide a basis for deep examination of clinicians, and provide support for rapidly and accurately mastering the disease state and the disease severity of patients and timely taking treatment measures.

The following description is given with reference to specific examples.

Example 1

The research route of the differential methylation sites of the diabetic retinopathy patients provided by the embodiment of the application is shown as the attached figure 1. The method comprises the following specific steps:

1. the study subjects were:

the research objects of the research are all from the prevention and treatment center of chronic diseases in Shenzhen city, the case group is from the cases of diabetic retinopathy in different communities in Shenzhen city, the diabetic patients without retinal complications are taken as the control group, and the distribution of the age, sex and course of disease of the case group and the control group is kept consistent. Clinical information and blood samples were collected from all subjects.

1.1 case group inclusion exclusion criteria:

inclusion criteria were: age 18-90 years, according to the standard of Chinese guidelines for the prevention and treatment of type 2 diabetes (2017 edition): (1) Typical diabetes symptoms exist, and random blood sugar is more than or equal to 11.1mmol/L; (2) fasting blood glucose is more than or equal to 7.0mmol/L; (3) The blood sugar of Oral Glucose Tolerance Test (OGTT) 2h is more than or equal to 11.1mmol/L; patients with no typical diabetes symptoms after 2 hours of glucose load need to be checked and confirmed again. Patients who have been diagnosed with T2 diabetes, a previous history of diabetes, or are taking hypoglycemic agents, have impaired vision, and are diagnosed with a diabetic network by fundoscopy, fundus Fluorescence Angiography (FFA), or Optical Coherence Tomography (OCT); has perfect basic data and clinical data, and collects blood samples.

Exclusion criteria: patients with diabetic foot, diabetic nephropathy and macular edema, patients with other eye diseases or eye surgery history, malignancies, severe liver and kidney insufficiency, psychiatric disorders and alcoholism or drug abuse.

1.2 inclusion of control group exclusion criteria:

inclusion criteria were: age 18-90 years, diagnosed with T2 diabetes (diagnostic criteria above), no retinopathy, age, sex, course of diabetes matched the frequency of patients in the comparative case group. Has perfect basic data and clinical data, and collects blood samples.

Exclusion criteria: patients with diabetic microvascular complications, malignancies, severe liver and kidney dysfunction, psychiatric disorders and alcoholism or drug abuse.

2. Questionnaire survey

Demographic information (sex, age, race, marital status, work lifestyle, etc.), anthropometric data (height, weight, waist circumference, etc.), laboratory test data (fundus examination, biochemical indicator test, blood glucose level, hbA1c, etc.), diabetes course, disease history (hypertension, liver and kidney diseases, cardiovascular and cerebrovascular disease history, etc.), medication history, and lifestyle data (whether to smoke, drink, and frequency, average number of weekly exercises, and time of each exercise, etc.) of the patient are collected using a questionnaire method.

Smoking: smoking is prescribed for one or more cigarettes per day and more than one year of smoking.

Drinking: the average intake of alcohol is 50ml or more per week, and the drinking time lasts more than half a year.

Hypertension: the Systolic Blood Pressure (SBP) is more than or equal to 140mmHg and/or the Diastolic Blood Pressure (DBP) is more than or equal to 90mmHg; or has a history of hypertension, or is administered with antihypertensives.

Blood pressure measurement: the blood pressure was measured with a cuff-type electronic sphygmomanometer. After the testee is rested for 15 minutes at room temperature, the upper arm is stretched on a horizontal plane and keeps the same level with the heart, the clothes on the tested arm are taken off, the upper arm is exposed, the cuff is placed at the pulse point of the brachial artery, the bottom of the cuff is about 1-2cm higher than the elbow, and the tightness of the cuff is preferably enough to be inserted into a finger. And starting the electronic sphygmomanometer, and reading the measurement value after the reading is stable. The measurements were taken 3 times and averaged.

Body Mass Index (Body Mass Index, BMI) = weight/height ² In units of kg/m ² 。

3. Sample collection and preservation

All the testees are fasted for more than 12h, and 5ml of fasting peripheral venous blood is collected by a vacuum blood collection tube from morning, centrifugally subpackaged, numbered and marked, and labeled and stored in a refrigerator at 80 ℃ for later use.

4. Detection of biochemical indexes: the detection of biochemical indicators such as glycated hemoglobin (HbA 1C), fasting Plasma Glucose (FPG), total Cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), and high-density lipoprotein cholesterol (HDL-C) is measured by a Beckman-20 full-automatic biochemical analyzer.

Methylation detection of TSHZ1 Gene

(1) DNA extraction: DNA was extracted using a blood genomic DNA extraction kit (centrifugal column type) purchased from OMEGA.

The DNA extraction steps are as follows:

1) Taking out the blood sample from a refrigerator at-80 deg.C, and thawing on ice;

2) The thawed blood sample is inverted and mixed evenly, and 250 mu l of the blood sample is transferred into a centrifuge tube of 1.5ml by using a micro-pipette;

3) Adding 25 mul OB and 250 mul BL Buffer into a centrifuge tube by using a micro pipette, and placing the centrifuge tube into a shaking and mixing machine to mix for 15 seconds;

4) Placing the sample at 65 ℃ for incubation for 10 minutes, and performing vortex shaking for several times in the incubation process;

5) Adding 260 mu l of absolute ethyl alcohol into a centrifuge tube, and carrying out vortex oscillation for 20 seconds;

6) Centrifuging for a short time, and centrifuging the liquid on the cover of the centrifuge tube to the bottom;

7) Inserting the DNA filter column into a 2ml collection tube;

8) Transferring the sample to a DNA filter column, centrifuging at 14000g for 1 minute;

9) Pouring off the filtrate and the collection tube, and transferring the DNA filter column to a new collection tube of 2 ml;

10 Mu.l of HBC Buffer was added to the filtration column;

11 Centrifuging at 14000g for 1 minute;

12 The filtrate is poured off and the collecting tube is used continuously;

13 700 mul of DNA Wash Buffer was added to the filter column and centrifuged at 14000g for 1 minute;

14 The filtrate is poured off and the collecting tube is used continuously;

15 700 mul of DNA Wash Buffer was added to the filter column, centrifuged at 14000g for 1 min;

16 The filtrate and collection tube were decanted, the DNA filter column was transferred to a new 2ml collection tube and centrifuged at 14000g for 2 minutes;

17 Transfer the DNA filter column to a new 1.5ml EP tube;

18 50 μ l of 65 ℃ Elution Buffer was added;

19 ) at room temperature for 5 minutes;

20 Centrifuging at 14000g for 1 minute;

21 Repeating 18-20 steps;

22 DNA was collected and marked by number, -20 ℃ refrigerator was kept for future use.

(2) And (3) detecting whether the DNA sample is successfully extracted by using an agarose gel electrophoresis method. The specific operation steps are as follows:

1) Weighing 2g of agarose powder, adding 100ml of 1 XTAE buffer solution, placing the agarose powder into a conical flask, gently shaking and mixing the agarose powder and the conical flask, placing the conical flask into a microwave oven to heat until agarose is completely melted, shaking the agarose powder evenly to prepare a 2.0% agarose gel solution. After the agarose gel solution was cooled to about 65 ℃, 8. Mu.l of Ethidium Bromide (EB) solution was added and mixed well.

2) Cleaning the gel making groove, putting the cleaned gel making groove into a glass plate, inserting a comb, and slowly and uniformly pouring the agarose gel solution into the gel making groove. And cooling at room temperature until the gel is completely solidified, and vertically taking down the comb. The gel was placed in an electrophoresis tank together with a gel preparation tank, and 1 × TAE electrophoresis buffer was added to the electrophoresis tank and passed through a gel plate.

3) The DNA sample and 10 × loading buffer were mixed on the spotting plate, and then the mixture was added to the wells of the gel plate using a pipette.

4) Electrophoresis was performed immediately after completion of sample application. Constant voltage 100V electrophoresis for 30 minutes.

5) After electrophoresis was completed, the results were observed using a ChemiDoc XRS + DEMO gel imaging system.

(3) Detection of genomic DNA concentration and purity

The purity of the genomic DNA was measured by a micro-UV spectrophotometer. First, the instrument was zeroed using the Elution Buffer solution. After zero setting, wiping the solution Buffer by using a lens wiping paper, and then respectively testing the DNA of the sample to be tested. And (3) measuring the absorbance of the DNA at the wavelengths of 260nm and 280nm by using a micro ultraviolet spectrophotometer, and reading the ratio of the absorbance of the DNA at the wavelengths of 260nm and 280nm, namely the ratio of OD260/OD280, wherein when the ratio of OD260/OD280 of the genomic DNA is in the range of 1.7-1.9, the purity of the sample is high. The ratios of OD260/OD280 of the extracted genomic DNA in the experiment are all in the range of 1.7-1.9, and the requirements of the subsequent experiment are met. Then, the final concentration of the genomic DNA was adjusted to 20 ng/. Mu.l or more, and the genomic DNA was stored in a refrigerator at-20 ℃ for further use.

(4) The methylation level of a specific CpG locus is detected by utilizing a multiple PCR (polymerase chain reaction) patent technology and a Methyltarget technology developed by a sequencing platform, and the specific detection work is finished by sky Hao biology (Shanghai) Limited company. The detection flow chart is shown in figure 2.

Determination of meQTL and SNP typing

(1) Searching the meQTL corresponding to the TSHZ1 gene through GTEx to obtain SNPs which can possibly regulate and control TSHZ1 methylation.

(2) SNP typing was done by sky Hao biology (Shanghai) Inc. The specific experimental steps are as follows: (1) designing a primer of the SNP locus according to the target locus; (2) completing the synthesis and dilution of the primer; (3) extracting DNA; (4) performing multiplex PCR amplification reaction; (5) SAP purification reaction; (6) single base extension reaction; (7) purifying the resin; (8) detecting on a machine; (9) and (6) collecting data.

7. Data analysis

(1) Statistical analysis of general data

The distribution of variables such as demographics, anthropometry, examination and life behavior patterns in a case group and a control group is described, continuous variables are expressed by mean +/-standard deviation, independent sample t test or t' test is adopted for comparison, and data which do not accord with normal distribution are converted or analyzed by rank sum test. The categorical variables are expressed as percentages (%) and compared using the chi-square test or Fisher's exact probability method. The software used SPSS25.0.

(2) Methylation level analysis

The degree of methylation of CpG sites is expressed in% as mean. + -. Standard deviation. CpG sites were correlated using the traditional t-test calibrated by Bonferroni. The methylation levels of the case group and the control group were compared using t or t' test. The software used SPSS25.0.

(3) Correlation analysis of meQTLs and DR

The genotype distribution in the control group was checked for Hardy-Weinberg genetic equilibrium law (HWE) with Arlequin software (version 3.5), which was judged to be satisfied when P > 0.05. The SNP sites were analyzed for linkage disequilibrium using PLINK software (version 2.0). The relevance of the meq TLs to DR was analyzed by SNPstat (https:// www.snpstats.net/start.htm).

(4) Correlation analysis of methylation level, meQTLs and DR

Adopting SPSS25.0 software, taking methylation level and meQTLs as independent variables, and carrying out multi-factor Logistic regression analysis on whether retinopathy is caused as dependent variable, wherein covariates comprise age, sex, disease course length, blood sugar, blood fat, blood pressure, medication history and the like. (if not otherwise stated, all P values represent bilateral probabilities, test level α = 0.05)

8. Quality control

(1) Subjects were selected strictly according to inclusion and exclusion criteria.

(2) Questionnaire survey quality control:

comprehensively collecting relevant documents and data, consulting expert opinions, and scientifically designing questionnaires; extracting 10 research objects to perform a pre-experiment, and perfecting the content and structure of a questionnaire; carrying out systematic training on an investigator before investigation, knowing the questionnaire content and improving the investigation skill of the investigator, examining the questionnaire in time during investigation, extracting 10-20% of the questionnaire for rechecking, and coding and recording after investigation; strict checks and logistic checks are performed on questionnaire survey data. Questionnaire survey data were entered in the epidata3.0 software using two persons and were checked for consistency.

(3) Collecting, subpackaging, transporting and storing the blood sample according to a standardized flow.

9. Data analysis results

The results of methylation levels of the case group and the control group are shown in table 1 below.

TABLE 1 methylation levels of TSHZ1 and its differentially methylated sites

As can be seen from table 1, 12 TSHZ1 sites and TSHZ1 genes both show: the methylation level in the case group was lower than that in the control group, and the difference was significant by t-test (P was less than 0.05).

The results of the TSHZ1-7 methylation levels in the different genotype groups are shown in FIG. 3. Three SNPs associated with TSHZ1-7 are shown in FIG. 3, with the methylation levels of human TSHZ1-7 of different genotypes. There are differences in methylation levels for three different genotypes, e.g. rs7237736: the methylation levels of TSHZ1-7 sites were compared among persons carrying GG, GT and TT genotypes, and compared among groups, the methylation levels of the three groups were significantly different, with p < 0.05.

The positional information of SNPs and the types of SNP sites are shown in Table 2.

TABLE 2

In table 2:

region represents the Region in which a variation of a SNP is located, where: "3Prime UTR Variant" indicates a 3' untranslated region variation; "Intron Variant" indicates a variation of an Intron region.

Allees denotes the content of the variation, wherein: "C > G/C > T" means that the original site is C, becoming G or T; "delC" indicates that the original site is C, and after mutation, the C site is deleted; "G > A/G > T" indicates that the original site is G, which is changed to A or T.

Variance Type represents the Type partitioning of the Variation, where: "SNV" means single nucleotide variation; "Indel" means an insertion or deletion variant.

The results of the correlation analysis of methylation levels, meQTLs and DR are shown in Table 3 below.

TABLE 3

The results of the analysis of the three gene models (additive/dominant/invisible) in table 3 show that the P-value in all models is greater than 0.05, indicating that there is no direct association between 3 SNP sites and diabetic retinopathy.

The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. Use of methylated CpG sites as a biomarker for the diagnostic and/or prognostic assessment of diabetic retinopathy, wherein the methylated CpG sites are derived from the TSHZ1 gene and are selected from any one or a combination of two or more of the following methylated CpG sites as a biomarker: chr18:75209739, chr18:75209656, chr18:75211921, chr18:75211929, chr18:75211936, chr18:75211939, chr18:75211952, chr18:75211955, chr18:75212006, chr18:75212008, chr18:75208861, and Chr18:75208794.

2. The use of claim 1, wherein the meQTL of the methylated CpG site Chr18:75211952 comprises rs1132845, rs11307633 and rs7237736.

3. A primer for detecting a methylated CpG site, wherein the methylated CpG site is the methylated CpG site of claim 1; wherein, the upstream primer of the Chr18:75209739 and/or the Chr18:75209656 is SEQ ID No.1, and the downstream primer is SEQ ID No.2;

the upstream primer of the Chr18:75211921 and/or the Chr18:75211929 and/or the Chr18:75211936 and/or the Chr18:75211939 and/or the Chr18:75211952 and/or the Chr18:75211955 and/or the Chr18:75212006 and/or the Chr18:75212008 is SEQ ID No.3, and the downstream primer is SEQ ID No.4;

the upstream primer of Chr18:75208861 and/or the Chr18:75208794 is SEQ ID No.5, and the downstream primer is SEQ ID No.6.

4. The application of a reagent for detecting the methylation level of methylated CpG sites in preparing a product for early diagnosis and/or prognosis evaluation of diabetic retinopathy is characterized in that: the methylated CpG sites are the methylated CpG sites of claim 1.

5. The use of claim 4, wherein the early diagnostic and/or prognostic assessment product further comprises a primer for the detection of methylated CpG sites, said primer being as defined in claim 3.

6. The use according to claim 4, wherein the early diagnosis and/or prognosis evaluation product comprises an early diagnosis reagent, an early diagnosis kit, a prognosis evaluation reagent or a prognosis evaluation kit.

7. A kit for early diagnosis and/or prognostic evaluation of diabetic retinopathy, comprising a reagent for detecting the methylation level of a methylated CpG site, wherein the methylated CpG site is the methylated CpG site of claim 1.

8. The kit of claim 7, further comprising a primer for detecting methylated CpG sites, wherein the primer is the primer of claim 3.