CN115925839A - Phytophthora sojae STT3 protein and its coding gene and application - Google Patents

Abstract

The invention discloses an oligosaccharyl transferase STT3 subunit from phytophthora sojae, and a coding gene and application thereof. The sequence of the oligosaccharyl transferase STT3 subunit protein provided by the invention is shown as a sequence 2; the coding gene is shown in sequence 1. Experiments prove that the protein provided by the invention plays an important role in the growth and development process of the phytophthora sojae, and the specific expression is that the phytophthora sojae hyphae growth is slowed down, the number of sporangium and zoospore is reduced, the pathogenicity is reduced and the like after the protein is deleted. The conclusion provides a technical basis for researching the development and pathogenic molecular mechanism of the phytophthora sojae, and provides a molecular target for the research and development of novel bactericides in the future.

Description

Phytophthora sojae STT3 protein and its coding gene and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an STT3 (staurosporine and temperature-sensitive) protein PsSTT3 from Phytophthora sojae, and a coding gene and application thereof.

Background

Phytophthora sojae is a typical phytophthora species phytopathogenic oomycete that was selected by the Molecular Plant Pathology journal as one of the most important 10 phytopathogenic oomycetes in 2015. Phytophthora sojae is a pathogenic bacterium responsible for phytophthora sojae, a typical soil-borne phytopathogen, with billions of dollars of economic losses caused by root and stem rot caused by phytophthora sojae in the united states each year. Phytophthora sojae causes rot of soybean seeds, root rot, stem rot and seedling blight, and the infected soybean plant typically shows the symptoms of rot starting from the root, gradually spreading from bottom to top along the stem, and forming a macroscopic brown lesion in the stem, especially the base of the stem.

The life history of phytophthora sojae is divided into asexual and sexual stages. In the sexual reproduction stage, phytophthora sojae forms oospores through the cooperation with zonum. The oospore has thick wall and rich content, can resist extreme environment, can survive in soil for years, and can directly germinate to produce hypha to infect host plants under proper conditions as an initial infection source. In the vegetative propagation stage, the sporangium of the phytophthora sojae can germinate directly to form hyphae and can also differentiate to form zoospores, so that the infection cycle of diseases is indirectly carried out. The zoospores have short service life, can be differentiated to form resting spores, and further germinate into hyphae or directly form secondary zoospores. The zoospores form resting spores on the surface of roots, directly invade the roots through germinating hyphae or invade the roots through wounds and natural orifices, live bodies are parasitic in plant bodies in a hypha mode and continuously expand, the living bodies are converted into dead body vegetative parasites after about 15 hours, and necrotic spots begin to appear on the surface of host plants.

In conclusion, the growth rate of phytophthora sojae hyphae, and the formation of sporangia and zoospores are important factors influencing the occurrence and development of diseases. If the growth rate of the phytophthora sojae hyphae is slowed down, the phytophthora sojae sporangium and zoospore are blocked, and the capability of infecting host plants by pathogenic bacteria is reduced, the harm of phytophthora sojae root rot can be controlled.

Disclosure of Invention

Through research of the inventor, the PsSTT3 gene knockout in the phytophthora sojae can cause the phytophthora sojae to be lethal, and the PsSTT3 gene knockout has the potential of serving as a molecular target of a novel bactericide. The PsSTT3 protein in the phytophthora sojae is closely related to the growth rate of phytophthora sojae hyphae and the yield of sporangia and zoospores, and the normal infection cycle of plant diseases is positively related to the growth rate of the hyphae, the yield of the sporangia and the yield of the zoospores. Therefore, the STT3 protein can be regulated and controlled to slow the growth of hyphae and block the generation of normal sporangium and/or zoospore, so that the capability of phytophthora sojae for infecting a host is weakened, and the occurrence and the development of phytophthora sojae root rot are controlled.

Therefore, one of the objects of the present invention is to provide a kind of phytophthora sojae STT3 protein, named PsSTT3, derived from phytophthora sojae strain P6497, which is A1) or A2) or A3) or A4) as follows:

a1 ) the amino acid sequence is a protein as shown in sequence 2;

a2 A fusion protein obtained by connecting a label to the N terminal and/or the C terminal of the protein shown in the sequence 2;

a3 Protein derived from the protein shown in the sequence 2 with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2;

a4 An amino acid sequence having a similarity of 75% or more, preferably 85% or more, more preferably 95% or more to the amino acid sequence shown in SEQ ID No.2 and having the same function as the amino acid sequence shown in SEQ ID No. 2.

In order to facilitate the purification of the protein in A1), labels such as Poly-Arg (RRRRRRR), poly-His (HHHHHHHHHHHHHH), FLAG (DYKDDDDK), strep-tag II (WSHPQFEK), C-myc (EQKLISEEDL) and the like can be connected to the amino terminal or the carboxyl terminal of the protein consisting of the amino acid sequence shown as the sequence 2 in the sequence table.

The proteins in A1) to A4) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. The coding gene of the protein in A2) to A4) can be obtained by deleting codons of one or more amino acid residues in a DNA sequence shown in a sequence 1 in a sequence table, and/or carrying out missense mutation of one or more nucleotide pairs, and/or connecting the coding sequence of the label at the 5 'end and/or the 3' end.

Wherein, in A1), the sequence 2 (PsSTT 3) in the sequence table is composed of 888 amino acid residues.

It is another object of the invention to provide nucleic acid molecules encoding said STT3 protein. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be an RNA, such as an mRNA, hnRNA, or tRNA, and the like.

Wherein, the coding gene of the STT3 protein is B1) or B2) or B3):

b1 A DNA molecule shown by a nucleotide sequence shown by a sequence 1 in a sequence table;

b2 A cDNA molecule or DNA molecule having 75% or more, 85% or more, or 95% or more identity to the nucleotide sequence of B1) and encoding the STT3 protein;

b3 ) hybridizes under stringent conditions with the nucleotide sequence defined in B1) or B2) and encodes the above STT3 protein.

The sequence 1 in the sequence table of the coding gene consists of 2756 nucleotides; the 1 st-270 th and 360 th-2756 th nucleotides from the 5' end of the sequence 1 are coding sequences and code a protein (PsSTT 3) shown in a sequence 2 in the sequence table.

The RNA molecule is obtained by transcription of the coding gene;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

c1 An RNA sequence having a similarity of 75% or more, more preferably 85% or more, still more preferably 95% or more to an RNA sequence transcribed from the DNA sequence shown in SEQ ID No.1 and having the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 1;

c2 An RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 1.

The DNA sequence of the invention can be molecularly hybridized with the DNA sequence shown as the sequence 1 under strict conditions and encodes the DNA sequence of STT3 protein shown as the sequence 2. The stringent conditions may be conditions in which hybridization is carried out at 65 ℃ using a solution obtained by 0.5% SDS in 6 XSSC, and then membrane washing is carried out once using 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

It is a further object of the present invention to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector and can also be a recombinant cloning vector. In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector; the microorganism may be a yeast, bacterium, algae or fungus, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, any one of the following D1) to D10) may be used as follows:

d1 An expression cassette containing the encoding gene of claim 2;

d2 A recombinant vector containing the coding gene of claim 2, or a recombinant vector containing the expression cassette of D1);

d3 A recombinant microorganism comprising the gene encoding the gene of claim 2, or a recombinant microorganism comprising the expression cassette of D1), or a recombinant microorganism comprising the recombinant vector of D2);

d4 A transgenic plant cell line containing the coding gene according to claim 2 or a transgenic plant cell line containing the expression cassette according to D1);

d5 A transgenic plant tissue containing the coding gene according to claim 2, or a transgenic plant tissue containing the expression cassette according to D2);

d6 A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2);

d7 A nucleic acid molecule that inhibits expression of the encoded gene of claim 2;

d8 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule according to D7);

d9 Nucleic acid molecules that inhibit translation of the RNA molecules described above;

d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line for the production of the nucleic acid molecule according to D9).

The fifth purpose of the invention is to provide the phytophthora sojae STT3 protein and the nucleic acid molecule encoding the STT3 protein or the application of the biological material containing the nucleic acid molecule encoding the STT3 protein.

The application is any one or more of the following 1) to 5):

1) The application of the compound in regulating (increasing or reducing) the yield of phytophthora sojae sporangium and/or zoospore;

2) The application of the compound preparation in regulating (increasing or reducing) the growth rate of phytophthora sojae hyphae;

3) The application of the compound in regulating (improving or reducing) the host infection ability of phytophthora sojae;

4) The application of the compound in regulating (increasing or reducing) the pathogenicity of the phytophthora sojae on a host;

5) The application in inhibiting and/or killing phytophthora sojae;

preferably, wherein, the application comprises inhibiting or inactivating the transcription of the coding gene in the sequence 1, or inhibiting the translation of the RNA molecule, or inhibiting and/or inactivating the activity of the STT3 protein in the sequence 2 to realize the application 1) -5).

In the application, the phytophthora sojae sporocyst yield, the zoospore yield, the hypha growth rate and the host infection capacity are regulated and controlled by inhibiting the transcription of the coding gene, or inhibiting the translation of the RNA sequence, or inhibiting and/or inactivating the activity of the STT3 protein, so that the growth of phytophthora sojae can be inhibited and/or killed.

The invention further provides an STT3 protein shown in a sequence 2 in the sequence table and application of a coding gene shown in a sequence 1 in the sequence table in screening of phytophthora sojae serving as a bacteriostatic or bactericide target.

The seventh purpose of the invention is to provide a method for screening or assisting in screening phytophthora sojae bacteriostasis and/or bactericide, wherein the method comprises the step of applying an object to be detected to the phytophthora sojae, and when the object to be detected can inhibit the transcription of the DNA sequence, or inhibit the translation of the RNA sequence, or inhibit and/or inactivate the STT3 protein shown above, the object to be detected is a candidate phytophthora sojae bacteriostat and/or bactericide.

The eighth purpose of the invention is to provide a method for reducing the activity of phytophthora sojae, which comprises the following steps: inhibiting transcription or deleting the coding gene as described above, or inhibiting translation of the RNA molecule, or inhibiting and/or inactivating the activity of the STT3 protein as described above;

wherein the activity of the phytophthora sojae is reduced by reducing the infection capacity and/or pathogenicity of the phytophthora sojae on a host, and/or reducing the growth rate of the phytophthora sojae, and/or inhibiting the yield of sporangium and zoospore of the phytophthora sojae;

in the above method, the inactivation of the protein is achieved by inhibiting or reducing the expression of a gene encoding the activity to be inhibited or the protein to be inactivated, specifically, by gene knockout or by gene silencing.

The gene knockout refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. Gene knockout is the inactivation of a specific target gene by a change in the DNA sequence.

The gene silencing refers to the phenomenon that a gene is not expressed or is under expressed on the premise of not damaging the original DNA. Gene silencing can occur at two levels, one is at the transcriptional level due to DNA methylation, differential staining, and positional effects, and the other is post-transcriptional gene silencing, i.e., inactivation of a gene at the post-transcriptional level by specific inhibition of a target RNA, including antisense RNA, co-suppression (co-suppression), gene suppression (quelling), RNA interference (RNAi), and micro-RNA (miRNA) -mediated translational suppression, among others.

Preferably, the protein shown by the sequence 2 in the sequence table is inactivated by knocking out and silencing the gene shown by the sequence 1 in the sequence table in the phytophthora sojae;

in two embodiments of the present invention, the methods for gene knockout of the above genes are CRISPR/Cas 9-based gene knockout method and antisense RNA-based gene silencing method.

Specifically, the gene knock-out method based on CRISPR/Cas9 is to obtain the recombinant bacteria inactivated by the target knock-out protein through the screening of soybean phytophthora transfected by a Donor vector of the target gene, sgRNA and Cas9 coexpression plasmids.

The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of a target gene to be knocked out, a Dodor DNA sequence (which can be a gene sequence such as NPTII, GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are sequentially connected.

The sgRNA and Cas9 co-expression plasmid is a vector for co-expressing sgRNA segments targeting a target gene to be knocked out and codes of Cas9, wherein the target gene to be knocked out is PsSTT3 gene, and the sgRNA sequence targeting the PsSTT3 gene is GAACAGGAAGTAGAACCA.

Preferably, the sgRNA and Cas9 co-expression plasmid is obtained by taking a pff 515 vector as a starting vector, annealing sgRNA of a PsSTT3 gene to obtain a double-stranded sgRNA coding sequence, and inserting the double-stranded sgRNA coding sequence between Nhe I and Bsa I enzyme recognition sites of the pff 515 vector.

The application of the substance for inhibiting the expression and/or activity of the STT3 protein in the preparation of the phytophthora sojae bactericide also belongs to the protection scope of the invention.

In the above application, the substance inhibiting the expression and/or activity of STT3 protein is a substance inhibiting the expression of STT3 protein and/or inhibiting the transcription of a gene encoding STT3 protein and/or inhibiting the translation of an RNA molecule obtained by the transcription of a gene encoding STT3 protein.

Experiments prove that the PsSTT3 protein provided by the invention plays a role in the growth and development process of phytophthora sojae. A PsSTT3 gene knockout homozygous transformant cannot be obtained by using a CRISPR/Cas9 gene editing technology, and the PsSTT3 gene knockout can cause lethality of phytophthora sojae. By using CaCl ₂ PEG-mediated protoplast transformation of PsSTT3 gene-silenced transformants which have a significantly altered growth compared to the wild-type parent strain, essentially comprising: the PsSTT3 silent transformants have slower hyphal growth rate, lower sporangial and zoospore yields, and a weaker ability to infect host plants. Therefore, the STT3 protein in the phytophthora sojae plays an important role in the processes of vegetative growth, asexual reproduction and host infection of the phytophthora sojae. The invention provides technical support for the research of pathogenic mechanism of phytophthora sojae and provides a potential molecular target for the research and development of novel bactericides in the future.

Drawings

FIG. 1 is a histogram of colony diameters (5 d on V8 solid medium) of P6497 (WT) strain of P.sojae, empty vector control transformant F3 (CK), series of PsSTT3 gene silencing transformants (S1-8, S1-31, S1-68 represent PsSTT3 gene silencing transformants).

FIG. 2 is a histogram of the virulence of P6497 (WT) strain of P.sojae, CK (F3) empty vector control transformant, and series of strains of the PsSTT3 gene-silencing transformant (S1-8, S1-31, S1-68 represent PsSTT3 gene-silencing transformants).

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but do not limit it. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Soybean epidemic disease mould strain P6497: standard strains presented to professor Brett m.tyler, oregon state university, usa, were deposited at the seed pathology and fungicide pharmacology laboratory, the institute of plant protection, chinese agriculture university, and publicly available from chinese agriculture university.

Culture medium or reagent formula:

10% of v8 solid medium: 100ml of V8 vegetable juice, 1.4g of CaCO ₃ Stirring, mixing, diluting with deionized water 10 times, adding 900ml deionized water, adding 15g agar, and wet-heat sterilizing at 121 deg.C for 20min.

10% V8 liquid medium: 100ml V8 vegetable juice, 1.4g CaCO ₃ Stirring, centrifuging at 12000rpm for 5min, collecting supernatant, diluting with deionized water 10 times, and performing high pressure moist heat sterilization at 121 deg.C for 20min.

S + L solid medium: 10ml basal medium (100 mg (NH) ₄ ) ₂ SO ₄ ，100mg MgSO ₄ ·7H ₂ O，30mg CaCl ₂ ·2H ₂ O，3mg ZnSO ₄ ·7H ₂ O，60mgK ₂ HPO ₄ ，30mg KH ₂ PO ₄ Distilled water to 100 ml), 100mg lecithin, 40mg glucose, KOH to adjust pH to 7.0, stirring thoroughly, 15g agar powder, adding water to 1L, and high-pressure moist heat sterilizing at 121 deg.C for 20min.

Nutrient pea medium (NPB): adding 125g of peas into 1L of deionized water, carrying out high-pressure damp-heat sterilization at 121 ℃ for 20min, and filtering with gauze to obtain pea nutrient solution; 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO ₃ 、0.1g CaCl ₂ 、0.5g MgSO ₄ 、3.0g KNO ₃ 、1.0g K ₂ HPO ₄ 、1.0gKH ₂ PO ₄ Stirring, mixing, centrifuging at 3000rpm for 10min or standing for 30min, collecting supernatant, diluting to 1L with semen Pisi Sativi nutrient solution, adding 15g agar powder into solid culture medium (NPBA), and wet-heat sterilizing for 20min. Before use, 2ml of vitamin stock solution (Biotin 6.7X 10) was added in a sterile operating table ^-7 g/ml；Folic acid 6.7×10 ^-7 g/ml；L-inositol 4.0×10 ^-5 g/ml；Nicotinic acid 4.0×10 ^-5 g/ml；Pyridoxine-HCl 6.0×10 ^-4 g/ml；Riboflavin 5.0×10 ^{- 5} g/ml；Thiamine-HCl 1.3×10 ^-3 g/ml) and 2ml of stock solution of trace elements (FeC) ₆ H ₅ O ₇ ·3H ₂ O 5.4×10 ^-4 g/ml；ZnSO ₄ ·7H ₂ O 3.8×10 ^-4 g/ml；CuSO ₄ ·5H ₂ O 7.5×10 ^-4 g/ml；MgSO ₄ ·H ₂ O 3.8×10 ^-5 g/ml；H ₃ BO ₃ 2.5×10 ^-5 g/ml；Na ₂ MoO ₄ ·H ₂ O 3.0×10 ^-5 g/ml)。

Pea Mannitol medium (Pea Mannitol, PM): 91.1g mannitol, 1g CaCl ₂ ，2g CaCO ₃ Adding about 900ml of pea nutrient solution, stirring and mixing for about 30min, centrifuging at 3000rpm for 10min or standing for 30min, collecting supernatant, adding pea nutrient solution to a constant volume of 1L, adding 15g of agar powder into solid culture medium (PMA), and performing moist heat sterilization for 20min.

Hypha enzymatic hydrolysate (20 ml): 10ml 0.8M mannitol, 0.8ml 0.5M KCl,0.8ml 0.5M 4-morpholine ethanesulfonic acid, 0.4ml 0.5M CaCl ₂ 0.12g of cellulase (Calbiochem, cat.No. 219466), 0.12g of lyase (Sigma, cat.No. L1412), sterile ultrapure water to 20ml, mixing and dissolving, filtering and sterilizing by a 0.22 mu m filter membrane, and preparing the preparation at present.

MMG solution (250 ml): 18.22g of mannitol, 0.76g of MgCl ₂ ·6H ₂ O,2.0ml 0.5m 4-morpholinoethanesulfonic acid (pH = 5.7), made to 250ml with ultra pure water, and sterilized by filtration through 0.22 μm filter membrane.

W5 solution: 0.1gKCl,4.6g CaCl ₂ ·2H ₂ O,2.25g NaCl,7.8g glucose and ultrapure water were dissolved to a volume of 250ml, and the solution was filtered through a 0.22 μm filter and sterilized.

PEG-CaCl ₂ Solution (40% w/v): 12g PEG 4000,3.75ml 0.5M CaCl ₂ 3ml of sterile ultrapure water, and 0.22 μm filter membrane filtration sterilization.

Example 1 acquisition of Phytophthora sojae STT3 protein PsSTT3 and its coding Gene

In this example, the phytophthora sojae STT3 protein PsSTT3 and its coding gene (or cDNA) can be obtained by using DNA (or cDNA) of the phytophthora sojae standard strain P6497 as a template and amplifying the template with the primers listed in table 1. Wherein, the material extracted by DNA or RNA can be hypha of the phytophthora sojae standard strain P6497. Wherein, the coding gene PsSTT3 of PsSTT3 is shown as sequence 1 in the sequence table, and the sequence 1 in the sequence table consists of 2756 nucleotides; the 1 st-270 th site and the 360 th-2756 th site from the 5' end of the sequence 1 are coding sequences and code a protein PsSTT3 shown in a sequence 2 in a sequence table. The above proteins or genes may also be artificially synthesized.

TABLE 1 PsSTT3 full-Length encoding Gene amplification primers

Example 2 construction of Phytophthora sojae PsSTT3 Gene knockout vector and obtaining of PsSTT3 Gene knockout heterozygous transformant

In this example, a method for constructing a gene knockout vector based on CRISPR/Cas9, a sequence of a related vector, and an NPT II gene sequence are disclosed in "Fang, y., and Tyler, b.m. (2016.). Efficient differentiation and replacement of an effector gene in the yeast photophora sojae using CRISPR/case 9.Molecular plant pathway, 17 (1), 127-139." and "Fang, y., cui, l., gu, b.a., arenedodo, f.and Tyler, b.m. (2017. Efficient gene editing in the yeast photophora sojae using CRISPR/CRISPR 9. Current.protoc.microbal.44, 2a 1.1-21a.1.26". The pBluescript II SK + homology arm vector plasmid (Donor vector), sgRNA and Cas9 co-expression plasmid pYF515 used in this example were given by professor Brett m.tyler, oregon state university, usa.

The Donor vector pBS-NPTII-STT3 used in this embodiment; the sgRNA and Cas9 co-expression plasmid pYF515-STT3; the specific construction method is as follows:

1) Construction of pBS-NPTII-STT 3: DNA of the strain of Phytophthora sojae P6497 was used as a template, and TaKaRa-In-Fusion _ Tools online website (http:// www. Clone. Com/US/Products/Cloning _ and _ component _ Cells/Cl) was usedThe hanging _ Resources/Online _ In-Fusion _ Tools) design primers amplify 1000bp upstream sequence of target gene PsSTT3 (shown as sequence 3 In the sequence table, obtained by amplification through primers shown as pBS-NPTII-STT3-F1 and pBS-NPTII-STT3-R1 In Table 2), NPTII gene sequence (obtained by amplification through primers with primer sequences shown as pBS-NPTII-STT3-F2 and pBS-NPTII-STT3-R2 In Table 2 and using pYF515 skeleton plasmid as template of NPTII gene), 1000bp downstream sequence of PsSTT3 (shown as sequence 4 In the sequence table, obtained by amplification through primers with primer sequences shown as pBS-NPTII-STT3-F3 and pBS-NPTII-STT3-R3 In Table 2), and In-

The HD Cloning Kit sequentially fusion-ligates the three amplified fragments into the Cloning vector pBluescript II SK + (EcoR V restriction enzyme), transfers the ligation product into E.coli DH5 alpha competent cells, after overnight culture at 37 ℃, amplifies and sequence verifies the clone using the universal primer M13F (sequence: 5-.

2) Construction of pYF515-STT 3: design website EuPaGDT (http:// grna. Cteg. Uga. Edu /) and RNA structure on-line analysis tool (http:// RNA. Urmc. Rochester. Edu/RNAstructure Web/Servers/Predict1/predict1. Html), select sgRNA sequence (sgSTT 3: GAACAGGAAGTAGAACCA, targeting PsSTT3 gene SEQ ID No.1, position 1348-1367), which specifically targets PsSTT3 gene and has weak secondary structure, send to company to synthesize forward and reverse sgRNA sequence primers with NheI and BsaI cleavage sites and HHribozyme. Dissolved in sterile water to 100. Mu.M solution. Annealing reaction to synthesize double-chain sgRNA sequence, wherein the reaction system comprises: mu.l of forward strand solution, 3. Mu.l of reverse strand solution, 3. Mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 4. Mu.l of 0.5M NaCl, 21. Mu.l of ultrapure sterile water, pipetting, mixing, reacting at 100 ℃ for 2min, naturally cooling to room temperature for 4h, and then diluting the reaction solution by 500 times. Mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 50ng pYF515 vector (Nhe I/Bsa I double digested), 4. Mu.l of diluted double stranded sgRNA solution, 1. Mu.l of T4 DNA Ligase, and 20. Mu.l of sterile ultrapure water were prepared, reacted at room temperature for 30min, transformed into E.coli DH 5. Alpha. Competent cells using 5. Mu.l of the ligation product, cultured overnight at 37 ℃, followed by colony PCR verification of RPL41_ Pseq _ F (sequence: 5-CAAGCCTCTTCTTGCTGAC TG) TG- (3 ')/M13F (sequence: 5-TGTAAAACCGGAGGCCAGT 3'), and sequencing verification of positive clones, and the recombinant vector which was verified to express sgRNA correctly was named pYF515-STT3.

TABLE 2 primer sequences for vector construction

3) Obtaining of phytophthora sojae PsSTT3 gene knockout heterozygous transformant:

using CaCl ₂ PEG-mediated protoplast transformation method for the preparation of PsSTT3 knockout transformants, genetic transformation of oomycetes is disclosed in the literature "Fang, Y., and Tyler, B.M. (2016. Efficient deletion and reproduction of an effector gene in the fungal phytophtora sojae using CRISPR/Cas9.Molecular plant Pathology,17 (1), 127-139".

The knockout transformant is obtained by specifically transferring the Donor vector, sgRNA and Cas9 co-expression plasmids (pBS-NPTII-STT 3 and pYF515-STT 3) of the knockout gene PsSTT3 obtained in the example 1 into protoplasts of phytophthora sojae P6497, culturing and screening the grown transformant at 25 ℃ by using a G418 resistant V8 solid medium plate, collecting mycelium of a suspected transformant, and extracting DNA for PCR sequencing verification. After several trials, no PsSTT3 knockout homozygous transformants were obtained, only PsSTT3 knockout heterozygous transformants (Δ STT 3-81) were obtained.

Example 3 obtaining of F2 Generation of Single oospore progeny of PsSTT3 knockout heterozygous transformants

The PsSTT3 knockout heterozygous transformant (. DELTA.STT 3-81) was used as the F1 generation, inoculated into V8 medium, cultured at 25 ℃ in the dark for 45d, cut out of the medium containing the mycelia (about 60 dishes), added with 150ml of sterile water, and disrupted by a tissue homogenizer (10 s/time. Times. X16 times). Centrifuging at 4000g for 10min to enrich oospore, and removing supernatant. Sterile water was added to 50ml, mixed well, centrifuged at 650g for 5min, shaken gently and the supernatant discarded. Adding sterile water to 30ml, centrifuging at 650g for 5min, shaking gently, and discarding the supernatant. Adding sterile water to 15ml, mixing, filtering with 100um filter membrane, centrifuging at 650g for 5min, and removing supernatant. 20mL of a lyase solution (0.3 g of lyase, 0.12g of cellulase, and water to a volume of 20 mL) was added thereto, and the mixture was gently shaken at 25 ℃ for 1 hour (55 rpm). Centrifuge at 650g for 5min and remove supernatant. Adding 25ml sucrose solution (10%, 10g sucrose, adding water to constant volume to 100 ml), mixing, centrifuging 400g for 5min, shaking gently, and removing supernatant. Adding 20ml sterile water, mixing, centrifuging at 400g for 5min, removing supernatant, and washing oospore. Coating on S + L culture medium, irradiating with 25 deg.C black light lamp (wavelength of 365 nm) for 3-10d, picking germinated oospore on v8 culture medium, and extracting DNA for verification.

The results showed that, in the F2 generation of the monospore progeny of the obtained 170 PsSTT3 gene knockout heterozygous transformants, the genotype STT3/STT3: STT3/NPT2II: the NPT2II/NPT2II ratio is 64:106:0, a PsSTT3 gene knockout homozygous transformant with the genotype of NPT2II/NPT2II is not obtained, the fact that the PsSTT3 knockout can cause phytophthora sojae to be lethal is proved, and PsSTT3 protein can be used as a potential molecular target of a future novel bactericide.

Example 4 construction of Phytophthora sojae PsSTT3 Gene silencing vector and obtaining of PsSTT3 Gene silencing transformant

1) Construction of pTOR-STT 3: a primer containing a restriction site is designed by using cDNA of an E.sojae strain P6497 as a template, a target gene PsSTT 3-911 bp sequence (shown as a sequence 1 in a sequence table and obtained by amplification through primers shown as pTOR-XbaI-STT3-F and pTOR-EcoRI-STT3-R shown in a table 3) is amplified, the amplified fragment is reversely connected into a cloning vector pTOR241 (XbaI and EcoRI restriction enzyme) by utilizing T4 ligase, a connection product is transferred into a DH5 alpha competent cell of escherichia coli, after overnight culture at 37 ℃, a primer pTOR-F (sequence: 5' and CTCACCTGTCTGCAAGTCTCA and 3') and a pTOR-R (sequence: 5' and TTGTATTAAATGCATACACA) are used for amplification, sequencing and verification cloning, and a recombinant expression vector containing the PsSTT3412-911bp reverse sequence connected in sequence is named as pTOR-3.

2) Acquisition of Phytophthora sojae PsSTT3 Gene silencing transformant

Using CaCl ₂ PEG-mediated protoplast transformation method for the preparation of PsSTT3 gene silencing transformants, methods for genetic transformation of oomycetes are disclosed in the literature "Fang, Y., and Tyler, B.M. (2016. Efficient differentiation and reproduction of an effector gene in the fungal phytophtora sojausing CRISPR/Cas9.Molecular plant Pathology,17 (1), 127-139".

The PsSTT3 gene silencing transformant is obtained by transferring the vector pTOR-STT3 of the silencing gene PsSTT3 obtained in the example 4 into a protoplast of phytophthora sojae P6497, culturing and screening grown transformants through a G418 resistant V8 solid culture medium plate at 25 ℃, collecting mycelium of suspected transformants, extracting DNA, and carrying out PCR and Q-PCR verification to obtain PsSTT3 silencing transformant series strains (S1-8, S1-31 and S1-68). The control transformant F3 (CK) was transformed with the empty vector plasmid, which had undergone the same transformation procedure but had not silenced PsSTT3.

TABLE 3 PsSTT3 full-Length encoding Gene amplification primers

Example 5 biological shape analysis of Phytophthora sojae PsSTT3 Gene silencing transformants

1. Hyphal growth rate detection

The wild type P6497 (WT) strain of Phytophthora sojae, the control transformant F3 (CK), and the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in example 4 were inoculated in the center of a sterile petri dish (diameter 9 cm) to which 15ml of V8 solid medium was added, cultured at 25 ℃ for 5 days in the dark, and the colony diameter of each strain was measured by the cross method, 3 replicates per strain.

The results show that the hyphal growth rate of all the tested PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) was significantly reduced compared to the wild type Phytophthora sojae strain P6497 (WT) and the control transformant F3 (CK) (FIG. 1). The experimental result shows that the PsSTT3 protein participates in regulating and controlling the hypha growth of the phytophthora sojae.

2. Sporangium and zoospore number and morphology detection

Preparing 10% of V8 solid and liquid culture media, respectively inoculating a wild type phytophthora sojae strain P6497 (WT), an empty vector control transformant F3 (CK) and PsSTT3 silent transformant series strains (S1-8, S1-31 and S1-68) obtained in example 4 on the V8 solid culture medium, culturing in the dark at 25 ℃ for 5-7d, punching 10 bacterial cakes of each strain by using a 5mm puncher, placing the bacterial cakes in a sterile culture dish (the diameter is 9 cm) of 20ml V8 liquid culture medium, after culturing in the dark at 25 ℃ for 3d, washing with 20ml of sterile deionized water for 1 time at intervals of 30min, washing for 5 times, adding 10ml of deionized water for constant volume, placing the bacterial cakes in the dark at 25 ℃ for 4-6h, and observing the number and the form of sporangia sporangium on the bacterial cakes through a microscope; after 8-10h, the number and morphology of zoospores produced in sterile water were observed by microscope and repeated 3 times.

The results show that the number of sporangia and the number of released zoospores of the PsSTT 3-silencing transformant series strains (S1-8, S1-31, S1-68) obtained in example 4 are significantly reduced compared with the wild type Phytophthora sojae strain P6497 (WT) and the control transformant F3 (CK), but the sporangia and zoospores are normal in morphology, which indicates that the PsSTT3 protein mainly affects the number of Phytophthora sojae sporangia and zoospores (Table 4).

TABLE 4 sporulation yield of PsSTT3-silenced transformants

Note: ap 6497 (WT) represents the parent strain; f3 (CK) represents a strain into which an empty vector plasmid has been transferred; s1-8, S1-31, S1-68 represent 3 strain PsSTT3 silent transformants.

The values in the b table represent mean values. + -. Standard deviation. The Turkey method in the one-way ANOVA analysis in DPS software was used to calculate the differences in biological traits between the wild-type strain and the different transformants, with the same letters in the same column indicating that there was no significant difference (P < 0.01).

3. Oospore number and morphology detection

The wild type P6497 (WT) strain of Phytophthora sojae, the control transformant F3 (CK), and the PsSTT3 silent transformants obtained in example 4 (S1-8, S1-31, S1-68) were inoculated into the center of a sterile petri dish (diameter 9 cm) to which 15ml of V8 solid medium was added, cultured at 25 ℃ for 14d in the dark, and the number and morphology of oospore production were observed by a microscope for 3 replicates.

The results show that the number of oospores of the PsSTT 3-silencing transformants obtained in example 4 (S1-8, S1-31 and S1-68) is not significantly changed compared with the wild strain P6497 (WT) and the control transformant F3 (CK), and the morphology is normal.

4. Detection of virulence

The soybean plant variety to be tested was japanese green, planted in a nursery tray (540 mm × 280mm, 80 plants per hole), and the culture medium was 2: adding a proper amount of deionized water into the peat soil and the vermiculite which are mixed according to the proportion of 1, and culturing for 7 days in a greenhouse (27 +/-2 ℃ and 24h of dark treatment) for later use. Beating 5mm fungus cakes on a phytophthora sojae V8 solid culture medium cultured for 5-7 days, inoculating one fungus cake at about 1cm of hypocotyl of soybean yellow flower seedlings, inoculating 10-20 yellow flower seedlings to each fungus, performing dark moisture preservation culture at 25 ℃ for 3 days, and investigating the length (mm) of lesion spots of phytophthora sojae infected with the hypocotyl of the yellow flower seedlings.

The results show that the pathogenicity of the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in example 4 is significantly reduced compared to the wild type Phytophthora sojae strain P6497 (WT) and the control transformant F3 (CK) (FIG. 2). This indicates that the PsSTT3 protein has the ability to participate in regulating and controlling phytophthora sojae infection in host plants.

Claims (10)

1. The oligosaccharyl transferase STT3 subunit protein of phytophthora sojae is the protein of the following A1):

a1 The amino acid sequence is the protein shown as the sequence 2;

a2 A fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein shown in the sequence 2;

a3 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 2 and has the same function and is derived from the protein shown in the sequence 2;

a4 An amino acid sequence having a similarity of 75% or more, preferably 85% or more, more preferably 95% or more to the amino acid sequence shown in SEQ ID No.2 and having the same function as the amino acid sequence shown in SEQ ID No. 2.

2. A gene encoding the STT3 protein of claim 1; preferably, the coding gene is the following B1) or B2) or B3):

b1 A DNA molecule shown by a nucleotide sequence in a sequence 1 in a sequence table;

b2 A cDNA molecule or DNA molecule having 75% or more or 85% or more or 95% or more identity to the nucleotide sequence of B1) and encoding said STT3 protein of claim 1;

b3 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in B1) or B2) and encodes the STT3 protein of claim 1.

3. An RNA molecule transcribed from the coding gene of claim 2; preferably, the sequence of the RNA molecule is C1) or C2) as follows:

c1 An RNA sequence having a similarity of 75% or more, more preferably 85% or more, still more preferably 95% or more to an RNA sequence transcribed from the DNA sequence represented by SEQ ID No.1 and having the same function as the RNA sequence transcribed from the DNA sequence represented by SEQ ID No. 1;

c2 An RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 1.

4. A biological material containing a nucleic acid molecule related to the coding gene of claim 2 or the RNA molecule of claim 3, which is any one of the following D1) to D10):

d1 An expression cassette containing the encoding gene of claim 2;

d2 A recombinant vector containing the coding gene of claim 2 or a recombinant vector containing the expression cassette of D1);

d3 A recombinant microorganism comprising the gene encoding the gene of claim 2, or a recombinant microorganism comprising the expression cassette of D1), or a recombinant microorganism comprising the recombinant vector of D2);

d4 A transgenic plant cell line containing the coding gene according to claim 2 or a transgenic plant cell line containing the expression cassette according to D1);

d5 A transgenic plant tissue containing the coding gene according to claim 2, or a transgenic plant tissue containing the expression cassette according to D2);

d6 A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2);

d7 A nucleic acid molecule that inhibits expression of the encoding gene of claim 2;

d8 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule according to D7);

d9 A nucleic acid molecule that inhibits translation of the RNA molecule of claim 3;

d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line for the production of the nucleic acid molecule according to D9).

5. The use of the STT3 protein of claim 1, the encoding gene of claim 2, the RNA molecule of claim 3, or the biomaterial of claim 4, wherein: the application is any one or more of the following 1) to 5):

1) The application in regulating and controlling the yield of phytophthora sojae sporangium and/or zoospore;

2) The application in regulating and controlling the growth rate of phytophthora sojae hyphae;

3) The application of the compound in regulating and controlling the host infection capacity of phytophthora sojae;

4) The application of the phytophthora sojae in regulating and controlling the pathogenicity of the phytophthora sojae on hosts;

5) The application in inhibiting and/or killing phytophthora sojae is provided.

6. Use according to claim 5, which comprises effecting use of 1) -5) by inhibiting or inactivating transcription in the encoding gene of claim 2, or inhibiting translation of the RNA molecule of claim 3, or inhibiting and/or inactivating the STT3 protein of claim 1.

7. Use of the STT3 protein of claim 1, the coding gene of claim 2, the RNA molecule of claim 3, the biomaterial of claim 4, the combination of proteins or DNA of claim 5 as a target for screening phytophthora sojae as a bacteriostatic or bactericidal agent.

8. A method for screening or assisting in screening phytophthora sojae bacteriostatic and/or bactericidal agent, the method comprising applying an object to be detected to the phytophthora sojae, wherein when the object to be detected is capable of inhibiting transcription of the coding gene of claim 2, or inhibiting translation of the RNA molecule of claim 3, or inhibiting or inactivating the activity of the STT3 protein of claim 1, the object to be detected is the phytophthora sojae bacteriostatic and/or bactericidal agent.

9. A method for reducing the activity of Phytophthora sojae comprising the steps of: inhibiting transcription or deleting the encoding gene of claim 2, or inhibiting translation in the RNA molecule of claim 3, or inhibiting or inactivating the activity of the STT3 protein of claim 1;

wherein the activity of the phytophthora sojae is reduced by reducing the infection capacity and/or pathogenicity of the phytophthora sojae on a host, and/or reducing the hyphal growth rate of the phytophthora sojae, and/or inhibiting the yield of sporangium and/or zoospore of the phytophthora sojae;

preferably, the protein shown in the sequence 2 in the sequence table is inactivated by gene silencing of the gene shown in the sequence 1 in the sequence table in the phytophthora sojae.

10. Use of a substance that inhibits the expression and/or activity of the STT3 protein of claim 1 in the preparation of a phytophthora sojae fungicide; preferably, the substance which inhibits the expression and/or activity of the STT3 protein is a substance which inhibits the expression of the STT3 protein and/or inhibits the transcription of the gene encoding the STT3 protein and/or inhibits the translation of an RNA molecule resulting from the transcription of the gene encoding the STT3 protein.

Images