CN115927539A - Target nucleic acid enrichment method and kit and application thereof - Google Patents

Abstract

The invention discloses a target nucleic acid enrichment method. The method comprises (1) mixing Tzhargonaute endonuclease and front end endonuclease DNA guide strand, incubating to obtain front end endonuclease DNA guide strand-endonuclease complex, mixing Tzhargonaute endonuclease and back end endonuclease DNA guide strand, incubating to obtain back end endonuclease DNA guide strand-endonuclease complex; (2) Carrying out mixed enzyme digestion on a nucleic acid substrate containing target nucleic acid, the front end endoDNA guide strand-endonuclease complex obtained in the step (1) and the rear end endoDNA guide strand-endonuclease complex obtained in the step (1) to obtain a front end endoDNA guide strand combined with the target nucleic acid; (3) And (3) mixing the magnetic beads with the front end endoDNA guide strand obtained in the step (2) to obtain the magnetic beads combined with the front end endoDNA guide strand, so as to realize the enrichment of the target nucleic acid. The target nucleic acid enrichment method provided by the invention has the advantages of higher specificity, better enrichment efficiency and shorter enrichment time.

Description

Target nucleic acid enrichment method and kit and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a target nucleic acid enrichment method, a kit and application thereof.

Background

There are three common techniques for selectively capturing target nucleic acid molecules in a sample.

The first technique is hybrid capture, which captures the target molecule by hybridization that selectively binds to the surface of a capture probe. The capture may remove non-target molecules followed by collection and release of the captured target molecules. This type of technique has the following advantages: including the ability to capture regions of exome size and to contain regions of unknown structural variation. The disadvantage is that the solution is too cumbersome, often taking more than 8 hours to complete the enrichment of the target molecule. Complexity is mainly due to the need to prepare randomly fragmented shotgun libraries prior to hybridization. A single hybridization step may take three days to complete. Examples of this type of technology include SeqCap EZ (NimbleGen, madison, wisc.) and SureSelect target enrichment system (Agilent, santa Clara, cal.).

The second method is based on amplification of dual target primers. In this method, two probes are used on the edges of both sides of the target molecule to enrich the target region. The method can be completed within 8 hours and is simpler than the hybrid capture method. However, the dual primer based techniques are unable to enrich for sequences with unknown structural variations. The most mature dual primer method is multiplex PCR. This is a very simple single process, but only tens of targets can be amplified in each reaction tube. Other newer Technologies are currently available, including TruSeq amplification (Illumina, san Diego, cal.) and Ion Torrent amplification (Life Technologies, grand Island, NY) products, which are capable of amplifying hundreds to thousands of targets in a single reaction tube and require only a few processing steps.

A third technique is amplification based on single target primers. In this method, the target is enriched by amplifying a region defined by a single target primer and an end-linked universal primer. Similar to hybridization-based methods; these techniques require the generation of randomly fragmented shotgun libraries prior to selective hybridization of target molecules. However, this method does not capture the target molecules by using oligonucleotide primers and wash away non-target molecules; instead, amplification is performed by random amplification, and the amplified product has a sticky end that can bind to an oligonucleotide that is specifically recognized by a target. This technique has the advantage that, unlike the double primer technique, it allows the detection of a primer with unknown structural variationAnd (4) sequencing. It is faster and simpler than hybridization-based techniques. However, this type of technique is still slower and more complex than the dual primer based approach. Examples of this type of technique are Archer's anchored multiplex PCR (Archer Dx, boulder, colo.) and

target enrichment system (NuGen, san Carlos, cal.).

In summary, the enrichment of the target molecule is divided into the enrichment of the known target molecule and the enrichment of the unknown target molecule. Higher specificity also means a decrease in the degree of containment; while higher containment also means that higher non-specificity will arise. The different solutions for selecting enrichment of targets also represent a difference in the direction of subsequent applications. For this reason, the prior art has not yet satisfied the desired requirements.

Disclosure of Invention

One of the objects of the present invention is to provide a method for enriching a target nucleic acid. The technical core of the method is based on a special endonuclease named Tth argonaute. As shown in FIG. 1, this enzyme is an editable endonuclease (TAgo argonaute in the figure) which functions as a DNA-mediated endonuclease by being guided by 5'phosphorylation single-stranded DNA (ssDNA in the figure, also called DNA guide strand) (16-18 nt) at the 5' end and cleaves a Nucleic acid substrate at bases complementary to the 10 th and 11 th bases of the DNA guide strand. Generally, the enzyme is mainly used for cutting a nucleic acid substrate, and subsequent experiments are carried out on a Target DNA tail tag generated after cutting, and the enzyme only has the capability of cutting the substrate and does not have the enrichment effect. On the basis of using the endonuclease, the invention gradually finishes substrate wrapping type specific cutting and specific enrichment of exposed targets after cutting by artificially setting the endonuclease guided by the front end/rear end endoDNA to the guide chain, marking biotin on the 3' end of the front end endoDNA to the guide chain and combining streptavidin modified magnetic beads.

The invention provides a target nucleic acid enrichment method, which comprises the following steps

(1) Mixing and incubating Tth argonaute endonuclease and a front-end endoDNA guide strand to obtain a front-end endoDNA guide strand-endonuclease complex, and mixing and incubating the Tth argonaute endonuclease and a rear-end endoDNA guide strand to obtain a rear-end endoDNA guide strand-endonuclease complex;

(2) Performing mixed enzyme digestion on a nucleic acid substrate containing target nucleic acid, the front end endoDNA guide strand-endonuclease compound obtained in the step (1) and the rear end endoDNA guide strand-endonuclease compound obtained in the step (1) to obtain a front end endoDNA guide strand combined with the target nucleic acid;

(3) Mixing the magnetic beads with the front end internal cutting DNA guide chain obtained in the step (2) to obtain magnetic beads combined with the front end internal cutting DNA guide chain, so as to realize the enrichment of target nucleic acid;

the front end endodna guide strand and the rear end endodna guide strand are single-stranded DNAs and 5' -phosphorylated, the front end endodna guide strand comprises a segment a and a segment B which are sequentially connected from 5' -end, the segment B is specifically combined with a 10-11nt adjacent segment at the 5' -end of the target nucleic acid, the segment a is specifically combined with a 5' -end segment of the target nucleic acid, the rear end endodna guide strand comprises a segment C and a segment D which are sequentially connected from 5' -end, the segment C is specifically combined with a 10-11nt segment at the 3' -end of the target nucleic acid, and the segment D is specifically combined with a 3' -adjacent segment of the target nucleic acid;

modifying a biotin group at the 3' end of the guide chain by the front end internal cutting DNA;

the surface of the magnetic bead is modified with streptavidin combined with biotin groups.

In the step (2), the front-end endodna guide strand-endonuclease complex and the back-end endodna guide strand-endonuclease complex direct the Tth argonaute endonuclease to cleave on the nucleic acid substrate, and a front-end endodna guide strand that binds to the target nucleic acid is obtained. In this case, the 5 'end of the target nucleic acid is complementarily ligated to the 10nt position of the forward-end endonuclease DNA in the 3' -5 'direction of the guide strand, the target nucleic acid is ssDNA/ssRNA, and the 3' end should contain a target DNA/RNA tail.

For known target nucleic acid enrichment, a front-end endoDNA guide strand and a rear-end endoDNA guide strand which are complementary to a target nucleic acid sequence can be directly designed for capture, cutting and enrichment. For unknown target nucleic acid enrichment, a 16N sequence can be used as a front end endoDNA guide chain and a rear end endoDNA guide chain for capture, cutting and enrichment. For the enrichment of mRNA sequence, the front end internal cutting DNA guide chain and the back end internal cutting DNA guide chain can be designed according to the specific polyA tail of mRNA to carry out capture cutting and enrichment.

Specifically, the Δ G value of the front-end internal DNA guide strand and the rear-end internal DNA guide strand is preferably as close to 0. The guide strand of the front-end restriction DNA and the guide strand of the rear-end restriction DNA are optimally controlled to 16 to 18nt.

For example, in the case of enrichment of the Rs1801133 fragment, the forward endoDNA guide sequence is ATCACGCAGCAGCTTTTCT (SEQ ID No. 1) and the rear endoDNA guide sequence is CGAAGCAGGGAGCTTT (SEQ ID No. 2).

For another example, when enrichment of the Ferma gene fragment from Staphylococcus aureus was carried out, the forward-end endo-DNA guide strand sequence was AAACAACTTCAAATGG (SEQ ID No. 3), and the rear-end endo-DNA guide strand sequence was AACTTCCGGCAAAATG (SEQ ID No. 4).

Alternatively, the incubation temperature in step (1) is 75 ℃ and the incubation time is 10-30 minutes according to the target nucleic acid enrichment method described above.

Alternatively, the front-end endodna guide strand length is 16-18nt, according to the target nucleic acid enrichment method described above; the length of the rear end incision DNA guide chain is 16-18nt.

Optionally, according to the target nucleic acid enrichment method, the enzyme cutting temperature in the step (2) is 65-85 ℃, and the enzyme cutting time is 10-60min.

Optionally, the method for enriching a target nucleic acid according to the above, further comprising:

(4) And (4) denaturing the target nucleic acid on the magnetic beads obtained in the step (3) and eluting to obtain free target nucleic acid.

Optionally, the nucleic acid substrate is DNA or RNA according to the target nucleic acid enrichment method described above. The nucleic acid substrate can be specifically nucleic acid extracted and purified by a kit or a nucleic acid amplification product.

The invention also provides a kit for enriching target nucleic acid, which comprises the Tth argonaute endonuclease, the front-end endoDNA guide chain, the rear-end endoDNA guide chain and the magnetic beads.

The invention also provides another kit for target nucleic acid enrichment, which comprises a front-end endoDNA guide strand-endonuclease complex, a back-end endoDNA guide strand-endonuclease complex and the magnetic beads,

the front end endonuclease DNA guide strand-endonuclease complex is obtained by mixing and incubating the front end endonuclease DNA guide strand and the Tth argonaute endonuclease,

the back-end endonuclease DNA-guide strand-endonuclease complex is obtained by mixing and incubating the back-end endonuclease DNA-guide strand and the Tth argonaute endonuclease.

The application of the kit also belongs to the protection scope of the invention. The application is any one of the following applications:

(1) Enriching target nucleic acid;

(2) DNA amplification;

(3) DNA sequencing;

(4) Preparing a target nucleic acid enrichment product;

(5) Preparing a DNA amplification product;

(6) Preparing DNA sequencing products.

The target nucleic acid enrichment method provided by the invention has the advantages of higher specificity, better enrichment efficiency and shorter enrichment time, reduces the costs related to amplification detection reaction, sequencing reaction and subsequent data analysis, and has extremely high specific cleavage activity and specific capture activity on target molecules.

Drawings

FIG. 1 shows the operation of Tth argonaute endonuclease.

FIG. 2 shows the working principle of cutting the target.

FIG. 3 is the working principle of enrichment of targets after cleavage.

FIG. 4 is the Rs1801133 sequence.

FIG. 5 shows the sequencing results of example 2.

FIG. 6 shows the real-time fluorescent PCR results of example 2.

FIG. 7 shows the real-time fluorescent PCR results of example 3.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Nucleic acid DNA extraction kit produced by Tiangen Biochemical company: catalogue No. of DNA/RNA Isolation Kit DNA/RNA Co-extraction Kit (centrifugal column type): DP422

Magnetic bead BeyoMag ^TM Product number P2151 of Streptavidin Magnetic Beads (Streptavidin Magnetic Beads)

Tth argonaute endonuclease/Buffer Tth argonaute endonuclease catalog M0665S

Example 1 preparation of enrichment kit

1. Principle of reaction

The main principle of the method for enriching target nucleic acid provided by the invention is shown in figures 2 and 3. FIG. 2 shows a specific step of target cleavage, which comprises mixing a nucleic acid substrate, a Tth argonaute endonuclease guided by a forward-end endoDNA guide strand and a Tth argonaute endonuclease guided by a rear-end endoDNA guide strand, wherein the Tth argonaute endonuclease cleaves on the nucleic acid substrate under the guide of the guide strand to obtain a forward-end endoDNA guide strand bound to a target nucleic acid. FIG. 3 is a diagram showing the enrichment of the cleaved target, which comprises the specific binding capture and separation of Streptavidin-modified magnetic beads (Streptavidin magnetic beads) and biotin modified at the 3' end of the front end endo-DNA guide strand to obtain the target nucleic acid.

2. Enrichment kit

Comprises the following steps:

1. guide strand for DNA for internal cutting

Including a front end endoDNA guide strand bound to the 5 'end of the target and a back end endoDNA guide strand bound to the 3' end of the target.

The front end cut DNA guide chain needs phosphorylation modification at the 5 'end, and biotin labeling at the 3' end; the rear end endoDNA guide strand needs phosphorylation modification at the 5 'end, but the 3' end does not need to be additionally marked.

Specifically, the designed front-end endoDNA guide strand is complementary to the 5' end and the adjacent position of target nucleic acid (dsDNA, ssDNA, ssRNA), the complementary base is 16-18nt, and after complete complementation, cutting is carried out at the position of 10-11 nt. The designed rear end endo-DNA guide strand is complementary with the 3' end and the adjacent position of target nucleic acid (dsDNA, ssDNA, ssRNA), the number of complementary bases is 16-18nt, and after complete complementation, cutting is carried out at the position of 10-11 nt.

More specifically, the front end endoDNA guide strand comprises a segment A and a segment B which are connected in sequence from the 5' end, wherein the segment B specifically binds to a 10-11nt adjacent segment at the 5' end of the target nucleic acid, and the segment A specifically binds to a 5' end segment of the target nucleic acid; the rear end endoDNA guide chain comprises a segment C and a segment D which are sequentially connected from the 5' end, wherein the segment C is specifically combined with the 10-11nt segment at the 3' end of the target nucleic acid, and the segment D is specifically combined with the adjacent segment at the 3' end of the target nucleic acid.

2. Tth argonaute endonuclease

A specific Tth argonaute endonuclease is available from NEB under the trade designation M0665S.

The specific reaction temperature of Tth argonaute endonuclease is 65-85 ℃.

The reaction concentration of the Tth argonaute endonuclease is 0.1. Mu.M-5. Mu.M.

3、10×Tth argonaute Buffer

A specific Tth argonaute Buffer is prepared from 20mM Tris-HCl, 10mM (NH) ₄ ) ₂ SO ₄ 、10mM KCl、2mM MgSO ₄ And 0.1%

X-100.

The specific pH of the Tth argonaute Buffer is approximately equal to 8.4-8.8.

The Tth argonaute Buffer can be used as a diluent, a Buffer and a reaction solution of the Tth argonaute endonuclease.

Specific formulation methods are shown in table 1 below.

TABLE 1.10 XTth argonaute Buffer formulation method

4. The magnetic bead with the surface modified with streptavidin can be specifically used for connecting with biotin at the 3' end in a guide chain of front end incision DNA

Alternatively, the kit may also comprise:

a front-end endoDNA-guide strand-endonuclease complex and a rear-end endoDNA-guide strand-endonuclease complex.

The preparation method of the above complex may comprise mixing the front-end endonuclease DNA guide strand or the rear-end endonuclease DNA guide strand with Tth argonaute endonuclease, and incubating at 75 ℃ to obtain a front-end endonuclease DNA guide strand-endonuclease complex or a rear-end endonuclease DNA guide strand-endonuclease complex.

The mixing volume ratio of the guide strand of the front-end endonuclease DNA or the guide strand of the back-end endonuclease DNA to the Tth argonaute endonuclease may be 5:1, final concentration of the front or rear end endonuclease DNA 5. Mu.M: tth argonaute endonuclease final concentration was 1. Mu.M.

The incubation time may be 10-30 minutes.

3. Establishment of enrichment method

1. Preparation of the front-end endo-DNA guide strand-endonuclease complex and the rear-end endo-DNA guide strand-endonuclease complex

The guide strand of the front-end endonuclease or the guide strand of the back-end endonuclease was ligated with Tth argonaute endonuclease in a ratio of 5:1 (final concentration ratio is also 5) and left to incubate at 75 ℃ for 10 to 30 minutes to obtain 20 × the front end endodna guide strand-endonuclease complex and 20 × the rear end endodna guide strand-endonuclease complex.

2. Enzyme digestion

20 Xthe front end endoDNA guide strand-endonuclease complex and 20 Xthe back end endoDNA guide strand-endonuclease complex were added to the sample to be enriched (the mixing volume ratio of the complex to the sample was 1. The sample may be extracted nucleic acid DNA. Setting the reaction temperature at 65-85 deg.c and reacting for 10-60min to obtain the enzyme digested product.

TABLE 2 preparation of specific digestion system

3. Bonding of

And (3) carrying out surface modification on the magnetic beads modified by streptavidin according to the proportion of 1: and 5, adding the mixture into the enzyme digestion product, and uniformly mixing to obtain the magnetic bead-enzyme digestion product combination. The mixing can be carried out by swirling for 30s and standing for 5min, or by mixing for 5min upside down.

4. Enrichment of

Placing the magnetic bead-enzyme digestion product conjugate on a magnetic frame for magnetic attraction for 1min, and removing the supernatant.

5. Cleaning of

The tube wall is cleaned (e.g., twice) with absolute ethanol to remove residual impurities. Air-drying at room temperature for 5min.

6. Elution is carried out

And (3) washing the magnetic beads by using nuclease-free water with pH = 7.5-8.5 and TE buffer solution, and eluting the enzyme digestion product targets combined on the magnetic beads to obtain the targets. Specifically, the magnetic beads are re-suspended by nuclease-free water or TE buffer solution, the reaction is carried out for 5 minutes in the environment of 95-100 ℃, the reaction is finished, then the reaction product is placed on a magnetic frame again for adsorption for 15 seconds, and supernatant is absorbed, wherein the supernatant is the liquid enriched in the target nucleic acid.

Example 2 target-specific enrichment of blood/body fluid tissue DNA

The sample is human whole blood, and a nucleic acid DNA sample is obtained by adopting a nucleic acid DNA extraction kit.

ssDNA1 and ssDNA2 were synthesized artificially. The ssDNA1 sequence is ATCACGCAGCTTTTTCT, 5'phosphorylation, 3' modified biotin, and specifically binds to the 475-490 bit region of Rs 1801133. ssDNA2 sequence isCGAAGCAGGGAGCTTT5' phosphorylated and specifically binds to the 545-560 region of Rs 1801133. The streptavidin-modified magnetic beads were taken out from 4 ℃ and returned to room temperature for use, and purchased from Byunnan biosciences.

The target DNA enrichment method and the verification method are as follows:

(1) Preparation of 20 XSsDNA 1-Tth argonaute endonuclease Complex: according to the following steps of 1:5, the Tth argonaute endonuclease and the ssDNA1 were mixed, and the concentration of the Tth argonaute endonuclease after mixing was 1. Mu.M, and the concentration of the ssDNA1 after mixing was 5. Mu.M. After mixing, the mixture was incubated at 75 ℃ for 15min to obtain a 20 XSsDNA 1-Tth argonaute endonuclease complex.

(2) Preparation of 20 XSsDNA 2 mixture-Tth argonaute endonuclease Complex: according to the following steps of 1:5, the concentration of the Tth argonaute endonuclease mixed with the ssDNA2 was 1. Mu.M, and the concentration of the ssDNA2 mixed with the Tth argonaute endonuclease mixed with the ssDNA2 mixed with the ssDNA was 5. Mu.M. After mixing, the mixture was incubated at 75 ℃ for 15min to obtain a 20 XSsDNA 2 mixture-Tth argonaute endonuclease.

(3) Specific cleavage of target DNA: the extracted DNA samples were prepared according to the preparation method shown in Table 2 of example 1. And incubated at 80 ℃ for 30min.

(4) Specific binding and enrichment of target DNA: after the reaction is finished, mixing the raw materials in a volume ratio of 5:1, adding streptavidin modified magnetic beads and absolute ethyl alcohol with the volume 2 times that of the reaction product into the reacted product, and turning the mixture upside down and mixing the mixture uniformly for 5 minutes to ensure that the reacted product is fully contacted with the magnetic beads. Placing the uniformly mixed magnetic bead-enzyme digestion product on a magnetic frame for adsorption for 15s, discarding the supernatant after the magnetic bead is completely adsorbed, adding absolute ethyl alcohol with the volume 2 times that of the reaction product again to wash the magnetic bead, placing the magnetic bead on the magnetic frame for adsorption for 15s, discarding the supernatant after the magnetic bead is completely adsorbed, naturally airing for 5 minutes, and ensuring that the ethyl alcohol is completely volatilized. Adding a proper amount of nuclease-free water with the pH value of 7.5-8.5 as eluent to resuspend the magnetic beads, putting the resuspended sample into an environment with the temperature of 95-100 ℃ to react for 5 minutes, putting the sample on a magnetic frame again to adsorb for 15 seconds after the reaction is finished, sucking supernatant (namely the liquid with the target specificity enrichment) and storing the supernatant in a clean tube at the temperature of-20 ℃.

(5) Verifying the enrichment effect of the target: an enriched Rs1801133 fragment comprising a mutation site No. 677 folate (G > a). See in particular fig. 4. First, PCR amplification is performed on the extracted nucleic acid DNA sample using the identifying primers, and the site is confirmed by first-generation sequencing (Shanghai, biotech). The sequence of the forward identification PCR primer is as follows: TGGGACCTGGGAGATCCACTT; the sequence of the reverse identification PCR primer is as follows: GTGCTGTTGGAAGGTGCAAG. The confirmation results are shown in FIG. 5. Rs1801133, which is a mutant type, was identified as a sample used in this example. And then, carrying out real-time fluorescence PCR amplification on the enriched target by using a verification primer to verify whether the target is enriched or not. The sequence of the forward validation primer (wild type) was: tgcgtgtgatgaaatcgg; the sequence of the forward validation primer (mutant) was: tgcgtgtgatgaaatcga; the sequence of the reverse validation primer was: GCTTTGAGGCTGACCTGAA. The results are shown in FIG. 6, the left panel shows the amplification results of the mutant primers; the right panel shows the amplification results of the wild-type primers. And (3) performing real-time fluorescence PCR amplification on the enriched target by adopting a forward verification primer (mutant type) and a reverse verification primer, wherein an obvious S-shaped curve appears in a fluorescence signal, the peak-off time of the S-shaped curve is less than the total reaction time multiplied by 10%, performing real-time fluorescence PCR amplification on the enriched target by adopting the forward verification primer (wild type) and the reverse verification primer, and the fact that the S-shaped curve does not appear in the fluorescence signal indicates that the Rs1801133 of the sample is the mutant type. The result shows that the method can specifically enrich the target DNA in the blood body fluid tissue DNA.

Example 3 target-specific enrichment of pathogenic microbial DNA

The sample is staphylococcus aureus CGMCC1.282, and the nucleic acid DNA sample is obtained by adopting a nucleic acid DNA extraction kit.

ssDNA1 and ssDNA2 were synthesized artificially. The ssDNA1 sequence is AAACAACTTCAAATGG,5 '-phosphorylated, 3' -modified biotin, and specifically binds to the FerMA gene of Staphylococcus aureus. The ssDNA2 sequence is AACTTCCGGCAAAAAATG, 5' phosphorylation, and specificity binding to the Ferma gene of staphylococcus aureus. The used staphylococcus aureus Ferma gene is a sequence after being compared and compressed, namely a sequence obtained by collecting 246 staphylococcus aureus Ferma gene sequences from an nt database of NCBI (national center of Biotechnology information) from different sources, performing ClustalW comparison by BioEdit software and then compressing by sense.

The streptavidin-modified magnetic beads were taken out from 4 ℃ and returned to room temperature for use, and purchased from Byunnan biosciences.

The target DNA enrichment method is as follows:

(1) Preparation of ssDNA1-Tth argonaute endonuclease complex: according to the following steps of 1:5, the Tth argonaute endonuclease and the ssDNA1 were mixed, and the concentration of the Tth argonaute endonuclease after mixing was 1. Mu.M, and the concentration of the ssDNA1 after mixing was 5. Mu.M. After mixing, the mixture was incubated at 75 ℃ for 15min to obtain ssDNA1 mixture-Tth argonaute endonuclease.

(2) Preparation of ssDNA2 cocktail-Tth argonaute endonuclease complex: according to the following steps of 1:5, the concentration ratio of the Tth argonaute endonuclease to the ssDNA2 was 1. Mu.M, and the concentration of the Tth argonaute endonuclease to the ssDNA2 was 5. Mu.M. After mixing, the mixture was incubated at 75 ℃ for 15min to obtain ssDNA2 mixture-Tth argonaute endonuclease.

(3) Specific cleavage of target DNA: the extracted DNA samples were prepared according to the method described in Table 2 of example 1, and incubated at 80 ℃ for 30min.

(4) Specific binding and enrichment of target DNA: after the reaction is finished, mixing the raw materials in a volume ratio of 5:1, adding streptavidin modified magnetic beads and absolute ethyl alcohol with the volume 2 times that of the reaction products into the reacted products, and turning the mixture upside down and mixing the mixture for 5 minutes to ensure that the reacted products are fully contacted with the magnetic beads. Placing the uniformly mixed magnetic bead-enzyme digestion product on a magnetic frame for adsorption for 15s, discarding the supernatant after the magnetic bead is completely adsorbed, adding absolute ethyl alcohol with the volume 2 times that of the reaction product again to wash the magnetic bead, placing the magnetic bead on the magnetic frame for adsorption for 15s, discarding the supernatant after the magnetic bead is completely adsorbed, naturally airing for 5 minutes, and ensuring that the ethyl alcohol is completely volatilized. Adding a proper amount of nuclease-free water with the pH value of 7.5-8.5 as eluent to resuspend the magnetic beads, putting the resuspended sample into an environment with the temperature of 95-100 ℃ to react for 5 minutes, putting the sample on a magnetic frame again to adsorb for 15 seconds after the reaction is finished, sucking supernatant (namely the liquid with the target specificity enrichment) and storing the supernatant in a clean tube at the temperature of-20 ℃.

(5) Verifying the enrichment effect of the target: based on the sequence fragments between ssDNA1 to ssDNA2, a molecular beacon MB was designed: HEX-5 'CCCGTTATGCTGGTGGTACATCAAATGCACGGGG3' -BHQ1 was prepared into a reaction system according to the following Table 3. And the reaction program in Table 4 was followed to perform detection on a real-time fluorescent PCR instrument and observe the fluorescent signal. When a fluorescent signal is generated, successful target enrichment is indicated, and otherwise, no target enrichment is indicated. The results are shown in fig. 7, the left panel is the detection result of real-time fluorescence PCR using the liquid specifically enriched in the target as the template, and a fluorescence signal is generated; the right panel shows the results of real-time fluorescent PCR using negative control as template, with no fluorescent signal being generated. The result shows that the method can specifically enrich the target DNA in the DNA of the pathogenic microorganism.

TABLE 3 preparation of the reaction System

Number of	Name(s)	Sample volume (μ L)	Final concentration
				1	Liquid with enriched target specificity	25μL	\
2	Molecular beacon MB (100. Mu.M)	0.25μL	0.5μM
				3	Nuclease-free water	24.75μL	\
4	Total volume	50μL	\

TABLE 4 setting of reaction sequence

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims (9)

1. A method for enriching a target nucleic acid, comprising: comprises that

(1) Mixing and incubating Tth argonaute endonuclease and a front-end endoDNA guide strand to obtain a front-end endoDNA guide strand-endonuclease complex, and mixing and incubating the Tth argonaute endonuclease and a rear-end endoDNA guide strand to obtain a rear-end endoDNA guide strand-endonuclease complex;

(2) Carrying out mixed enzyme digestion on a nucleic acid substrate containing target nucleic acid, the front end endoDNA guide strand-endonuclease complex obtained in the step (1) and the rear end endoDNA guide strand-endonuclease complex obtained in the step (1) to obtain a front end endoDNA guide strand combined with the target DNA;

(3) Mixing the magnetic beads with the front end internal cutting DNA guide chain obtained in the step (2) to obtain magnetic beads combined with the front end internal cutting DNA guide chain so as to realize the enrichment of target nucleic acid;

the front end endodna guide strand and the rear end endodna guide strand are single-stranded DNAs and 5' -phosphorylated, the front end endodna guide strand comprises a segment a and a segment B which are sequentially connected from 5' -end, the segment B is specifically combined with a 10-11nt adjacent segment at the 5' -end of the target nucleic acid, the segment a is specifically combined with a 5' -end segment of the target nucleic acid, the rear end endodna guide strand comprises a segment C and a segment D which are sequentially connected from 5' -end, the segment C is specifically combined with a 10-11nt segment at the 3' -end of the target nucleic acid, and the segment D is specifically combined with a 3' -adjacent segment of the target nucleic acid;

modifying a biotin group at the 3' end of the guide chain by the front end internal cutting DNA;

the surface of the magnetic bead is modified with streptavidin combined with biotin groups.

2. The target nucleic acid enrichment method of claim 1, characterized in that: the incubation temperature in the step (1) is 75 ℃, and the incubation time is 10-30 minutes.

3. The target nucleic acid enrichment method of claim 1, characterized in that:

the length of the front end internal cutting DNA guide chain is 16-18nt;

the length of the rear end incision DNA guide chain is 16-18nt.

4. The target nucleic acid enrichment method of claim 1 or 2, characterized in that:

the enzyme cutting temperature in the step (2) is 65-85 ℃, and the enzyme cutting time is 10-60min.

5. The method for enriching a target nucleic acid according to any one of claims 1 to 4, wherein: further comprising:

(4) And (4) denaturing the target nucleic acid on the magnetic beads obtained in the step (3) and eluting to obtain free target nucleic acid.

6. The method for enriching a target nucleic acid according to any one of claims 1 to 5, wherein: the nucleic acid substrate is DNA or RNA.

7. A kit for enrichment of target nucleic acids characterized by: comprising a Tth argonaute endonuclease, a forward strand of the sense strand of the endonuclease as defined in claim 1, a back strand of the sense strand of the endonuclease as defined in claim 1, and a magnetic bead as defined in claim 1.

8. A kit for enrichment of target nucleic acids, characterized in that: comprising a front-end endonuclease complex, a back-end endonuclease complex, and the magnetic bead of claim 1,

the forward-end endonuclease DNA-guide strand-endonuclease complex obtained by incubating the forward-end endonuclease DNA-guide strand of claim 1 in admixture with a Tth argonaute endonuclease,

the back-end endonuclease complex is obtained by incubating the back-end endonuclease complex of claim 1 with the Tth argonaute endonuclease in a mixture.

9. Use of a kit according to claim 7 or 8 in any of:

(1) Enriching target nucleic acid;

(2) DNA amplification;

(3) DNA sequencing;

(4) Preparing a target nucleic acid enrichment product;

(5) Preparing a DNA amplification product;

(6) Preparing DNA sequencing products.

Images