CN115927389A - Soybean GmAP2-a gene and application thereof - Google Patents

Abstract

The invention discloses a soybean GmAP2-a gene and application thereof. The gene is a member of soybean AP2 subfamily, the nucleotide sequence of the GmAP2-a gene is shown as SEQ ID NO.3, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 4. Researches show that the gene is overexpressed in arabidopsis thaliana, so that the abiotic stress resistance of a plant can be improved, the stamen of the plant is abnormal, and the soybean plant with the gene knocked out shows male sterility. The characteristic of the gene has great application value in breeding.

Description

Soybean GmAP2-a gene and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a soybean GmAP2-a gene and application thereof.

Background

Floral organ development (Floral organ development) is an important process for the transition of plants from vegetative growth to reproductive growth, and the molecular basis thereof is the participation of a plurality of related genes. By using model plants, researchers divide the flower into four rounds of sepals, petals, stamens and pistils from outside to inside in sequence, namely, A with different functions

Three types of genes (AP 1-APETALA1 and AP2-APETALA 2), B (AP 3-APETALA3 and PI-PISTILLATA) and C (AG-AGAMOUS) are controlled and respectively play roles in two adjacent organs, namely a famous ABC model of flower development. Male sterility refers to the phenomenon that stamens are not normally developed and cannot produce functional pollen or male gametes, but pistils are normally developed and can accept normal pollen to fertilize and fruit. The male sterility can be used for improving the plant quality and providing excellent seed sources, thereby bringing material benefits to human beings and saving a large number of manual castration links. In the production process of crops, the male sterility phenomenon in the development process of floral organs is applied to realize the 'cross breeding' of various crops and the popularization and application of hybrid seeds. At present, the application of the male sterility crossbreeding technology to crops such as rice, corn and the like is the most successful, and the related genes of male sterility are cloned in various plants such as tobacco, camellia oleifera, corn, petunia and the like. At present, genes related to soybean male sterility are not cloned, and soybean male sterile hybrids cannot be applied to actual production. Therefore, the problem of seed production of the soybean male sterile hybrid is very urgent.

Disclosure of Invention

The invention aims to provide a soybean GmAP2-a gene and application thereof, wherein the gene is a member of soybean AP2 subfamily, and the invention aims to explore partial functions of the gene and elucidate the application of the gene in breeding.

In order to achieve the aim, the invention provides a soybean GmAP2-a gene, and the nucleotide sequence of the gene is shown in SEQ ID NO. 3.

The invention also provides a protein coded by the GmAP2-a gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 4.

The invention also provides an overexpression recombinant vector containing the soybean GmAP2-a gene.

The invention also provides a gene knockout recombinant vector containing the soybean GmAP2-a gene.

The invention also provides a recombinant bacterium containing the overexpression recombinant vector or the gene knockout recombinant vector.

Preferably, the empty bacterium of the recombinant bacterium is selected from agrobacterium tumefaciens.

The soybean GmAP2-a gene provided by the invention can be applied to soybean breeding, and particularly can be applied to preparation of soybean male sterile lines.

The soybean GmAP2-a gene and the application thereof analyze partial functions of the gene for the first time, solve the problems of slow clone and function exploration of soybean male sterility related genes and the like, and have the following advantages:

according to the invention, the GmAP2-a gene sequence is obtained, the positioning of the gene is analyzed in detail, the effects of stress resistance and the like of overexpression of the gene are explored and verified, the soybean with the gene knocked out shows male sterility, and the gene and the function thereof have great application values in breeding.

Drawings

FIG. 1 shows the electrophoresis diagram of cDNA amplification of GmAP2-a gene in the present invention.

FIG. 2 is a schematic diagram of an Arabidopsis overexpression vector of the present invention.

FIG. 3 is the PCR amplification electrophoresis chart of the over-expression plasmid constructed in the present invention.

FIG. 4 is the PCR amplification chart for identifying Agrobacterium colony transformed with the constructed overexpression plasmid of the present invention.

FIG. 5 shows the comparison result of drought stress resistance between Arabidopsis wild-type plants and overexpression plants in the present invention.

FIG. 6 is a comparison result of root growth conditions of Arabidopsis wild-type plants and overexpression plants under mannitol stress and high salt stress conditions.

FIG. 7 shows the comparison results of Arabidopsis thaliana wild-type plants and over-expressed plants under the stress of low-temperature germination.

FIG. 8 shows the comparison of the plant phenotype and anther morphology of Arabidopsis wild-type plants and over-expressed plants of the present invention.

FIG. 9 shows the PCR identification result of the bacterial liquid obtained after transforming Agrobacterium with the gene knockout recombinant vector of the present invention.

FIG. 10 is the PCR identification electrophoresis picture of the resistance gene bar in the T0 generation regenerated seedlings of the transgenic plants after gene knockout.

FIG. 11 is a diagram showing the identification result of PAT/bar transgenic test paper in T0 generation regenerated seedlings of transgenic plants in the present invention.

FIG. 12 is a T1 generation resistance gene bar smearing identification result diagram of the transgenic plant of the invention.

FIG. 13 shows the result of comparing the DNA sequencing sequence of the target site of the GmAP2-a gene of the present invention.

Fig. 14 shows the comparison of plant morphology and anther morphology of soybean wild type and Cas9 mutant in the present invention.

Fig. 15 is a comparison of paraffin sections of anther morphology microstructures of soybean Cas9 mutant and wild type plants in the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be described clearly and completely below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Description of the drawings:

the soybean AP2 gene is named GmAP2-a;

the reagents and methods used in the examples are conventional reagents and techniques conventional in the art, not specifically described.

Experimental example 1cloning of GmAP2 Gene

1.cDNAs sequence of GmAP2 Gene

1.1 Single-stranded cDNA template acquisition

Collecting florets formed by incomplete differentiation at the top of the cultivated soybean inflorescences, freezing and storing in a liquid nitrogen refrigerator at-80 ℃ for later use. Total RNA was extracted in small amounts by combining TRIzol (Invitrogen) and LiCl (Sigma) precipitation, and after digestion of DNA by RQ1RNase-FreeDNaseI (Promega), concentration and quality of total RNA were checked by 1.0% agarose electrophoresis in combination with ThermoscientificNaNodrop2000 c. First single-stranded cDNA was synthesized using SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen) using 1.5. Mu.g of gRNA as a template, 2. Mu.g of total RNA, and OligodT

1 μ L (100 μ M), 1 μ L of dNTP (10 mM), ddH supplement ₂ O (RNase-free) to 29. Mu.L; reacting for 5min at 65 ℃ on a PCR instrument, and quickly taking out and cooling in an ice bath for 10min; add 11. Mu.L of the mixture to the tube

(5 Xfirst strand buffer 8. Mu.L, 0.1M DTT solution 2. Mu.L, 200U/. Mu.L M-MLV 1. Mu.L); mixing with pipette, reacting at 37 deg.C for 60min, standing at 70 deg.C for 15min to terminate the reaction,

storing at-20 deg.C for use.

1.2 bioinformatics analysis of Soybean AP2 subfamily Gene

355 soybean AP2-ERF family gene sequences are subjected to bioinformatics analysis by searching (BLAST) for published whole genome sequences of cultivated soybeans in https:// phytozome-next.jgi.doe.gov/info/Gmax _ Wm82_ a2_ v1, and 42 related information of AP2 subfamily genes is obtained. Through analysis and comparison, RT-PCR primers are respectively designed for 42 AP2 subfamily genes by using Primer Premier 5, then cDNA of a soybean inflorescence is used as a template for respective amplification, the obtained AP2 subfamily gene cDNA complete sequence is named GmAP2-a, the Primer pair for amplifying the sequence is GmAP2-aF/R, the nucleotide sequence of the Primer pair is shown as follows, and the PCR reaction conditions are as follows: 94 ℃ for 5min,35 cycles (94 ℃ for 1min,60 ℃ for 30s,72 ℃ for 30 s), 72 ℃ for 10min, and a PCR system of 50 mu L by using a conventional PCR amplification kit.

The sequence is shown below (5 '→ 3'):

GmAP2-a F(SEQ ID NO.1)：ATGTTAGATCTTAATCTCAATGCGGAGGmAP2-a R(SEQ ID NO.2)：TTAACTAACATTGGTTTCCATC

preparing a sample of the obtained RT-PCR amplification product, and carrying out electrophoresis separation detection by using 1.0% agarose, wherein a result is shown in figure 1, wherein a lane M in the figure is a D2000 molecular weight standard; lane 1 is the PCR amplified fragment, indicating that about 1000bp of PCR product was obtained by successful amplification. Placing the gel under an ultraviolet lamp, cutting off the gel of the target fragment part by using a scalpel, and collecting the gel into a sterilized centrifugal tube. Recovery was performed according to the Promega gel recovery kit instructions.

According to

T1cloning vector (Promega) Instructions will recover the product and ` Liang `>

T1cloning vector ligation. The 10 μ L reaction was as follows: PCR recovery of 3. Mu.L/ml>

T1Cloning Vector 1. Mu.L, T4 ligase 1. Mu.L, 2 XT 4 ligase Buffer 5. Mu.L. Mix gently and react at 37 ℃ for 5min. After the reaction was completed, the centrifuge tube was placed on ice.

mu.L of the ligation product was added to 50. Mu.L of Trans1-T1 competent cells, gently mixed, ice-cooled for 30min, heat-shocked at 42 ℃ for 45s, and immediately placed on ice for 2min. Adding 800 μ L LB liquid culture medium without antibiotic, shaking culturing at 37 deg.C and 200rpm for 1h. mu.L of 500mM IPTG and 40. Mu.L of 20mg/mL X-gal were mixed and applied evenly to LB plates containing ampicillin at a final concentration of 100 mg/L. After IPTG and X-gal are absorbed, 100. Mu.L of the bacterial liquid is uniformly coated on the plate culture medium and cultured in an inverted mode at 37 ℃ overnight.

White colonies were picked and inoculated into LB liquid medium containing ampicillin (100 mg/L), and cultured with shaking at 37 ℃ for 12 hours for PCR reaction identification. And the amplified product is delivered to Invitrogen company for sequencing, the obtained CDS of the GmAP2-a gene is analyzed by using biological information software, and the result shows that the total length of the CDS sequence of the GmAP2-a gene is 1119bp, the nucleotide sequence is shown as SEQ ID NO.3, the open reading frame is 1119bp, 372 amino acids are coded, and the amino acid sequence is shown as SEQ ID NO. 4.

Experimental example 2 functional study in Arabidopsis thaliana

1.obtaining Arabidopsis thaliana over-expression plant of GmAP2-a gene

1.1 Arabidopsis overexpression vector construction

The cDNA full-length sequence of the cultivated soybean AP2-a gene is taken as a template, xba I and Sac I enzyme cutting sites are selected from an overexpression vector pMDC100IG multiple cloning site, amplification primers with Xba I and Sac I enzyme cutting sites respectively added at two ends are synthesized by Invitrogen company, and a simplified diagram of an arabidopsis thaliana overexpression vector is shown in figure 2. The reaction system and the PCR conditions are the same as the cDNA sequence amplification conditions of the GmAP2-a gene. After the PCR amplification product is separated by 1% agarose electrophoresis and recovered by a kit, connecting a Trans1-T1 vector (Promega), sending to Invitrogen for sequencing to verify the sequence correctness, and respectively carrying out double digestion (Takara) on a pMDC-100IG vector and related plasmids containing GmAP2-a gene, wherein 50 mu.L of digestion system: template 1. Mu.g, sac I and Xba I enzymes 1.5. Mu.L each, 10 XBufferm 5. Mu.L, ddH ₂ O32. Mu.L. Performing metal bath reaction at 37 ℃ for 1h, performing electrophoresis separation on 0.8% agarose, cutting the agarose, and recovering the kit. The concentration was determined by Thermo Scientific Nanodrop2000c, ligated by T4 ligase (promega), and the digested GmAP2-a cloned fragment was ligated to pMDC100IG vector (10. Mu.L system: 4. Mu.L of the digested cloned fragment, 1. Mu.L of pMDC100IG digested vector, 10 XT 4 strain Buffer 1. Mu.L, T4 strain 1. Mu.L, ddH ₂ O3. Mu.L), reacting for 1h at 37 ℃ in a metal bath, and naming the constructed recombinant as pMDC100 IG-AP2-a. mu.L of pMDC100 IG-AP2-a was transformed into E.coli DH 5. Alpha. Competent cells by heat shock method (same as above), plated (50 mg/L, kana) ⁺ ) After single colony developed, the single colony was picked up and inoculated into 5mL of liquid LB medium (50 mg/L kana) ⁺ ) Culturing at 37 ℃ for about 8h under constant temperature shaking, extracting plasmids, and performing PCR and sequencing identification (Invitrogen) on recombinant plasmids as shown in FIG. 3, wherein M in the figure is D2000 molecular weight standard; lanes 1-5 are PCR amplified fragments, and the results show that the overexpression recombinant plasmid to be detected is successfully constructed.

1.2 Agrobacterium tumefaciens GV3101 transformation of Arabidopsis thaliana

The procedure (heat shock method) was performed according to the molecular cloning protocol (fourth edition), and 1. Mu.L of competent cells of Agrobacterium tumefaciens GV3101 were transformed with plasmid of the successfully constructed recombinant overexpression vector pMDC100 IG-AP2-a, and identified by PCR amplification, the result of which is shown in FIG. 4, wherein M is the standard of D2000 molecular weight; lanes 1-4 are PCR amplified fragments; lane 5 is a positive control; lane 6 is a negative control.

The top of the main inflorescence of Columbia wild type Arabidopsis plants growing in a light incubator (24 ℃,16h light/8 h dark) for about three weeks is cut off, and the plants are ready to be infected when a large number of buds grow on the lateral branches and are opened. One day before infection, water was poured, the pods and flowers that had opened were removed and ready for transformation. Agrobacterium containing the overexpression vector pMDC100 IG-AP2-a of the recombinant gene GmAP2-a is inoculated into LB liquid culture medium containing resistance (50 mg/L kanamycin and 25mg/L rifampicin), and cultured overnight at 30 ℃ with shaking at 200 rpm. The overnight culture was inoculated into LB liquid medium containing the corresponding antibiotic at a ratio of 1. The cells were collected by centrifugation and resuspended in an equal volume of buffer (containing 1/2MS medium, 5% sucrose and 0.02% silwet-77).

The Arabidopsis infection adopts a pollen tube channel method, the upper part of an Arabidopsis plant prepared in advance is gathered into a lock, slowly immersed into a container filled with agrobacterium heavy suspension, gently shaken to enable flower organs to uniformly contact with bacterial liquid for 30s, cultured in dark for 12h, and repeatedly infected for 1 time after 3 days. When the top pod turns yellow and the seeds mature quickly, the watering is stopped, and the seeds are harvested successively (T0 generation).

Screening seeds of the T1 generation by using a screening culture medium (1/2 MS culture medium with 50mg/L kanamycin resistance) (24 ℃,20 h light/4 h dark), selecting individual plants capable of normally growing, transplanting the individual plants into a nutrition pot for culture (24 ℃,20 h light/4 h dark), and harvesting the seeds (T1 generation); and repeating the screening steps, re-planting the plants on a screening culture medium, counting and selecting the plants with the phenotypic character segregation ratio of 3.

1.3 phenotypic characterization of transgenic Arabidopsis

1.3.1 adult plant water shortage-rehydration treatment: directly planting T3 generation seeds of strains obtained by screening arabidopsis thaliana (four transgenic arabidopsis thaliana strains a-3, b-4, c-7 and d-11 are selected here) in a seedling culture disc (nutrient soil: vermiculite is 1), placing the disc in an illumination incubator (24 ℃,16h illumination/8 h darkness) for growth, pouring 1/2MS culture solution once every 7 days when two lotus throne leaves are developed, carrying out water-deficient treatment for 3 weeks at 5 weeks, rehydrating, and counting the survival rate of the plants after one week. The growth comparison result after drought stress is shown as A in figure 5, the quantitative result is shown as B in figure 5, after rehydration, the survival rate of the transgenic plant is over 70 percent and is obviously higher than that of the control group (Col-0, 36 percent), and the difference is very obvious.

1.3.2 seedling growth stress treatment: the four T3 generation seeds obtained by Arabidopsis thaliana screening were sterilized conventionally, planted in culture dishes (1/2 MS) containing 300mM mannitol and 150mM sodium chloride, respectively, and vertically cultured in a light culture phase, and after 3 weeks, the growth state of the plants was observed, and the root length was measured. The results in mannitol are shown as C in FIG. 6, the quantitative results are shown as D in FIG. 6, the results in sodium chloride are shown as E in FIG. 6, and the quantitative results are shown as F in FIG. 6. The results show that the root length of the germination and growth of the seeds of the Arabidopsis transgenic lines (a-3, b-4, c-7 and d-11) is higher than that of a control group (Col-0), and the difference is extremely obvious; there were also differences in the individual performances between the different strains under the respective stresses of mannitol and sodium chloride.

1.3.3 seed low-temperature germination treatment: and (3) conventionally sterilizing the four T3 generation seeds obtained by screening arabidopsis thaliana, inoculating the seeds into a 1/2MS culture medium, germinating for 14 days in a dark place at the temperature of-4 ℃, taking out, and counting the germination rate of the plants. The results are shown as G in FIG. 7, and the quantitative results are shown as H in FIG. 7. It can be known that the seed low-temperature germination rate of the Arabidopsis transgenic lines (a-3, b-4, c-7 and d-11) is more than 80 percent and higher than that of a control group (Col-0), and the difference reaches a very significant level.

1.3.4 plant morphology observations: directly planting the four T3 generation seeds obtained by screening the arabidopsis thaliana in a seedling raising pot (nutrient soil: vermiculite is 1). The results are shown in FIG. 8, wherein the comparison result of the growth conditions in the growth period of the control group (Col-0) and the plant with the overexpressed gene (b-4) is shown in I in FIG. 8, J in FIG. 8 is the anther morphology of the control group (Col-0) plant, and K in FIG. 8 is the anther morphology of the overexpressed plant. The results show that: the growth period of the arabidopsis plant (b-4) with the overexpression of the recombinant gene GmAP2-a is obviously 7-10 days later than that of a control (Col-0), the phenomenon that stamens are abnormally developed and the number of the stamens is obviously increased is shown, the overexpression of the GmAP2-a gene is involved in regulating and controlling the stamens development of the transgenic arabidopsis, and the result suggests that the overexpression of the GmAP2-a gene may play a positive role in the related research on soybean male sterility.

Experimental example 3 acquisition of transgenic plants of cultivated soybeans

1. Site-directed editing of GmAP2-a gene mediated by CRISPR/Cas9

1.1 Targeted site design and vector construction for CRISPR/Cas9 Gene editing

The target site sgRNA design platform is designed by using CRISPR/Cas9 technology: CRISPR-P

(http:// cbi. Hzau. Edu. Cn/CRISPR2 /) sgRNA primer design was performed. A primer of GmAP-a-cas9-3F/R is designed according to an identification sequence of 20bp of a gRNA target position, and a specific sequence is shown as follows and synthesized by Invitrogen company;

the sequence is shown below (5 '→ 3'):

GmAP-a-cas9-3F (SEQ ID NO. 5): TTGCCTCCGTGGTGAATGCGGACGCACGGAC-a-cas 9-3R (SEQ ID NO. 6): AACGTCCGCATTCACCAGGAGGCRISPR/Cas 9 plasmid construction A kit Cas9/sgRNA plasmid construction kit developed by WESTERN Biotech limited is adopted, a company carrier (named VK 005-102) uses a promoter sequence of Arabidopsis thaliana AtU6-26 (starts sgRNA transcription), a dicotyledonous plant codon optimized dppS 9 gene, a Ubi promoter of corn activates expression of the dppS 9, a screening marker gene is glufosinate-resistant bar, and subsequent operations are carried out according to an operation instruction of the kit:

(1) Formation of oligo dimer: the oligo primers synthesized by Invitrogen were diluted to 10. Mu.M, respectively, and mixed in the following ratio, wherein the system was 25. Mu.L (GmAP-a-cas 9-3F 5. Mu.L; gmAP-a-cas9-3R 5. Mu.L; ddH ₂ O15. Mu.L), and 3min at 95 ℃ in a PCR instrument; slowly cooling to 25 ℃ at 95 ℃ (PCR cooling amplitude is-1 ℃/30 s); obtaining the oligo dimer at 16 ℃ for 5min.

(2) Insertion of oligo dimers into vectors: the reaction system is 10 mu L and comprises (sacAS 9/gRNA Vector (kit self-contained) 1 mu L, oligo dimer (step 1) 1 mu L, solution1 (kit self-contained) 1 mu L, solution2 (kit self-contained) 1 mu L and H ₂ O6. Mu.L) was added, and the reaction was carried out in a PCR apparatus at 16 ℃ for 120min.

(3) And (3) transformation: adding 10 mu L of the final product in the step (2) into 50 mu L of escherichia coli competent cells DH5 alpha which are just unfrozen on ice, flicking and uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, standing on ice for 2min, adding 200 mu L of non-antibiotic liquid LB, placing in a constant temperature shaking table at 37 ℃, absorbing 100 mu L of bacterial liquid for resuscitation at 180rpm for 1h, and uniformly coating the bacterial liquid containing kanamycin resistance (Kana) ⁺ 50 mg/L) on LB solid plates, and culturing overnight at 37 ℃ in an inverted state.

(4) Identification of Positive clones

The white colonies on the plate obtained in step (3) were picked and inoculated into 20mL of liquid LB (containing Kana) ⁺ ) Shaking the strain at 170rpm for 8h at 37 ℃; carrying out PCR detection on bacterial liquid, wherein a 25-microliter system: 1 mu L of bacterial liquid, 1 mu L of GmAP-a-cas9-3F primer, 1 mu L of Sq primer with the nucleotide sequence shown as SEQ ID NO.9, 2 XTaqMasterMix12.5 mu L and Autoclaveddh ₂ O9.5. Mu.L. The PCR reaction program is 94 ℃ for 3min;35 cycles (94 ℃ 30s, 55 ℃ 30s,72 ℃ 30 s); and 5min at 72 ℃, detecting by 1% agarose gel electrophoresis, selecting clones with positive electrophoresis detection, sequencing, and screening to obtain clones successfully inserted into the designed sgRNA target site sequence.

Wherein Sqprimer is a nucleotide sequence carried by cas9 vector company, is located at one side of the insertion-related site, and is only used for PCR sequencing detection of the operation of the kit, and the specific sequence is shown as follows (5 '→ 3'):

Sqprimer(SEQ ID NO.9)：GATGAAGTGGACGGAAGGAAGGAG

(5) Agrobacterium strain transformation and identification

Agrobacterium tumefaciens (Agrobacterium tumefaciens) strain EHA105 transformation was performed using a freeze-thaw method. The procedure (heat shock method) was performed according to the molecular cloning protocol (fourth edition) (2. Mu.L of successfully assembled plasmid, as determined by sequencing, was added to 200. Mu.L of iced Agrobacterium EHA105 competent cell tube, gently flicked and mixed, left on ice for 30min; liquid nitrogen cooling for 5min in 37 ℃ water bath, 800. Mu.L of YEP solution medium without antibiotics (1L solution: tryptone 10g, yeast extract 5g, naCl5g, pH = 7.0) was added, shaking culture was performed at 150rpm in a constant temperature shaker for 4h, 100. Mu.L of bacterial solution was aspirated and applied to YEP solid medium (Rif, 25mg/L; kana) ⁺ 50mg/L; YEP liquid +12.5g/L agar powder), and performing inverted culture at 28 ℃ for 1-2 days; after the bacterial plaque is clearly visible, a single bacterial colony is picked up and subjected to PCR identification again (the PCR and electrophoresis method is the same as (4), the result is shown in figure 9, wherein a lane M in the figure is a D2000 molecular weight standard, a lane 1 is a negative control of an empty carrier, lanes 2-5 are PCR amplified fragments, 500 mu L of bacterial liquid for identifying positive bacterial plaque (bacterial plaque corresponding to the lanes 2-5) is taken, 500 mu L of 50% sterile glycerol is added, and the bacterial liquid is stored in a refrigerator at the temperature of 80 ℃.

1.2 Agrobacterium tumefaciens mediated genetic transformation of soybean cotyledonary nodes

(1) Sterilizing the surface of the soybean by using chlorine gas: selecting about 200 full seeds with smooth and non-wrinkled skins and damaged seeds in Dongnong small-grain beans, and spreading the seeds in a glass culture dish with the diameter of 22 cm; the glass petri dish was separately placed in a desiccator in a fume hood with an open lid, while one beaker containing 90mL of sodium hypochlorite solution (about 5% active chlorine content) was placed, 4mL of concentrated hydrochloric acid was slowly added along the wall of the beaker, the desiccator lid coated with vaseline was quickly closed, and chlorine gas was sterilized for 16 hours.

(2) Seed germination: after sterilization the glass dish was opened in a fume hood to release residual chlorine for 1h. The lid was moved to a clean bench, and the soybean seeds were picked up with sterile forceps and inoculated on germination medium (1/2 × MS salt, 5g/L sucrose, 3.5g/L gel, pH = 5.8), and cultured for 2 days (25 ℃,16h light/8 h dark) with the lid.

(3) Preparing bacterial liquid: inoculating 50 μ L of Agrobacterium strain solution with target vector and identified and preserved into 20ml LYEP liquid culture medium (Rif, 25mg/L; kana) ⁺ 50 mg/L), and shaking at 28 ℃ for overnight culture to complete primary activation of the bacterial liquid. 200 μ L of activated bacterial suspension was added to 200mL of YEP liquid medium (Rif, 25mg/L; kana) ⁺ 50 mg/L), was shake-cultured at 28 ℃ until OD600 became about 1.0, the cells were collected by centrifugation (4000 rpm, 30min), and they were resuspended in a liquid resuspension medium (1/10B 5 medium, 30g of sucrose, 3.9gMES,1.67mg6-BA,0.25mgGA3, 40mgAS (pH 5.4)) until OD600 became about 0.8.

(4) Infection and co-culture: under aseptic conditions, the explants with good germination (green cotyledons and no obvious cracks) are taken, hypocotyls of about 0.5cm are reserved, the seed coats are peeled off, the cotyledons are longitudinally cut together with the hypocotyls, the embryos are removed, and the axillary parts of the cotyledons are scratched to make wounds. The scratched explants were soaked in the resuspended suspension for 30min (28 ℃, 120 rpm), the suspension was removed by occasional stirring, and then the cut wound site was placed down on a co-culture medium (1/10B 5 medium, 30g/L sucrose, 3.9g/LMES,5g/L agarose, 1.67mg/L6-BA,0.25mg/LGA3, 40mg/LAS,400mg/LL-cys,154.2mg/LDTT,158mg/LNaTHIo (pH5.4)) with a layer of sterile filter paper, covered with a dish and sealed, and placed in 25 ℃ for co-culture (dark) for 4 days.

(5) Washing and induced sprouting: taking out the explants after co-culture, washing with washing solution (1 XB 5 culture medium, 30g/L sucrose, 3.9g/LMES,1.67mg/L6-BA,0.25mg/LGA3, 50mg/LCef,500mg/LCarb (pH5.6)) for several times until the washing solution becomes clear, after the washing solution is sucked dry by sterile filter paper, obliquely inserting the explants into SIM culture medium (1 XB 5 culture medium, 30g/L sucrose, 3.5g/L gel, 0.58g/LMES,1.67mg/L6-BA,50mg/LCef,500mg/LCarb (pH5.6)), at 25 ℃,

Culturing under 16h light/8 h dark condition. Cutting off large buds of bud explants after 2 weeks, transferring the buds into SIM culture medium containing 5mg/L glufosinate, and screening and culturing for 14 days (25 ℃,16h light/8 h dark); after 14 days, the dead shoots, yellow leaves and yellow cotyledons of the explants were excised, and after a new wound was formed at the base, a new SEM medium (1 XB 5 medium, 30g/L sucrose, 3.5g/L gel, 0.58g/LMES,0.5mg/LGA3,0.1mg/LIAA,1mg/LZR,50mg/LAsp,100mg/LL-pyro,75mg/LCef,500mg/LCarb,3mg/LGlu (pH 5.6)) containing 4mg/L glufosinate was transferred and cultured for 6-8 weeks (25 ℃,16h light/8 h dark h), subcultured every two weeks under the same growth conditions.

(6) Inducing rooting and hardening seedlings: when the regenerated bud is extended to about 3-5cm and 3 or more leaves are grown, cutting off cluster buds from the base part, transferring the cluster buds to RM rooting culture medium (1/2B 5 culture medium, 15g of cane sugar, 0.59gMES,8g of agar powder and 1mg of IBA (pH5.7)), and culturing for about 10 days under the conditions of 25 ℃ and 16h of light/8 h of dark to induce rooting; when the root system grows to have 2-3 main roots and the root length is more than 3 cm, opening the culture pot and hardening seedlings for 3 days (covering a freshness protection bag, adding sterilized distilled water into the pot and preserving moisture).

(7) Transplanting: taking out the green regenerated seedlings from the culture tank, cleaning root culture media with distilled water, transplanting the seedlings into sterilized mixed nutrient soil (a mixture of nutrient soil and vermiculite, the volume ratio =2 1), tightly wrapping the pots with preservative films, placing the pots in an artificial culture incubator (25 ℃,16h light/8 h dark) for acclimation for 1-2 weeks, and harvesting seeds after 2-3 months.

Detection of 1.3T0 generation plant bar gene

When a plant formed by transforming the T0 generation cotyledon node is transplanted in nutrient soil by a culture tank, 1/3 of young leaves are cut, DNA is extracted by using a plant genome DNA extraction kit (Tiangen), and PCR detection of transgenosis is carried out. Using the selection of the resistance gene bar (the sequence of bar-F/R is shown below), 30. Mu.L system: DNA template 1. Mu.L, 2 XPCRBUffer 15. Mu.L, rTaq 2. Mu.L (Takara), 10. Mu.M primers bar-F/R1. Mu.L each, ddH ₂ O10 μ L, reaction conditions: 94 ℃ for 5min,35 cycles (94 ℃ for 1min,60 ℃ for 30s,72 ℃ for 30 s), 72 ℃ for 10min. The result of 1% agarose electrophoresis separation imaging is shown in FIG. 10, wherein lane M is the D2000 molecular weight standard; lane 1 is a positive control; lane 2 is a negative control; lanes 3-9 are PCR amplified fragments. The results of using the above DNA solution for PCR identification to detect transgenic positive plants using QuickStix PAT/bar transgenic test paper (LibertylinkRstrip; catalogNumberAS013LS, obtained from EnviroLogix, USA) are shown in FIG. 11, which is a graph showing1 in (a) is a non-transgenic plant; 2 is negative transgenic plant; 3-9 are T0 generation regenerated seedlings, the screening result is verified again, and meanwhile, plants (plants with target bands indicated by arrows in PCR amplification and detection test paper) with positive resistance gene bar are selected and screened.

The sequence used is shown below (5 '→ 3'):

bar-F(SEQ ID NO.7)：AGAAACCCACGTCATGCCAGT

bar-R(SEQ ID NO.8)：TCTGCACCATCGTCAACCACT

identification of 1.4T1 generation plants

The T0 generation identification obtains 13 positive plants in total, wherein 11 seeds are harvested in total from 6 plants, and 7 plants are not fruitful. The obtained seeds are planted in nutrient soil (a mixture of the nutrient soil and vermiculite, the volume ratio is = 2.

(1) Coating glufosinate-phosphine: when the third three-compound leaf of the T1 generation soybean plant is completely unfolded, marking 1/3 of the leaf tip with a marker pen, dipping 150mg/L glufosinate with a brush pen, and smearing the leaf after 3-5 days, wherein the result is shown in FIG. 12, wherein A in the figure is wild type leaf smeared with glufosinate; b in the figure is positive transgenic plant leaves coated with glufosinate-glufosinate, and the result shows that after wild soybean leaves are coated with glufosinate-glufosinate, large-area green loss occurs at the upper ends of the leaves, 11T 1 transgenic mutant plants are generated, 5 mutant soybean leaves do not generate obvious green loss, leaves of the other 6 mutant plants generate green loss and plant death in different degrees, and plant lines (M-1, M-2, M-3, M-7 and M-9) with leaves not generating green loss are selected for PCR identification again.

(2) And (3) PCR identification: 1/3 of the young leaves are cut, and DNA is extracted by using a plant genome DNA extraction kit (Tiangen) for PCR detection of transgenosis. The bar gene reaction system (the primer is bar-F/R) and the reaction conditions are the same as 1.3; the reaction system and the PCR condition of the GmAP2-a gene are amplified by the RT-PCR, a primer is GmAP2-aF/R,1% agarose gel electrophoresis separation is carried out, gel cutting and recovery are carried out, then sequencing is carried out by a company, the sequencing result is compared with the sequence of a mutation site, the sequencing comparison result is shown in figure 13, compared with a wild plant WT, in the target site area of the GmAP2-a gene, four basic group deletions are generated at the same position of mutants M-1 and M-3; m-2 is subjected to single base deletion; m-7 and M-9 were unchanged.

1.5 phenotypic characterization of transgenic cultures

Wild type and 11 seeds are respectively planted in nutrient soil, the seeds are cultured in an artificial climate chamber (24 ℃,16h illumination/8 h darkness), only 3 plants (M-1, M-2 and M-3) are true positive plants (target site base is deleted) through the identification and sequencing of the various technologies, the plant morphological characteristics are observed, the result is shown in figure 14, wherein WT in the figure is a wild type plant, M-1, M-2 and M-3 are mutant T1 generation plants respectively, and the result shows that the mutant T1 generation seedlings obtained by gene editing have the phenomena of plant dwarfing, internode shortening, flower organ shortening and selfing sterility compared with the wild type.

1.6 Paraffin section preparation

Flower organs of wild type and positive mutant plants were taken, fixed with 70% FAA, prepared by conventional paraffin sectioning, 10 μm in section thickness, stained with safranin-fast green, gel-blocked, observed and photographed under a microscope set-up (OlympusBH 2-C5060 WZ), by the specific steps of:

(1) Slicing: the material fixed by 70% FAA was dehydrated by alcohol step by step, cleared by xylene, waxed, embedded in paraffin, then tabletted, stained by safranin-fast green double staining, canada gum seal. The operation method comprises the following steps:

(1) and (3) dehydrating: material was graded by 70% faa followed by 70% ethanol (2 h) → 85% ethanol (2 h) → 95% ethanol (overnight) → 100% ethanol (1 h), respectively;

(2) and (3) transparency: after dehydration, respectively carrying out exchange once during 1/3 xylene +2/3 absolute ethyl alcohol (2 h) → 1/2 xylene +1/2 absolute ethyl alcohol → 2/3 xylene (2 h) +1/3 absolute ethyl alcohol (2 h) → pure xylene (1 h pure xylene);

(3) wax dipping: wax crumbs were added to the cleared material to saturation, placed in a 37 ℃ incubator overnight, and the next day the samples were placed in a 56-61 ℃ (2 ℃ above the melting point of paraffin) wax immersion chamber and half of the xylene was replaced with pure wax. Changing half of the stock solution after 2h, changing the stock solution into pure wax after 2h, and finally changing the pure wax twice at an interval of 1h;

(4) embedding: a paper box with proper size is prepared in advance, dissolved paraffin is poured in, and the material is embedded into a wax block.

(5) Slicing: determining the direction of a tangent plane, trimming the wax block into a shape convenient for slicing, and slicing and sticking. The slices were 10 μm thick and were made into serial slices.

(2) Safranin-fast green double staining: spreading the dried slices, soaking in xylene for 15min, and then performing upward rehydration: dripping 1-2 drops of dimethylbenzene, immersing the sliced sample for 1-2 min, and immersing the sliced sample for 1-2 min at each cloth time interval in the dyeing dripping process, wherein the steps are as follows: 2/3 dimethylbenzene +1/3 ethanol, 1/2 dimethylbenzene +1/2 ethanol, 1/3 dimethylbenzene +2/3 ethanol, absolute ethanol, 95% ethanol, 85% ethanol, 70% ethanol, 50% ethanol, 30% ethanol, distilled water, safranine dyeing for 2-3 min, washing off floating color by distilled water, then downwards dehydrating, 30% ethanol, 50% ethanol, 70% ethanol, 85% ethanol, dropwise adding fast green dyeing for about 30s, quickly washing off floating color by 95% ethanol, 100% ethanol, 1/3 dimethylbenzene +2/3 ethanol, 1/2 dimethylbenzene +1/2 ethanol, 2/3 dimethylbenzene +1/3 ethanol, dimethylbenzene, each step for 1min, and finally sealing by neutral gum.

The paraffin section microscopic examination result is shown in fig. 15, wherein a in the figure is a wild type, b is a mutant, and the result shows that the pollen of the stamen of the mutant plant develops normally, but the anther tapetum can not crack normally, so that the pollen of the mutant can not spread normally to the pistil stigma, and the normal selfing and fructification can not be caused, and the male sterility is caused.

While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.

Claims (8)

1. A soybean GmAP2-a gene is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 3.

2. The protein encoded by the GmAP2-a gene of claim 1, wherein the protein has an amino acid sequence shown as SEQ ID No. 4.

3. An over-expression recombinant vector comprising the soybean GmAP2-a gene of claim 1.

4. A gene knock-out recombinant vector comprising the soybean GmAP2-a gene of claim 1.

5. A recombinant bacterium comprising the overexpression recombinant vector of claim 3 or the knock-out recombinant vector of claim 4.

6. The recombinant strain of claim 5, wherein the recombinant strain is selected from the group consisting of Agrobacterium tumefaciens.

7. The use of the soybean GmAP2-a gene of claim 1 in soybean breeding.

8. The use of claim 7, wherein said use comprises preparing a soybean male sterile line.

Images