CN115919888A - Nucleic acid interference medicine composition for treating various tumors - Google Patents

Abstract

The invention relates to a nucleic acid interference medicine composition for treating various tumors, which comprises siRNA molecules capable of binding to mRNA coding TGF-beta 1 and inhibiting the activity of TGF-beta 1 and siRNA molecules capable of binding to mRNA coding VEGFR2 and inhibiting the activity of VEGFR 2. The invention adopts the nucleic acid interference technology, combines the siRNA molecule which can be combined with the mRNA for coding TGF-beta 1 protein in the mammalian cell and the siRNA molecule which can be combined with the mRNA for coding VEGFR2 protein in the mammalian cell for use, simultaneously inhibits the expression of TGF-beta 1 protein target gene and VEGFR2 protein target gene, generates synergistic effect and effectively inhibits the growth of various tumors in mammalian tissues.

Description

Nucleic acid interference medicine composition for treating various tumors

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a nucleic acid interference pharmaceutical composition for treating various tumors.

Background

The VEGF/VEGFR2 signaling pathway promotes neovascularization in tumor tissue.

Angiogenesis or neovascularization is an integral part of the homeostatic regulatory network, as blood vessels are pathways for nutrient transport and waste metabolism to cells. Angiogenesis occurs during organism development, regeneration of lesions, and many tumorigenic processes. More than 70 years ago, idea et al (Ide et al,1939 algire et al, 1945) observed that "angiogenic growth stimulators" stimulate the strong growth of new blood vessels in tumor tissue and confer growth advantages on tumor cells, thereby suggesting a concept of angiogenesis involved in tumorigenesis. Judah Folkman (Folkman, 1971) in 1971 suggested that anti-angiogenesis could be applied to the treatment of cancer and other related diseases, and renewed interest in this field.

Angiogenesis occurs in normal physiologyIn the process, it is controlled by Sub>A number of regulatory factors, but primarily by the vascular endothelial derived growth factor (VEGF) family, including the most prominent subtypes in tissue, VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF ₁₆₅ . However, among other cell types reported, the primary target cell for VEGF is endothelial cells. VEGF acts by binding to its cell membrane receptors VEGFR1, VEGFR2 and VEGFR 3. The VEGF receptor is a Receptor Tyrosine Kinase (RTK) consisting of an extracellular 7 immunoglobulin homeodomain, a transmembrane domain, and an intracellular regulatory tyrosine kinase domain. VEGF receptors are expressed primarily on endothelial cells. After binding to VEGFRII, VEGF triggers a series of signal transduction pathways that stimulate endothelial cell proliferation, migration, and neovascularization.

The function of VEGF/VEGFR is primarily studied in pathological processes such as tumorigenesis and hypertrophic scarring, although physiologically, VEGF/VEGFR is essential for maintaining homeostasis in many normal tissues. Under normal conditions, VEGF production is only increased when the tissue is hypoxic. However, VEGF is found to be overexpressed in most cancers (Kerbel, 2008) and leads to aberrant neovascularization of structure within the tumor and surrounding tissues to meet the nutritional requirements for uncontrolled proliferation of the tumor. (Ferrara, 2010, jain,2003 Nagy et al, 2009).

Due to the study of VEGF function, therapeutic strategies against the VEGF/VEGFR signaling pathway were developed. Avastin is but one of the successful drugs (Ferrara and adams, 2016. The humanized monoclonal antibody has been widely applied to the treatment of various cancers such as colon cancer, non-squamous non-small cell lung cancer (NSCLC), renal Cell Carcinoma (RCC), glioblastoma multiforme, ovarian cancer, cervical cancer and the like. However, treatment with combination drugs has become a common standard of care in cancer treatment. Simultaneous connection of multiple targets is considered to have better therapeutic efficacy (Gerber and Ferrara, 2005). Preclinical studies have consistently shown that the use of VEGF inhibitors in combination with cytotoxic drugs may increase or provide synergistic benefits.

TGF-. Beta.is one of the key factors in the process of tumorigenesis.

TGF- β s are one of pleiotropic cytokines and are involved in basic physiological processes such as proliferation, differentiation, metabolism, apoptosis, and the like. Homeostasis of multicellular organisms is maintained and regulated by a complex network of hormones and cytokines, particularly in mammals. TGF-. Beta.s are present only in mammals, with TGF-. Beta.1 expression being the most abundant and ubiquitous. Although TGF- β 1 is reported to exert its distal effect primarily as an effector locally, it is mainly secreted as a latent complex and then stored in the extracellular matrix. (Crane, J.L. & Cao, X.2014; annes, J.P., munger, J.S. & Rifkin, D.B.2003). There is evidence that TGF- β can respond to disorders that cause local tissue inflammation, such as various injuries, and act rapidly to restore local ECM homeostasis. (Annes, J.P., munger, J.S. & Rifkin, D.B.2003). Thus, the temporal and spatial activation of this growth factor is crucial for its in vivo context-dependent physiological effects.

As a pleiotropic regulator of homeostasis, TGF- β/T β RII receptor signaling generally regulates downstream molecules Smads through canonical arms, and TGF- β/T β RII receptor signaling also activates members of mitogen-activated protein (MAP) kinase signaling molecules, including JNK, p38, ERK, and PI 3K/AKT pathways [ Ikushima h. And k.miyazono,2010 ], in a non-canonical manner.

TGF-beta R is composed of TGF-beta RI, TGF-beta RII and TGF-beta RIII. [ B.Bierie and H.L.Moses ]. Both TGF-ligands function by binding to a TGF-receptor heterotetrameric complex formed between two TGF- β RIs and two TGF- β RIIs. Both receptors exhibit Ser/Thr kinase activity and transduce signals via the downstream component molecule Smads (Wrana J.L., et al, 1994); dijke p.ten et al).

TGF-. Beta.is considered to be an important participant in tumorigenesis and tumor progression, the term "transformation" being generated by its ability to transform normal fibroblasts from an anchorage-dependent growth phenotype to an anchorage-independent colony phenotype in soft agar, a hallmark of tumorigenesis (Keski-Oja, J., lyons, R.M., and Moses, H.L. (1987). However, later studies found that TGF-. Beta.can act as a potent inhibitor of cell proliferation both in early preneoplastic growth (Roberts AB, & Wakefield LM. (2003); adam B.et; (1994), and in late-stage progression and metastatic cancers as a promoter of tumor cell migration and proliferation (Lu SL, et al.1999). TGF-. Beta.growth inhibition and increased expression of TGF-. Beta.is associated with malignant transformation and progression of many tissues/organs, including breast cancer as well as gastric, endometrial, ovarian, and melanoma cancers, studies indicate that the genetic and increased expression of TGF-. Beta.2011 is associated with increased by the mechanisms of secretory transformation and increased signaling of tumor cells, and increased by stimulation of the mechanisms of epithelial proliferation (MEK.2011 signaling).

Both TGF-. Beta.1 and VEGF are important factors in synergistically inducing immune tolerance in the Tumor Microenvironment (TME).

Elevated serum levels of TGF- β are often observed in later stages of cancer patients, and are thought to be compensatory responses of cells to loss of TGF- β inhibition. (Gold, L.I.1999). Whereas elevated TGF- β can induce proliferation of regulatory T cells (Tregs). Tregs in TME induce T cell inertia and depletion and promote immune tolerance (Fontenot, j.d.et al, 2003. Nakamura et al reported that overexpression of TGF-. Beta.enhanced tumor growth by inhibiting anti-tumor T lymphocyte responses in CT26 colorectal cancer cells in immunocompromised Balb/c mice (Nakamura et al 2014). At this stage, tumor cells may escape TGF- β mediated antiproliferative control by unstable signal activation of the non-classical arm of the signaling pathway or by somatic mutation of TGF- β pathway components (Seoane j.2006). For example, TGF-. Beta.can increase the secretion of MCP-1 (monocyte chemotactic protein-1, also known as CCL-2) and actively recruit tumorigenic monocytes into TME. (

-Valdes n, et al, 2011) report that anti-PD-1 resistance may be associated with elevated levels of CCL-2, CCL-7, CCL-8 and CCL-13. These chemotaxisOverexpression of the gene is regulated by TGF- β activation, suggesting that TGF- β is a key enhancer of immune tolerance and also an obstacle that must be overcome to achieve optimal efficacy of immune checkpoint therapy (Hugo w, et al, 2016). TGF-. Beta.contributes in one aspect to the establishment of an inhibitory TME model and in another aspect mediates expression, secretion and activation of integrins and VEGF and Matrix Metalloproteinases (MMPs) that stimulate endothelial cell migration, thereby promoting tumor angiogenesis and metastatic spread (Padua)&Massague;2009; hagedorn, et al, bachmeier,2001.Pertovaara, et al.1994.Kang, Y.et al.2003.de Jong, J.S., et al,1998.Hasegawa et al.2001.Schadendorf et al.1993.Tai and Wang, 2018.). Meanwhile, the TGF-beta neutralizing antibody is used for inhibiting TGF-beta signals, so that angiogenesis of human breast cancer and prostate cancer can be inhibited, and the key effect of TGF-beta as an angiogenesis promoting factor in a tumor process is further verified (Tuxhorn, et al 2002).

Dual targeted combination therapy for inhibiting tumor growth

Studies have shown that homeostasis is regulated and controlled by increasingly complex networks of signal pathways that interact to compensate for each other's function. However, these cellular-interacting signals present difficulties and obstacles to monotherapy. For example, TGF β, a pleiotropic cytokine, can be signaled by MAPK molecules in either the Smads-dependent classical or non-classical arm.

Moreover, increasing data suggests that anti-angiogenic therapy may lead to the appearance of more aggressive tumors. (Bergers G, et al, 2008) recent reports provide several mechanisms of tumor resistance to anti-angiogenic therapy. For example, in NSCLC, a therapeutic approach targeting VEGF should be paired with EGFR-targeted therapy, and vice versa, since both pathways are embedded in NSCLC and can complement each other. Clinical trials employing dual VEGF/EGFR inhibition have been performed in NSCLC patients (Koh YJ, et al 2010). RNAi (RNA interference) is a physiological regulatory mechanism for mRNA expression. It is a post-transcriptional gene silencing mechanism (PTGS). siRNA (small interference RNA) is a short segment of a double-stranded RNA molecule of 13-25bp in length. The antisense strand of the siRNA duplex can pair to a specific region on the mRNA molecule. Within the cytoplasm, the antisense strand will become wedged into a protein particle called RISC (RNA interference silencing complex) and then anneal to the target mRNA. Thereafter the enzymatic components of the RISC will cleave the mRNA molecule, initiating the mRNA degradation process. Thus, RNAi is a sequence that specifically downregulates a target mRNA molecule. The introduction of exogenous synthetic siRNA has been shown to be an effective method of controlling specific genes during the development and clinical stages.

Strategies for pairing anti-TGF- β/TGF- β RII with other IO-targeting drugs are gaining attention. Bintrafursp alpha is an anti-PD-L1/TGF-beta RII fusion structure, and destroys the immune tolerance of TME by simultaneously blocking two paths. (Hanne Lind, et al, 2020) have reported that Bintrafusp α can prevent tumor cells from undergoing TGF- β induced EMT and render tumor cells more sensitive to other treatments. (David JM, 2017) has demonstrated that Bintrafursp α recruits NK and T cells to TME and enhances their cytolytic capacity against tumor cells. Another activity reported by (bat E, & Massague j.2019) of bintrafusip α is enhancement of human tumor cell lysis mediated by antibody-dependent cell-mediated cytotoxicity (ADCC) (Grenga I, 2018).

Another example is dual targeted combination therapy of VEGF and BMP-9/10 (bone morphogenetic protein-9/10, akatsu Y, et al 2016). BMPs are members of the TGF superfamily, and have been reported to inhibit tumor growth by inhibiting angiogenesis.

Dual targeting to two disease targets can be performed simultaneously with drugs from small molecules to different drug classes such as monoclonal antibodies and nucleic acids (including ASOs and siRNAs). However, synthetic sirnas have chemically similar properties, which is a unique advantage, since sirnas targeting different disease genes can be administered in combination in the same formulation, which makes multi-target combination therapy easier.

However, TGF-beta 1 is a potential combined target, and the research of dual targeting combination treatment of tumors and/or diseases with abnormal angiogenesis of TGF-beta 1 and VEGF is not seen.

Disclosure of Invention

In a first aspect, the invention provides a nucleic acid interfering pharmaceutical composition for treating a plurality of tumors, the nucleic acid interfering pharmaceutical composition comprising an siRNA molecule capable of binding to an mRNA encoding TGF- β 1 and inhibiting the activity of TGF- β 1, and an siRNA molecule capable of binding to an mRNA encoding VEGFR2 and inhibiting the activity of VEGFR 2.

In the present invention, the siRNA molecule is a double-stranded RNA oligonucleotide (dsRNA) that inhibits the expression of multiple genes, including VEGFR2 and TGF- β 1.

In particular, the dsRNA inhibits expression of one or more of a VEGF pathway gene, a TGF- β pathway gene, a pro-angiogenic gene, a pro-inflammatory gene, an endothelial cell proliferation gene.

Preferably, the sequence of the sense strand of the siRNA molecule capable of binding to the mRNA encoding TGF-beta 1 and inhibiting TGF-beta 1 activity is at least selected from the group consisting of SEQ ID Nos. 1 to 10 and one of SEQ ID Nos. 1 to 10 with specific modifications, and the antisense strand is at least selected from the group consisting of SEQ ID Nos. 11 to 20 and one of SEQ ID Nos. 11 to 20 with specific modifications complementary to the sense strand;

and/or, the sequence of the sense strand of the siRNA molecule capable of binding to mRNA encoding VEGFR2 and inhibiting VEGFR2 activity is at least selected from any one of SEQ ID Nos. 21-63 and 21-63 with specific modification, and the sequence of the antisense strand is at least selected from one of SEQ ID Nos. 64-106 and 64-106 with specific modification, which is complementary to the sense strand.

Further preferably, the siRNA molecule capable of binding to mRNA encoding TGF-. Beta.1 and inhibiting TGF-. Beta.1 activity has the sequence:

sense strand: 5 '-AACUAUUGCUCUCUCAGCUCCADDT-3' (SEQ ID No. 3),

antisense strand: 5 '-UGGAGCAUGAAGCAAUAGUUdTdT-3' (SEQ ID No. 13),

and/or the presence of a gas in the gas,

sense strand: 5 '-CGGCAGCUGUACAUUGACUUDTdT-3' (SEQ ID No. 6),

antisense strand: 5'-AGUCAAUGUACAGCUGCCGdTdT-3' (SEQ ID No. 16),

and/or the presence of a gas in the gas,

the sequence of the siRNA molecule capable of binding with mRNA encoding VEGFR2 and inhibiting VEGFR2 activity is as follows:

sense strand: 5 '-GCCUAGUGUUCUUGAUUUGAUdTdT-3' (SEQ ID No. 40),

antisense strand: 5 '-AUCAAGAAACACCUAGGCdTdT-3' (SEQ ID No. 83),

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-GGUCCAUUCAAAUCUCAAdTdT-3' (SEQ ID No. 41),

antisense strand: 5 '-UUGAGAUUGAAAUGGACCDTdT-3' (SEQ ID No. 84),

and/or the presence of a gas in the gas,

a sense strand: 5 'GACCAACAUGGAGUCGUGUACAUUA-3' (SEQ ID No. 23),

antisense strand: 5-,

and/or the presence of a gas in the gas,

sense strand: 5,

antisense strand: 5-,

and/or the presence of a gas in the atmosphere,

sense strand: 5'-GCAUCAGCAUAAGAAACUUdTdT-3' (SEQ ID No. 44),

antisense strand: 5 '-AAGUUCUUAUGCUGAGDCTTdT-3' (SEQ ID No. 87),

and/or the presence of a gas in the gas,

a sense strand: 5 '-GCUGACAUUGUCUdTdT-3' (SEQ ID No. 46),

antisense strand: 5 '-AUAGACCGAUACAUGUCAGCdTdT-3' (SEQ ID No. 89),

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-GGACUGGCUUGGCCCAAUdTdT-3' (SEQ ID No. 56),

antisense strand: 5 '-AUUGGGCCAAGCCAGCUCCdTdT-3' (SEQ ID No. 99),

and/or the presence of a gas in the atmosphere,

sense strand: 5'-GGAAAAAACAAAACUGUAAdTdT-3' (SEQ ID No. 57),

antisense strand: 5 '-UUACGUUGUUUUUCCdTdT-3' (SEQ ID No. 100).

Further preferably, the specific modification is one or more of 2' methoxy modification, 2' fluoro modification and 5' phosphorylation modification.

Still further preferably, the sequence of an siRNA molecule capable of binding to mRNA encoding TGF-. Beta.1 and inhibiting TGF-. Beta.1 activity and having nucleoside with specific modifications is as follows:

sense strand: 5 '-mAMAMMCmUmUfUfGfCmUmUmmCMmGmCMmmCMmmmmMadT-3',

antisense strand: 5 '-PmufGmGmAmGmGmAmmAfAmmGmUdTdT-3',

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-mCMGmGmAmGfCfUfGmAMmAMmUmUmGmAmCmUdTdT-3',

antisense strand: 5 '-PmaGmMemAmUmGmGmGmUmGmCmCmGmGmGmdTdT-3',

and/or, the sequence of an siRNA molecule capable of binding to mRNA encoding VEGFR2 and inhibiting VEGFR2 activity with a specific modification of a nucleoside is as follows:

sense strand: 5 '-mGmCmUmGfUfGfUmUmUmUmCumMemUmUmUmGmAmUdTdT-3',

antisense strand: 5 '-PmaUmCMAmmAmmGmAmAmmCmAfCmAmGmCdTdT-3',

and/or the presence of a gas in the atmosphere,

a sense strand: 5 '-mGmGMmCMmMafUfUmCMAMAMAMAMAMAMAMAMAMAMAMAMATdT-3',

antisense strand: 5 '-PmUmGmAmmUmUmGmAmAmaUmGmGmCdCtTdT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmAmCmAmmAmmAmmAmUmGmGmGfUfCmGmUmGmmmmMemUmUmA-3',

antisense strand: 5 '-PmaAmAmUmGmGmmmMemMemGmAmfUmMemUmGmUmGmGmGmUmC-3',

and/or the presence of a gas in the gas,

a sense strand: 5 '-mCMCMmUmGmGMmCMmMafAfUfCmAmmAmAmAmmUmAMmA-3',

antisense strand: 5 '-PmaUmAMAMAMAMAMUMUmGmUmGmGmUmGmGmUmGmGmGmG-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmAmCmUmGfGfCfUmUmUmGmCmCmAmAmUdTdT-3',

antisense strand: 5 '-PmafUmUmGmGmCmAmmCmAmmCmAmmGmCymcMcmcdTdT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmAmAmAmAmAmafAfAfafCmAmAmAmAmaCmUmGmAmmAddT-3',

antisense strand: 5 '-PmaUmAmmMemGMAMUmUmUmUmUmmmmmmmmmmmmmmMecGDT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmCMAmUmCMAFGfCfAmUmAmmAmmGmAmmUdTdT-3',

antisense strand: 5 '-PmaAmGmUmUmUmUmUmUmUmGmCmUmGmGmCdTdT-3',

and/or the presence of a gas in the gas,

a sense strand: 5 '-mGmCmGmGmAmCfAfUfGmAmmMemGmMemUmUdTdT-3',

antisense strand: 5 '-PmaUmAmmGmAmCmGmAmmmmmmUfGmCMmGmCdTdT-3'

Wherein m represents that the 2' position of the nucleoside sugar ring is modified by methoxyl, f represents that the 2' position of the nucleoside sugar ring is modified by fluorin, and P represents phosphorylation modification of 5' end.

Preferably, the nucleic acid interfering pharmaceutical composition further comprises one or more of other RNA molecules capable of binding to mRNA encoding a pro-angiogenic gene, mRNA encoding an endothelial cell proliferation gene, mRNA encoding a VEGF pathway gene, mRNA encoding a TGF- β 1 pathway gene, or mRNA encoding VEGFR 2.

Preferably, the ratio of the mass of the siRNA molecule that binds to mRNA encoding TGF- β 1 and inhibits the activity of TGF- β 1 to the mass of the siRNA molecule that binds to mRNA encoding VEGFR2 and inhibits the activity of VEGFR2 is about (0.5-2): 1, more preferably (0.5 to 1.5): 1, more preferably (0.8 to 1.2): 1.

preferably, the nucleic acid interference pharmaceutical composition also includes a drug carrier for delivering siRNA molecules.

Further preferably, the drug carrier is selected from one or more of a polycationic binder, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer graft polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer graft polyacetal, a ligand-functionalized cationic polymer, or a ligand-functionalized hydrophilic polymer graft polymer.

According to some embodiments, the pharmaceutical carrier is a histidine-lysine copolymer.

More specifically, the histidine-lysine copolymer is selected from the group consisting of H3K4b (i.e., HKP), H3K (+ H) 4b (i.e., HKP (+ H)) or HK-RCOOH of the HKP series, having a lysine backbone or RCOOH scaffold with 3-4 branches, containing multiple repeats of histidine, lysine or asparagine.

More preferably, the N/P mass ratio of the histidine-lysine copolymer to the siRNA molecule is 1.5/1 to 3.5/1, and more preferably 2/1 to 3/1.

Further preferably, the nucleic acid-interfering pharmaceutical composition is a nanoparticle.

The second aspect of the invention also provides the application of the nucleic acid interference medicine composition in treating tumors and/or diseases with abnormal angiogenesis.

Specifically, the diseases comprise one or more of breast cancer, colon cancer, pancreatic cancer and melanoma.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

the invention adopts the nucleic acid interference technology, combines the siRNA molecule which can be combined with the mRNA for coding TGF-beta 1 protein in the mammalian cell and the siRNA molecule which can be combined with the mRNA for coding VEGFR2 protein in the mammalian cell for use, simultaneously inhibits the expression of TGF-beta 1 protein target gene and VEGFR2 protein target gene, generates synergistic effect, and effectively inhibits the growth of various tumors in mammalian tissues.

Drawings

FIG. 1 preliminary screening results of candidate VEGFR2 siRNA sequences in MDA-MB-231 cell line;

FIG. 2 Primary screening of candidate VEGFR2 siRNA sequences in U87MG cell line;

FIG. 3 shows the preliminary screening results of candidate TGF-beta 1 siRNA sequences in DLD-1 cell line;

FIG. 4 preliminary screening results of candidate TGF-. Beta.1 siRNA sequences in RKO cell lines;

FIG. 5 shows preliminary screening results of candidate TGF-beta 1 siRNA sequences in U87MG cell line;

FIG. 6 shows the preliminary screening results of candidate TGF-beta 1 siRNA sequences in PANC-1 cell line;

FIG. 7 comparison of EC50 profiles of candidate sequences before and after modification of VEGFR2 siRNA in MDA-MB-231 cell line;

FIG. 8 comparison of EC50 profiles of candidate sequences before and after the siRNA modification of VEGFR2 in U87MG cell line;

FIG. 9 comparison of EC50 profiles of candidate sequences before and after VEGFR2 siRNA modification in PANC-1 cell line;

FIG. 10 comparison of the EC50 curves of candidate sequences before and after TGF-. Beta.1 siRNA modification in different cell lines (U87 MG, PANC-1, RKO, bxPC 3);

FIG. 11 comparison of EC50 curves of candidate sequences before and after TGF-. Beta.1 siRNA modification in different cell lines (SK-Hep-1, HUCCT, A549 and DLD-1);

FIG. 12 comparison of the mass ratio of siRNA molecules of VEGFR2 to TGF- β 1 in compositions;

FIG. 13. In vivo pharmacodynamic assay of STP355 in a mouse pancreatic cancer (PANC-1) xenograft model;

FIG. 14. In vivo pharmacodynamic assay of STP355 in a mouse model of breast cancer (MDA-MB-231) xenograft tumor;

FIG. 15. In vivo pharmacodynamic assay of STP355 human colorectal carcinoma tumor at PDL1 site (MC 38-hPDL 1) in an immunocompetent mouse model;

figure 16 in vivo pharmacodynamic assay of stp355 on melanoma (B16) in an immunocompetent mouse model;

FIG. 17 comparative pharmacodynamic testing of combination drug and single drug in a mouse breast cancer (MDA-MB-231) transplantable tumor model;

FIG. 18 comparative in vivo pharmacodynamic testing of combination and modified drugs in a mouse pancreatic cancer (PANC-1) xenograft model;

FIG. 19 comparative test of stability of modified and unmodified drugs in C57BL/6J mice.

Detailed Description

These and other aspects of the invention are described in more detail below.

In one embodiment, the invention provides a method of dual down-regulating tolerogenic and angiogenic factors in tissue cells of a mammal comprising administering to the tissue a therapeutically effective amount of the composition. In another embodiment, a method of inducing apoptosis in a tumor tissue of a mammal is provided comprising administering to the tissue a therapeutically effective amount of the composition. In another embodiment, a method of reducing tumor size in a tissue of a mammal is provided comprising administering a therapeutically effective amount of the composition to a tumor. In another embodiment, a method of reducing a tumor in a tissue of a mammal is provided comprising co-administering to the tissue a therapeutically effective amount of the composition and a therapeutic monoclonal antibody.

siRNA molecules can produce additive or synergistic effects in a cell, depending on the composition and structure of a particular molecule. In preferred embodiments, they produce a synergistic effect.

As used herein, an "siRNA molecule" is a double-stranded oligonucleotide, which is a short double-stranded polynucleotide that, when introduced into a cell, interferes with the process of post-transcriptional translation of a target gene in the cell, thereby affecting the level of synthesis of the target protein. For example, it targets and binds to a complementary nucleotide sequence in a single-stranded (ss) target RNA molecule, such as an mRNA or a microrna (miRNA). The target RNA is then degraded by the cell. These molecules are constructed by techniques well known to those skilled in the art. These techniques are described in U.S. patents. Nos. 5,898,031, 6,107,094, 6,506,559, 7,056,704 and european patent nos. 1214945 and 1230375, which are incorporated by reference in this protocol. As is conventional in the art, when a nucleic acid sequence is used to represent an siRNA molecule, it is generally referred to as the sense strand of the duplex.

siRNA molecules may be made from naturally occurring ribonucleotides, i.e., ribonucleotides found in living cells, or one or more nucleotides thereof may be chemically modified by techniques known in the art. In addition to modifications at one or more levels of its individual nucleotides, the backbone of the oligonucleotide may also be modified. Other modifications include the use of small molecules (e.g., sugar molecules), amino acid molecules, peptides, cholesterol and other macromolecules to couple to the siRNA molecule.

In one embodiment, the molecule is an oligonucleotide of about 19 to about 35 base pairs in length. In one aspect of this embodiment, the molecule is an oligonucleotide of about 19 to about 27 base pairs in length. In another aspect, the molecule is an oligonucleotide of about 21 to 25 base pairs in length. In all of these aspects, the molecule may have a blunt end at both ends, or may be sticky at both ends, or may have a blunt end at one end and a sticky end at the other end.

The relative amounts of the two different molecules and copolymers may differ in the compositions of the present invention. In one embodiment, the mass ratio of the two different siRNA molecules is about 1:1. the mass ratio of these siRNA molecules to copolymer was about 1. By these ratios, the composition forms nanoparticles having an average diameter of about 100-300 nm.

The invention includes a method for identifying a desired siRNA molecule comprising: (a) Creating a collection of siRNA molecules intended to target complementary nucleotide sequences in a target mRNA molecule, wherein the targeting strand of the siRNA molecules comprises various nucleotide sequences; (b) Selecting siRNA molecules that exhibit the highest desired effect on the target mRNA molecules in vitro, including primary screening and EC50 assays; (c) evaluating the selected siRNA molecule in an animal tumor model; and (d) selecting the siRNA molecule that exhibits the greatest silencing activity and therapeutic effect in the model.

The preferred animal model for verifying candidate siRNA is a nude mouse xenograft model. In another aspect, the animal disease model is an immunocompetent mouse model of a C57BL/B6 mouse. In one embodiment, the method further comprises adding a pharmaceutically acceptable carrier to each siRNA molecule selected in step (c) to form a pharmaceutical composition, and evaluating each pharmaceutical composition in an animal tumor model or models.

The siRNA sequences were prepared in such a way that each sequence could target and inhibit (at least) the same gene in both human and mouse or both human and non-human primates (tables 1 and 2). In one aspect, the siRNA molecule binds to a human mRNA molecule and a homologous mouse mRNA molecule. That is, the proteins encoded by the human and mouse mRNA molecules are substantially identical in structure or function. Thus, the therapeutic and toxic effects observed in mouse disease models provide a good understanding of what will occur in humans. More importantly, siRNA molecules tested in the mouse model are good candidates for pharmaceutical formulations for use in humans.

Selecting an siRNA molecule from the siRNA molecules in table 1 and table 2 that can simultaneously bind and induce degradation of TGF- β 1mRNA and VEGFR2 mRNA in a mammalian cell.

The siRNA molecules are conjugated to a pharmaceutically acceptable carrier to provide a pharmaceutical composition for administration to a mammal. In one aspect of this embodiment, the mammal is a laboratory animal, including dogs, cats, pigs, non-human primates, and rodents, such as mice, rats, and guinea pigs. In another aspect, the mammal is a human.

The carrier is a histidine-lysine copolymer, and can form nanoparticles containing siRNA molecules. In one aspect of this embodiment, the vector is selected from the group consisting of H3K4b, H3K (+ H) 4b, and HK-RCOOH in the HKP series, having a lysine backbone or an RCOOH scaffold with 3 or 4 branches, containing multiple repeats of histidine, lysine, or asparagine. When the aqueous HKP solution was mixed with siRNA at a ratio of 2.5:1, the nanoparticles (average diameter 100-300 nm) self-assemble when mixed. In another aspect of this embodiment, HKP has the formula: (R) K (R) - (R) K (X), wherein R = khhhkhhhkhhhhk, or R = khhhkhhhnhhhn, X = C (0) NH2, K = lysine, H = histidine, and N = asparagine. In another aspect of this embodiment, HKP has the formula: (R) K (R) - (R) K (X), wherein R = khhhkhhhhk, X = C (0) NH2, K = lysine, H = histidine. In another aspect of this embodiment, HKP has the formula: (R) -Lys (R) -Lys (R) -Gly-Ala-Pro-Gly-Ala-Pro-Ala-Pro-Gly-Ala-Pro-Gly-Arg-Arg-Arg-Gly-Val-Arg-COOH, wherein R = KHHHKHHHKHKHKHHHK.

In one embodiment, the composition is administered by injection into tumor tissue. In another embodiment, the composition is administered to a mammal by subcutaneous injection. In another embodiment, the composition is administered to the mammal intravenously. In a preferred embodiment, the mammal is a human.

The specific embodiment is as follows:

example 1 selection of Small nucleic acids specific for human and mouse TGF-. Beta.1 mRNA

According to a proprietary computer-based algorithm, we designed small nucleic acids for TGF-. Beta.1 (Table 1) that have the following characteristics: a. optimal thermodynamic characteristics; b. enhancing the combining ability with RISC; c. (ii) elimination of the immune activation domain; d. having human or human murine homology; e. searching the sequence through the intellectual property; f. blast was used to try to avoid "off-target effects"; g. multiple sequences do not interact when mixed in the cocktail. The most effective small nucleic acid for each gene was selected by Q RT-PCR (MyiQ, bio Rad) detection.

TABLE 1

Example 2 selection of Small nucleic acids specific for human and mouse VEGFR2 mRNA

Based on proprietary computer-based algorithms, we designed small nucleic acids for VEGFR2 (table 2) with the following characteristics: a. optimal thermodynamic characteristics; b. enhancing the combining ability with RISC; c. (ii) elimination of the immune activation domain; d. having human or human murine homology; e. searching the sequence through the intellectual property; f. blast was used to try to avoid "off-target effects"; g. multiple sequences do not interact when mixed in a cocktail. The most effective small nucleic acid for each gene was selected by Q RT-PCR (MyiQ, bio Rad) detection.

TABLE 2 screening of siRNA sequences targeting VEGFR2 mRNA

/>

Example 3.in vitro Effect of small nucleic acids of 25 nucleotides in length (25 mer) and 21 nucleotides in length (21 mer) Primary screening (cellular level, target for VEGFR 2)

The cell line used to screen for the most effective small nucleic acid should be one that is capable of expressing the target gene. In this example, human MDA-MB-231 cells (FIG. 1) and human U87 cells (FIG. 2) were used to screen for small VEGFR 2-specific nucleic acids.

MDA-MB-231 and U87 cells were seeded separately in 24-well cell plates (1X 10) ⁵ Per well) and then siRNAs (21 mer or 25mer or negative control) were transfected with commercial transfection reagents (lipo 2000) at a siRNA transfection concentration of 100nM. Meanwhile, untreated cells were set as a blank control. Total RNA was extracted from the cells 24h after transfection. Reverse transcription was performed using the kit to obtain cDNA according to the manufacturer's instructions. The relative level of expression of the target gene VEGFR2 mRNA was determined by real-time PCR and normalized to housekeeping gene β -actin. Gene knockdown effectiveness was expressed as a percentage of the blank. The results are shown in FIGS. 1 and 2, and the results of primary screening in MDA-MB-231 and U87-MG cells are combined, and the sequences with reduced effect of 75% or more are selected for subsequent EC50 data detection and analysis, so VEGFR2-21-h1#, VEGFR2-21-h2#, VEGFR2-21-h5#, VEGFR2-21-h7#, VEGFR2-21-hm17#, VEGFR2-21-hm18#, VEGFR2-25-h3#, and VEGFR2-25-h4# are selected as candidate sequences, and 8 sequences are modified (see Table 3 for modified sequences).

TABLE 3 modified siRNA sequences targeting VEGFR2

Note: 2'F (f), 2' OME (m); phosphorylation (indicated by P).

Example 4.21 in vitro Effect of Small nucleic acids of nucleotide length preliminary screening (cellular level, TGF-. Beta.1 as the target of detection)

The cell line used to screen for the most effective small nucleic acid should be one that is capable of expressing the target gene. In this example, human DLD-1 cells (FIG. 3), human RKO cells (FIG. 4), human U87-MG cells (FIG. 5) and human PANC-1 cells (FIG. 6) were used to screen for small nucleic acids specific for TGF-. Beta.1.

DLD-1, RKO, U87-MG and PANC-1 cells were seeded into 24-well cell plates (1X 10) ⁵ Per well), then siRNAs (21 mer or negative control) were transfected with commercial transfection reagents (lipo 2000) at a siRNA transfection concentration of 100nM. Meanwhile, untreated cells were set as a blank control. Total RNA was extracted from the cells 24h after transfection. Reverse transcription was performed using the kit to obtain cDNA according to the manufacturer's instructions. The relative level of expression of TGF- β 1mRNA of the target gene was determined by real-time PCR and normalized against β -actin, a housekeeping gene. Gene knockdown effectiveness was expressed as a percentage of the blank. As shown in FIGS. 3 to 6, the primary screening results in DLD-1, RKO, U87-MG and PANC-1 cells were combined, and sequences with knockdown effect of 75% or more were selected for subsequent EC50 data detection and analysis, so TF1-21-hm3# and TF1-21-hm6# were selected as candidate sequences, and these 2 sequences were modified (see Table 4 for modified sequences).

TABLE 4 modified siRNA sequences targeting TGF-beta 1

Note: 2'F (f), 2' OME (m); phosphorylation (indicated by P).

Example 5.comparison of data before and after modification of siRNA sequences of 25 nucleotides in length and 21 nucleotides in length (cellular level, target for detection VEGFR 2)

The EC50 s of the candidate sequences before and after modification in different cells (MDA-MB-231, U87-MG and PANC-1) were compared. MDA-MB-231, PANC-1 and U87-MG cells were seeded in 24-well cell plates (1X 10 cells) ⁵ Per well), siRNA candidates (modified or unmodified) were transfected with multiple concentration gradients in different cells) The same procedure as for the primary screen was used. Finally, data were plotted using the software GraphPad Prism8 and EC50 values were calculated.

The results of comparison of the EC50 curves of candidate sequences before and after MDA-MB-231 cell modification are shown in FIG. 7; the results of comparison of EC50 curves of candidate sequences before and after modification of U87-MG cells are shown in FIG. 8; the results of comparison of the EC50 curves of candidate sequences before and after PANC-1 cell modification are shown in FIG. 9. As shown in the data summary Table 5, each sequence (before and after modification) showed a lower EC50 value in PANC-1 and MDA-MB-231, indicating that the sequences have more significant knockdown effect, and the knockdown effect after modification of the sequences VEGFR2-21-h5#, VEGFR2-21-h17#, VEGFR2-21-h1#, VEGFR2-21-h2# and VEGFR2-21-hm18# is better than that without modification; the EC50 values of the candidate VEGFR2 sequences before and after modification were higher in U87-MG, and the knocking-down effect was not significant, which corresponds to the preliminary screening result in U87-MG in FIG. 2, but the tendency of the knocking-down effect before and after modification was consistent with the results in PANC-1 and MDA-MB-231.

TABLE 5 EC50 data for siRNA candidates targeting VEGFR2

Example 6.21 comparison of data before and after modification of siRNA sequences of nucleotide length (cellular level, TGF-. Beta.1 as the target of detection)

The candidate sequences EC50 before and after modification of different cells (U87-MG, DLD-1, SK-Hep-1, bxPC3, A549, HUCCT, PANC-1 and RKO) were compared. U87-MG, DLD-1, SK-Hep-1, bxPC3, A549, HUCCT, PANC-1 and RKO cells seeded in 24-well cell plates (1X 10) ⁵ Per well), multiple concentration gradients (transfected siRNA candidates (modified or unmodified) in different cells were used using the same procedure as for primary screening. Finally, data were plotted using the software GraphPad Prism8 and EC50 values were calculated.

The results of comparison of EC50 curves for candidate sequences before and after modification by different cells (U87 MG, PANC-1, RKO, bxPC 3) are shown in FIG. 10, the results of comparison of EC50 curves for candidate sequences before and after modification by different cells (SK-Hep-1, HUCCT, A549 and DLD-1) are shown in FIG. 11, the data are summarized in Table 6, comparative analysis of EC50 data before and after modification in various cell lines (U87-MG, DLD-1, SK-Hep-1, bxPC3, A549, HUCCT, PANC-1 and RKO) was selected in consideration of the universality of the candidates (modified or unmodified), each sequence (before and after modification) showed a lower EC50 value in U87-MG, DLD-1, SK-Hep-1, bxPC3, A549, HUCCT, PANC-1 and RKO, indicating a less significant low effect of knock-out, and indicating that the modified results after modification were superior to the EC50 values before and after knock-out of EC 1# of TF1-21 # in EC 1-TF 3 before and TF-1 # 87.

TABLE 6 EC50 data for siRNA candidates targeting TGF-. Beta.1

Example 7 Effect of VEGFR2 siRNA in combination with TGF-. Beta.1 siRNA (cellular level, assay target TGF-. Beta.1 and VEGFR 2)

In MDA-MB-231 cells, the knockdown effect of VEGFR2 siRNA and the knockdown effect of TGF-. Beta.1 siRNA were compared at different mass ratios of VEGFR2 siRNA to TGF-. Beta.1 siRNA. MDA-MB-231 cells were seeded into 24-well cell plates (1 × 105/well) and transfected with different ratios of siRNA (1.5, 1, 2, 1 for VEGFR2: TGF- β 1, respectively by siRNA molecule mass ratio 1.5, 2) at siRNA transfection concentration of 100nM using the same procedure as for the primary screen. Finally, data were plotted using the software GraphPad Prism8 and EC50 values were calculated. The results are shown in fig. 12, and the combination effect of the VEGFR2 siRNA and the TGF- β 1 siRNA is almost the same within the mass ratio of 1 to 2, and the good effect of inhibiting VEGFR2 expression and TGF- β 1 expression can be achieved. In view of the ease of handling, the following example selects a mass ratio of 1 as the ratio of two sirnas in an STP355 drug.

Example 8 selection of Small nucleic acid compositions as active ingredients for drug candidates

In order to fully utilize the novel mode of combining two small nucleic acids in the invention to improve the treatment effect of the small nucleic acids, the following combined medicaments are prepared:

(1) Composition 1:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm3# and VEGFR2-21-h1# in the tables, and have the following sequences:

TF1-21-hm3#：

Sense chain：5’-AACUAUUGCUUCAGCUCCAdTdT-3’(SEQ ID No.3)；

antisense：5’-UGGAGCUGAAGCAAUAGUUdTdT-3’(SEQ ID No.13)，

VEGFR2-21-h1#：

Sense chain：5’-GCCUAGUGUUUCUCUUGAUdTdT-3’(SEQ ID No.40)；

Antisense：5’-AUCAAGAGAAACACUAGGCdTdT-3’(SEQ ID No.83)。

(2) Composition 2:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm3# and VEGFR2-21-h2# in the tables, the sequences of which are as follows:

TF1-21-hm3#：

Sense chain：5’-AACUAUUGCUUCAGCUCCAdTdT-3’(SEQ ID No.3)；

Antisense：5’-UGGAGCUGAAGCAAUAGUUdTdT-3’(SEQ ID No.13)，

VEGFR2-21-h2#：

Sense chain：5’-GGUCCAUUUCAAAUCUCAAdTdT-3’(SEQ ID No.41)；

Antisense：5’-UUGAGAUUUGAAAUGGACCdTdT-3’(SEQ ID No.84)。

(3) Composition 3:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm6# and VEGFR2-21-h1# in the tables, the sequences of which are as follows:

TF1-21-hm6#：

Sense chain：5’-CGGCAGCUGUACAUUGACUdTdT-3’(SEQ ID No.6)；

Antisense：5’-AGUCAAUGUACAGCUGCCGdTdT-3’(SEQ ID No.16)，

VEGFR2-21-h1#：

Sense chain：5’-GCCUAGUGUUUCUCUUGAUdTdT-3’(SEQ ID No.40)；

Antisense：5’-AUCAAGAGAAACACUAGGCdTdT-3’(SEQ ID No.83)。

(4) Composition 4:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm6# and VEGFR2-21-h2# in the tables, the sequences of which are as follows:

TF1-21-hm6#：

Sense chain：5’-CGGCAGCUGUACAUUGACUdTdT-3’(SEQ ID No.6)；

Antisense：5’-AGUCAAUGUACAGCUGCCGdTdT-3’(SEQ ID No.16)，

VEGFR2-21-h2#：

Sense chain：5’-GGUCCAUUUCAAAUCUCAAdTdT-3’(SEQ ID No.41)；

Antisense：5’-UUGAGAUUUGAAAUGGACCdTdT-3’(SEQ ID No.84)。

(5) Composition 5:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pairs of the tables named TF1-21-hm # 3-mod and VEGFR2-21-h # 1-mod, having the following sequences:

TF1-21-hm3#mod：

Sense chain：5’-mAmAmCmUmAmUfUfGfCmUmUmCmAmGmCmUmCmCmAdTdT-3’；

Antisense：5’-PmUfGmGmAmGmCmUmGmAmAmGmCmAfAmUmAmGmUmUdTdT-3’，

VEGFR2-21-h1#mod：

Sense chain：5’-mGmCmCmUmAmGfUfGfUmUmUmCmUmCmUmUmGmAmUdTdT-3’；

Antisense：5’-PmAfUmCmAmAmGmAmGmAmAmAmCmAfCmUmAmGmGmCdTdT-3’。

(6) Composition 6:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pair of molecules in the tables named TF1-21-hm3# mod and VEGFR2-21-h2# mod, which have the following sequences:

TF1-21-hm3#mod：

Sense chain：5’-mAmAmCmUmAmUfUfGfCmUmUmCmAmGmCmUmCmCmAdTdT-3’；

Antisense：5’-PmUfGmGmAmGmCmUmGmAmAmGmCmAfAmUmAmGmUmUdTdT-3’，

VEGFR2-21-h2#mod：

Sense chain：5’-mGmGmUmCmCmAfUfUfUmCmAmAmAmUmCmUmCmAmAdTdT-3’；

Antisense：5’-PmUfUmGmAmGmAmUmUmUmGmAmAmAfUmGmGmAmCmCdTdT-3’。

(7) Composition 7:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pair of molecules in the tables designated TF1-21-hm6# mod and VEGFR2-21-h1# mod, having the following sequences:

TF1-21-hm6#mod：

Sense chain：5’-mCmGmGmCmAmGfCfUfGmUmAmCmAmUmUmGmAmCmUdTdT-3’；

antisense：5’-PmAfGmUmCmAmAmUmGmUmAmCmAmGfCmUmGmCmCmGdTdT-3’，

VEGFR2-21-h1#mod：

Sense chain：5’-mGmCmCmUmAmGfUfGfUmUmUmCmUmCmUmUmGmAmUdTdT-3’；

Antisense：5’-PmAfUmCmAmAmGmAmGmAmAmAmCmAfCmUmAmGmGmCdTdT-3’。

(8) Composition 8:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pair of molecules in the tables named TF1-21-hm6# mod and VEGFR2-21-h2# mod, which have the following sequences:

TF1-21-hm6#mod：

Sense chain：5’-mCmGmGmCmAmGfCfUfGmUmAmCmAmUmUmGmAmCmUdTdT-3’；

Antisense：5’-PmAfGmUmCmAmAmUmGmUmAmCmAmGfCmUmGmCmCmGdTdT-3’，

VEGFR2-21-h2#mod：

Sense chain：5’-mGmGmUmCmCmAfUfUfUmCmAmAmAmUmCmUmCmAmAdTdT-3’；

Antisense：5’-PmUfUmGmAmGmAmUmUmUmGmAmAmAfUmGmGmAmCmCdTdT-3’。

(9) Composition 9:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm3# and VEGFR2-21-hm17# in the tables, the sequences of which are as follows:

TF1-21-hm3#：

Sense chain：5’-AACUAUUGCUUCAGCUCCAdTdT-3’(SEQ ID No.3)；

Antisense：5’-UGGAGCUGAAGCAAUAGUUdTdT-3’(SEQ ID No.13)，

VEGFR2-21-hm17#：

Sense chain：5’-GGACUGGCUUUGGCCCAAUdTdT-3’(SEQ ID No.56)，

Antisense：5’-AUUGGGCCAAAGCCAGUCCdTdT-3’(SEQ ID No.99)。

(10) Composition 10:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm3# and VEGFR2-21-hm18# in the tables, the sequences of which are as follows:

TF1-21-hm3#：

Sense chain：5’-AACUAUUGCUUCAGCUCCAdTdT-3’(SEQ ID No.3)；

Antisense：5’-UGGAGCUGAAGCAAUAGUUdTdT-3’(SEQ ID No.13)，

VEGFR2-21-hm18#：

Sense chain：5’-GGAAAAAACAAAACUGUAAdTdT-3’(SEQ ID No.57)；

Antisense：5’-UUACAGUUUUGUUUUUUCCdTdT-3’(SEQ ID No.100)。

(11) Composition 11:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pair of molecules designated TF1-21-hm6# and VEGFR2-21-hm17# in the tables, the sequences of which are as follows:

TF1-21-hm6#：

Sense chain：5’-CGGCAGCUGUACAUUGACUdTdT-3’(SEQ ID No.6)；

Antisense：5’-AGUCAAUGUACAGCUGCCGdTdT-3’(SEQ ID No.16)，

VEGFR2-21-hm17#：

Sense chain：5’-GGACUGGCUUUGGCCCAAUdTdT-3’(SEQ ID No.56)；

Antisense：5’-AUUGGGCCAAAGCCAGUCCdTdT-3’(SEQ ID No.99)。

(12) Composition 12:

the siRNA molecules are selected from the siRNA molecules identified in Table 1 and Table 2, such as the pairs designated TF1-21-hm6# and VEGFR2-21-hm18# in the tables, the sequences of which are as follows:

TF1-21-hm6#：

Sense chain：5’-CGGCAGCUGUACAUUGACUdTdT-3’(SEQ ID No.6)；

Antisense：5’-AGUCAAUGUACAGCUGCCGdTdT-3’(SEQ ID No.16)，

VEGFR2-21-hm18#：

Sense chain：5’-GGAAAAAACAAAACUGUAAdTdT-3’(SEQ ID No.57)，

Antisense：5’-UUACAGUUUUGUUUUUUCCdTdT-3’(SEQ ID No.100)。

(13) Composition 13:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pairs of the Table named TF1-21-hm3# mod and VEGFR2-21-hm17# mod, whose sequences are as follows:

TF1-21-hm3#mod：

Sense chain：5’-mAmAmCmUmAmUfUfGfCmUmUmCmAmGmCmUmCmCmAdTdT-3’；

Antisense：5’-PmUfGmGmAmGmCmUmGmAmAmGmCmAfAmUmAmGmUmUdTdT-3’，

VEGFR2-21-hm17#mod：

Sense chain：5’-mGmGmAmCmUmGfGfCfUmUmUmGmGmCmCmCmAmAmUdTdT-3’；

Antisense：5’-PmAfUmUmGmGmGmCmCmAmAmAmGmCfCmAmGmUmCmCdTdT-3’。

(14) Composition 14:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pairs of the Table named TF1-21-hm3# mod and VEGFR2-21-hm18# mod, whose sequences are as follows:

TF1-21-hm3#mod：

Sense chain：5’-mAmAmCmUmAmUfUfGfCmUmUmCmAmGmCmUmCmCmAdTdT-3’；

Antisense：5’-PmUfGmGmAmGmCmUmGmAmAmGmCmAfAmUmAmGmUmUdTdT-3’，VEGFR2-21-hm18#mod：

Sense chain：5’-mGmGmAmAmAmAfAfAfCmAmAmAmAmCmUmGmUmAmAdTdT-3’；

Antisense：5’-PmUfUmAmCmAmGmUmUmUmUmGmUmUfUmUmUmUmCmCdTdT-3’。

(15) Composition 15:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, for example, the pairs designated TF1-21-hm6# mod and VEGFR2-21-hm17# mod in the tables, the sequences of which are as follows:

TF1-21-hm6#mod：

Sense chain：5’-mCmGmGmCmAmGfCfUfGmUmAmCmAmUmUmGmAmCmUdTdT-3’；

Antisense：5’-PmAfGmUmCmAmAmUmGmUmAmCmAmGfCmUmGmCmCmGdTdT-3’，

VEGFR2-21-hm17#mod：

Sense chain：5’-mGmGmAmCmUmGfGfCfUmUmUmGmGmCmCmCmAmAmUdTdT-3’；

Antisense：5’-PmAfUmUmGmGmGmCmCmAmAmAmGmCfCmAmGmUmCmCdTdT-3’。

(16) Composition 16:

the siRNA molecules are selected from the siRNA molecules identified in tables 3 and 4, such as the pairs of the Table named TF1-21-hm6# mod and VEGFR2-21-hm18# mod, whose sequences are as follows:

TF1-21-hm6#mod：

Sense chain：5’-mCmGmGmCmAmGfCfUfGmUmAmCmAmUmUmGmAmCmUdTdT-3’；

Antisense：5’-PmAfGmUmCmAmAmUmGmUmAmCmAmGfCmUmGmCmCmGdTdT-3’，

VEGFR2-21-hm18#mod：

Sense chain：5’-mGmGmAmAmAmAfAfAfCmAmAmAmAmCmUmGmUmAmAdTdT-3’，

Antisense：5’-PmUfUmAmCmAmGmUmUmUmUmGmUmUfUmUmUmUmCmCdTdT-3’。

example 9 preparation of STP355 drugs

TGF-beta 1 siRNA and VEGFR2 siRNA were selected as composition 9 (TF-21-hm 3# and VEGFR2-21-hm17 #) in example 8, according to the following 1:1 (mass ratio) to form a solution with the polypeptide carrier (HKP or HKP (+ H)) to form a stable nanoparticle formulation.

Example 10 in vivo pharmacodynamic assay of STP355 in a mouse pancreatic cancer (PANC-1) xenograft model

The STP355 drug used in this example was the STP355 drug prepared in example 9. BALB/c nude mice were inoculated subcutaneously in the back with human pancreatic carcinoma PANC-1 cells, 4X 10 cells each ⁶ 0.2ml, when the tumor volume grows to about 200mm ³ Tumors were collected and cut into pieces of about 2mm in diameter and inoculated subcutaneously to mice with an average tumor volume of 100mm ³ The grouped dosing was started. STP355 was administered intratumorally at a dose of 1mg/kg and 2.5mg/kg 2 times per week for a total of 8 times, and gemcitabine (GemZar) (3 mg/kg) was administered intratumorally as a positive control for a total of 8 times twice per week. The tumor volume and body weight of the mice were measured periodically, the tumors were collected at the end of the experiment and analyzed by the software GraphPad Prism 8. Mean. + -. SE. As can be seen in FIG. 13, STP355 has a certain inhibitory effect on mouse pancreatic carcinoma, and the effect of 2.5mg/kg dose is close to that of GemZar.

Example 11 pharmacodynamic testing of STP355 in a mouse Breast cancer (MDA-MB-231) transplantable tumor model

The STP355 drug used in this example was the STP355 drug prepared in example 9. BALB/c nude mice were subcutaneously inoculated with human breast cancer MDA-MB-231 cells at the back, 4X 10 each ⁶ 0.2ml, mean tumor volume up to 100mm ³ The group administration was started. STP355 is administered intratumorally at a dose of 1mg/kg twice weekly for 8 times total or intravenously at a dose of 2mg/kg twice weekly for 8 times total. Paclitaxel (PTX) (5 mg/kg) was used as a positive control and administered intratumorally twice weekly for 8 total doses. Tumor volume and mouse body weight of mice were measured periodically, tumor weights were collected at the end of the experiment and analyzed by the software GraphPad Prism 8. Data points were calculated as mean ± SE. Fig. 14 shows that the STP355 treatment has better effect of inhibiting the breast cancer of mice than the paclitaxel and much lower toxicity than the paclitaxel.

Example 12 in vivo pharmacodynamic assay of STP355 human colorectal carcinoma tumor at the PDL1 site (MC 38-hPDL 1) in an immunocompetent mouse model

The STP355 drug used in this example was the STP355 drug prepared in example 9. C57BL/6J mice are inoculated with humanized PDL1 site colorectal cancer tumor MC38-hPDL1 cells subcutaneously on the back, and the inoculation amount is as follows: 1X 10 ⁶ 100 μ L/seed, inoculation position: the average tumor volume above the thigh of the right back of the mouse is up toTo 100mm ³ The divided administration was started, divided into 4 groups of 8/group, and the experiment tested 4mg/kg and 6mg/kg doses and set up a model group, a positive control Teentrip Thangsaintqi (Alizezumab). 2 times per week for 8 times, measuring the tumor volume with vernier caliper on days 0,3,7, 10, 14, 17, 21, 24, and 28, respectively, and calculating the tumor growth inhibition rate TGI according to the formula,

calculating the formula: TGI% = [1- (Ti-T0)/(Vi-V0) ]. Times.100%.

Ti represents the mean tumor volume of the treatment group at a certain time point,

t0 represents the mean tumor volume in the treatment group on day 0,

vi denotes the mean tumor volume of the model group at the same time point as Ti,

v0 represents the mean tumor volume of the model group at day 0.

Fig. 15 shows that the positive control group (Tecentrip, 4mpk, biw x 4w, i.p.), STP355 low dose group (4mpk, biw x 4w, i.v.) and STP355 high dose group (6mpk, biw x 4w, i.v.), the tumor volume was significantly smaller than that of the model control group from day 7 until day 28, and the STP355 high dose group was comparable in effect to the positive control group. From the tumor weight results, the STP355 high dose group and the control group were significantly lower than the model group, and the inhibition effect of the STP355 high dose group on tumor growth was comparable to that of Tecentrip.

Example 13 in vivo pharmacodynamic assay of STP355 on melanoma (B16) in an immunocompetent mouse model

The STP355 drug used in this example was the STP355 drug prepared in example 9. C57BL/6J mice were inoculated subcutaneously on the back with B16-F0 cells, at the following: 1X 10 ⁶ 100 μ L/seed, 50 inoculations, position: the average tumor volume on the right back of the mouse is 80-100 mm ³ Group administration was started with STP355 being administered intravenously at a dose of 2mg/kg twice weekly for 8 times, and the positive control group being administered cisplatin (Cisplattin) intratumorally at a dose of 4mg/kg twice weekly for 8 times. FIG. 16 shows that under the current assay system, the positive control group (cisplatin, cisplartin,4mg/kg i.p.QW), STP355 group (2 mg/kg, 10. Mu.l/g,i.v., Q2D) all showed significant antitumor effect, and the STP355 group was more effective and less toxic.

Example 14 comparative pharmacodynamic testing of combination drug and Single drug in mouse Breast cancer (MDA-MB-231) transplantable tumor model

Composition 9 (TF 1-21-hm3# and VEGFR2-21-hm17 #), composition 10 (TF 1-21-hm3# and VEGFR2-21-hm18 #), composition 11 (TF 1-21-hm6# and VEGFR2-21-hm17 #), composition 12 (TF 1-21-hm6# and VEGFR2-21-hm18 #), TGF- β 1 siRNA (TF 1-21-hm3 #), TGF- β 1 siRNA (TF 1-21-hm6 #), VEGFR2 siRNA (VEGFR 2-21-hm17 #), and VEGFR2 siRNA (VEGFR 2-21-hm18 #) are respectively self-assembled with HKP (+ H) to form nanoparticles, and the prepared nanoparticles are respectively marked as STP (3 + 17), STP (3 + 355), STP (3 + 18), STP (6 + 17), STP (6 si + 18), siTGF- β 1 (3), siTGF- β 1 (6), siTp (17-17), VEGF (VEGF 2-18).

NOD SCID mice were subcutaneously inoculated with human breast cancer MDA-MB-231 cells at the back, 1X 10 each ⁷ 0.2ml, mean tumor volume up to 100mm ³ The divided administration was started and divided into 10 groups and 8 groups. The STP355 drug, TGF-beta 1 siRNA single drug and VEGFR2 siRNA single drug were administered intravenously at a dose of 2mg/kg, once every 3 days for 8 times. Paclitaxel (PTX) (5 mg/kg) was used as a positive control, and was intraperitoneally injected once every 3 days for a total of 8 administrations. Tumor volume and mouse body weight of mice were measured periodically, tumor weights were collected at the end of the experiment and analyzed by the software GraphPad Prism 9. Data points were calculated as mean ± SE. FIG. 17 shows that, compared with the model group, the inhibition effect of STP355 (3 + 18) drug treatment on mouse breast cancer is obviously superior to that of TGF-beta 1 siRNA single drug, VEGFR2 siRNA single drug and paclitaxel.

Example 15 comparative in vivo pharmacodynamic testing of combination and modified drugs in a mouse pancreatic cancer (PANC-1) xenograft model

The method adopts composition 9 (TF 1-21-hm3# and VEGFR2-21-hm17 #), composition 10 (TF 1-21-hm3# and VEGFR2-21-hm18 #), composition 13 (TF 1-21-hm3# mod and VEGFR2-21-hm17# mod), composition 14 (TF 1-21-hm3# mod and VEGFR2-21-hm18# mod) to self-assemble with HKP (+ H) respectively to form nano particles, and the prepared nano particles are respectively marked as STP355 (3 + 17), STP355 (3 + 18), STP355 (3m + 17m) and STP355 (3m + 18m).

BALB/c nude mice were subcutaneously inoculated with human pancreatic cancer PANC-1 cells at the back, 4X 10 cells each ⁶ 0.2ml, mean tumor volume up to 120mm ³ The divided administration was started and divided into 6 groups and 8 groups per group. STP355 was administered intratumorally at a dose of 1mg/k 1 time every 3 days for a total of 8 times, and gemcitabine (GemZar) (60 mg/kg) was administered intraperitoneally 1 time every 3 days for a total of 8 times as a positive control. Tumor volumes and body weights of mice were measured periodically and analyzed by the software GraphPad Prism 9. Mean. + -. SE. As can be seen in FIG. 18, each administration group had a certain inhibitory effect on PANC-1 tumor, the effect was comparable to gemcitabine, and the combination drug and the modified drug were not different.

Example 16 comparative testing of the stability of modified and unmodified drugs in C57BL/6J mice

C57BL/6J mice were divided into 5 groups and 6 mice/group, and STP355 (3 + 17) and STP355 (3m + 17m) in example 15 were used to compare the in vivo stability of the unmodified STP355 and the modified STP355m in mice, control was a blank Control group, single dose group (sige dose) was administered once, and repeat dose group (Q2D × 3 dose) was administered once every two days for 3 times. Sampling is carried out 24 hours after the last administration, and the content of TGF-beta 1 siRNA and VEGF-R2 siRNA in liver tissues is determined by adopting a real-time fluorescent quantitative PCR method. Figure 19 shows that both the modified and unmodified drugs, i.p., were able to detect higher levels of VEGF-R2 siRNA and TGF- β 1 siRNA in liver tissue after i.p. administration. Under the same administration mode, the siRNA residue amount of the modified group is higher than that of the unmodified group; in the modified group, the residual quantity of siRNA after repeated administration is higher than that of single administration, and the residual quantity of siRNA after repeated administration in the unmodified group is also higher than that of single administration. Indicating that the siRNA has better stability in vivo after modification.

The proteins encoded by human and mouse mRNA molecules are essentially identical in structure or function. Thus, the therapeutic and toxic effects observed in mouse disease models provide a good understanding of what will occur in humans. More importantly, siRNA molecules tested in the mouse model are good candidates for pharmaceutical formulations for use in humans. In the above examples, the STP355 drug used human-mouse homologous siRNA.

While this disclosure describes certain examples of the compositions and methods, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that these compositions and methods are susceptible to additional embodiments and that certain details may be varied from the embodiments described herein without departing from the basic principles of the disclosure.

Claims (15)

1. A nucleic acid interfering pharmaceutical composition for treating a plurality of tumors, comprising: the nucleic acid interference medicine composition comprises siRNA molecules capable of binding with mRNA coding TGF-beta 1 and inhibiting TGF-beta 1 activity and siRNA molecules capable of binding with mRNA coding VEGFR2 and inhibiting VEGFR2 activity.

2. The nucleic acid interfering pharmaceutical composition according to claim 1, wherein: the sequence of the sense strand of the siRNA molecule which can be combined with mRNA coding TGF-beta 1 and inhibit the activity of TGF-beta 1 is at least selected from one of SEQ ID Nos. 1-10 and SEQ ID Nos. 1-10 with specific modification, and the antisense strand is at least selected from one of SEQ ID Nos. 11-20 and SEQ ID Nos. 11-20 with specific modification which is complementary to the sense strand;

and/or, the sequence of the sense strand of the siRNA molecule capable of binding to mRNA encoding VEGFR2 and inhibiting VEGFR2 activity is at least selected from SEQ ID Nos. 21 to 63 and any one of SEQ ID Nos. 21 to 63 with specific modifications, and the sequence of the antisense strand is at least selected from SEQ ID Nos. 64 to 106 and one of SEQ ID Nos. 64 to 106 with specific modifications complementary to the sense strand.

3. The nucleic acid interfering pharmaceutical composition according to claim 2, characterized in that: the siRNA molecule sequence capable of binding with mRNA coding TGF-beta 1 and inhibiting TGF-beta 1 activity is as follows:

sense strand: 5 '-AACUAUUGCUCUCUCAGCUCCADDT-3' (SEQ ID No. 3),

antisense strand: 5 '-UGGAGCAUGAAGCAAUAGUUdTdT-3' (SEQ ID No. 13),

and/or the presence of a gas in the gas,

sense strand: 5 '-CGGCAGCUGUACAUUGACUTTdT-3' (SEQ ID No. 6),

antisense strand: 5'-AGUCAAUGUACAGCUGCCGdTdT-3' (SEQ ID No. 16),

and/or the presence of a gas in the atmosphere,

the sequence of the siRNA molecule capable of binding with mRNA encoding VEGFR2 and inhibiting VEGFR2 activity is as follows:

a sense strand: 5 '-GCCUAGUGUUCUUCUUGAUdTdT-3' (SEQ ID No. 40),

antisense strand: 5 '-AUCAAGAAACACCUAGGCdTdT-3' (SEQ ID No. 83),

and/or the presence of a gas in the gas,

sense strand: 5 '-GGUCCAUUCAAAUCUCAAdTdT-3' (SEQ ID No. 41),

antisense strand: 5 '-UUGAGAUUGAAAUGGACCDTdT-3' (SEQ ID No. 84),

and/or the presence of a gas in the gas,

sense strand: 5 'GACCAACAUGGAGUCGUGUACAUUA-3' (SEQ ID No. 23),

antisense strand: 5 'UAAUGUACACGACCAUUGAUGUGUGUGUGUUC 3' (SEQ ID No. 66),

and/or the presence of a gas in the atmosphere,

sense strand: 5-,

antisense strand: 5-,

and/or the presence of a gas in the gas,

a sense strand: 5'-GCAUCAGCAUAAGAAACUUdTdT-3' (SEQ ID No. 44),

antisense strand: 5 '-AAGUUUUAUGCUGAGDCDTT-3' (SEQ ID No. 87),

and/or the presence of a gas in the gas,

sense strand: 5 '-GCUGACAUCGGUCUAUdT-3' (SEQ ID No. 46),

antisense strand: 5 '-AUAGACCGAUACAUGUCAGCdTdT-3' (SEQ ID No. 89),

and/or the presence of a gas in the gas,

sense strand: 5 '-GGACUGGCUUGGCCCAAUdTdT-3' (SEQ ID No. 56),

antisense strand: 5 '-AUUGGGCCAAGCCAGCUCCdTdT-3' (SEQ ID No. 99),

and/or the presence of a gas in the gas,

sense strand: 5'-GGAAAAAACAAAACUGUAAdTdT-3' (SEQ ID No. 57),

antisense strand: 5 '-UUACAGUUUGUUUUUUCCDTdT-3' (SEQ ID No. 100).

4. The nucleic acid-interfering pharmaceutical composition according to claim 2, wherein: the specific modification is one or more of 2' methoxyl modification, 2' fluorin modification and 5' phosphorylation modification.

5. The nucleic acid-interfering pharmaceutical composition according to claim 4, wherein: the sequence of an siRNA molecule capable of binding to the mRNA encoding TGF-. Beta.1 and inhibiting TGF-. Beta.1 activity and having specific modifications of the nucleoside is as follows:

sense strand: 5 '-mAMAMMCmUmUfUfGfCmUmUmmCMmGmCMmmCMmmmmMadT-3',

antisense strand: 5 '-PmufGmGmGmGmCmAmmCmAfAmmGmUdTdT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mCMGmGmAmGfCfUfGmAMmAMmUmUmGmAmCmUdTdT-3',

antisense strand: 5 '-PmafGmMemAMAMAMAMAMAMAMAMAMmGmGmGmCmGmGdTdT-3',

and/or the presence of a gas in the gas,

the sequence of an siRNA molecule capable of binding to mRNA encoding VEGFR2 and inhibiting VEGFR2 activity with nucleotides having specific modifications is as follows:

sense strand: 5 '-mGmCmUmGfUfGfUmUmUmUmCumMemUmUmUmGmAmUdTdT-3',

antisense strand: 5 '-PmaUmCMAmmAmmGmAmAmmCmAfCmAmGmCdTdT-3',

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-mGmMemCMmMafUfUmCMmAMAMAMAMAMAMadT-3',

antisense strand: 5 '-PmafUmGmAmAmAmUmUmUmGmAmAmAmAfUmGmGmCmCdTdT-3',

and/or the presence of a gas in the gas,

a sense strand: 5 '-mGmAmCmAmmAmmAmmAmUmGmGmGfUfCmGmUmGmmmmMemUmUmA-3',

antisense strand: 5 '-PmaAmAmUmGmGmmmMemMemGmAmfUmMemUmGmUmGmGmGmUmC-3',

and/or the presence of a gas in the gas,

a sense strand: 5 '-mCMCMmUmGmGMmCMmMafAfUfCmAmmAmAmAmmUmAMmA-3',

antisense strand: 5 '-PmaUmAmUmUmGmUmGmGmUmGmGmAmmGmGmGmGmGmG-3',

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-mGmAmCmUmGfGfCfUmUmUmGmCmCmAmAmUdTdT-3',

antisense strand: 5 '-PmafUmUmGmGmCmAmmCmAmmCmAmmGmCymcMcmcdTdT-3',

and/or the presence of a gas in the atmosphere,

sense strand: 5 '-mGmAmAmAmAmAmafAfAfafCmAmAmAmAmaCmUmGmAmmAddT-3',

antisense strand: 5 '-PmaUmAmmMemGMAMUmUmUmUmUmmmmmmmmmmmmmmMecGDT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmCMAmUmCMAFGfCfAmUmAmmAmmGmAmmUdTdT-3',

antisense strand: 5 '-PmaAmGmUmUmUmUmUmUmGmCmUmGmGmGmCdTdT-3',

and/or the presence of a gas in the gas,

sense strand: 5 '-mGmCmGmAmfAfUfGmAMmGMmGmCMUmUmUdTdT-3',

antisense strand: 5 '-PmaUmAmmGmAmCmGmAmmmmmmUfGmCMmGmCdTdT-3'

Wherein m represents that the 2' position of the nucleoside sugar ring is modified by methoxyl, f represents that the 2' position of the nucleoside sugar ring is modified by fluorin, and P represents phosphorylation modification of 5' end.

6. The nucleic acid interfering pharmaceutical composition according to claim 1, wherein: the nucleic acid interfering pharmaceutical composition also comprises one or more of other RNA molecules capable of combining with mRNA encoding a pro-angiogenic gene, mRNA encoding an endothelial cell proliferation gene, mRNA encoding a VEGF pathway gene, mRNA encoding a TGF-beta 1 pathway gene, or mRNA encoding VEGFR 2.

7. The nucleic acid interfering pharmaceutical composition according to claim 1, wherein: the mass ratio of the siRNA molecule capable of binding with mRNA encoding TGF-beta 1 and inhibiting activity of TGF-beta 1 to the siRNA molecule capable of binding with mRNA encoding VEGFR2 and inhibiting activity of VEGFR2 is (0.5-2): 1.

8. the nucleic acid-interfering pharmaceutical composition according to any one of claims 1 to 7, characterized in that: the nucleic acid interference medicine composition also comprises a medicine carrier for delivering siRNA molecules.

9. The nucleic acid-interfering pharmaceutical composition according to claim 8, wherein: the drug carrier is selected from one or more of polycation binder, cationic lipid, cationic micelle, cationic polypeptide, hydrophilic polymer graft polymer, non-natural cationic polymer, cationic polyacetal, hydrophilic polymer graft polyacetal, ligand functionalized cationic polymer or ligand functionalized hydrophilic polymer graft polymer.

10. The nucleic acid-interfering pharmaceutical composition according to claim 8, wherein: the drug carrier is histidine-lysine copolymer.

11. The nucleic acid-interfering pharmaceutical composition according to claim 10, wherein: the histidine-lysine copolymer is selected from H3K4b, H3K (+ H) 4b or HK-RCOOH in HKP series, has lysine skeleton or RCOOH scaffold with 3-4 branches, and contains multiple repeat sequences of histidine, lysine or asparagine.

12. The nucleic acid-interfering pharmaceutical composition according to claim 10, wherein: the mass ratio of N/P of the histidine-lysine copolymer to siRNA molecules is 1.5/1-3.5/1.

13. The nucleic acid interfering pharmaceutical composition according to claim 8, wherein: the nucleic acid interference medicine composition is a nanoparticle.

14. Use of the nucleic acid interfering pharmaceutical composition according to any one of claims 1 to 13 for the treatment of tumors and/or diseases with abnormal angiogenesis.

15. Use according to claim 14, characterized in that: the disease comprises one or more of breast cancer, colon cancer, pancreatic cancer and melanoma.

Images