CN115919887A - Application of long-chain non-coding RNA TPRG1-AS1 related to coronary heart disease and binding protein MYH9 thereof - Google Patents

Abstract

The invention provides an application of long-chain non-coding RNA TPRG1-AS1 related to coronary heart disease and a binding protein MYH9 thereof. Specifically, the invention provides application of long-chain non-coding RNA TPRG1-AS1 in preparation of a reagent for regulating and controlling smooth muscle cell migration, and also provides application of long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation for inhibiting vascular neointimal formation. The invention also provides application of the long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation interacting with MYH9 protein, and also provides application of MYH9 gene and/or protein in preparation of a reagent for regulating and controlling smooth muscle cell migration.

Description

Application of long-chain non-coding RNA TPRG1-AS1 related to coronary heart disease and binding protein MYH9 thereof

Technical Field

The invention relates to an application of long-chain non-coding RNA TPRG1-AS1 related to coronary heart disease and a binding protein MYH9 thereof, in particular to an application of TPRG1-AS1 in preparation of a reagent for inhibiting HASMC migration, neointimal formation and/or atherosclerotic lesion.

Background

The most significant feature of atherosclerotic cardiovascular disease (ASCVDs) is the formation of atherosclerotic plaques. Most of the cells in atherosclerotic plaques are derived from Vascular Smooth Muscle Cells (VSMCs) migrating in the tunica media, and vascular remodeling is caused by vascular intimal thickening caused by abnormal proliferation of vascular smooth muscle cells migrating from the tunica media to the tunica intima.

Long non-coding RNAs (lncrnas) that are widely expressed in mammals are a class of RNA molecules that are over 200 nucleotides (nt) in length and that encode little protein. lncRNA plays a broad role in various biological activities including chromatin remodeling, alternative splicing, genomic imprinting, cell cycle regulation, etc. by regulating gene expression during transcription, post-transcriptional and epigenetic levels, etc. It has been reported in the literature that lncrnas can play a key role in modulating VSMC phenotypic switching by interacting with proteins. For example, lncRNA AK098656 induces VSMC phenotypic switching by promoting MYH11/FN1 protein degradation. The antisense non-coding RNA (ANRIL) in the INK4 locus serves as a scaffold for WDR5 and HDAC3 complexes and facilitates the phenotypic switching of Human Aortic Smooth Muscle Cells (HASMCs). Cardiac mesoderm enhancer-associated non-coding RNA (CARMN) promotes the contractile phenotype of human coronary smooth muscle cells (HCASMC) by binding directly to MYOCD.

However, the regulatory role and mechanism of most lncrnas in human aortic smooth muscle cell phenotypic switching and vascular remodeling have not been fully elucidated.

Disclosure of Invention

The invention aims to provide application of long-chain non-coding RNA TPRG1-AS 1.

The invention aims to provide application of a binding protein MYH9 of a long-chain non-coding RNA TPRG1-AS 1.

The subject group of the inventor of the present application carries out lncRNA/mRNA chip analysis on peripheral blood mononuclear cells of 93 coronary heart disease cases and 48 contrasts in the past research to obtain a coronary heart disease whole transcriptome level lncRNA/mRNA expression profile (GSE 113079); repeated verification is carried out on 412 cases of coronary heart disease and 295 control large samples by applying qRT-PCR technology, and the TPRG1-AS1 is verified to be a new CAD diagnosis biomarker; deletion of macrophage TPRG1-AS1 affects the expression of inflammation-related genes and genes in the vicinity thereof. In addition, in tumor-related studies, TPRG1-AS1 was found to inhibit tumor progression by inducing RBM24 expression and activating caspase3/7 mediated apoptosis. The research of the invention discovers that TPRG1-AS1has no protein coding capability and is a real long-chain non-coding RNA, and TPRG1-AS1has an important regulation function in aortic smooth muscle cell phenotype conversion and vascular remodeling, thereby providing the application of TPRG1-AS1 in preparing a preparation for inhibiting HASMC migration, neointima formation and/or atherosclerotic lesion, and further providing the related application of binding protein MYH9 of TPRG1-AS 1.

Specifically, in one aspect, the invention provides application of long-chain non-coding RNA TPRG1-AS1 in preparation of a reagent for regulating and controlling smooth muscle cell migration.

According to the specific embodiment of the present invention, the full length sequence of TPRG1-AS1 of the present invention is 1279nt, and the specific sequence is shown in SEQ ID NO. 1.

On the other hand, the invention also provides application of the long-chain non-coding RNA TPRG1-AS1 in preparing a preparation for inhibiting the neointimal formation of blood vessels.

In accordance with a particular embodiment of the invention, TPRG1-AS1 inhibits atherosclerotic lesions by inhibiting smooth muscle cell neointima formation.

According to a particular embodiment of the invention, for use according to the invention, the smooth muscle cells are vascular smooth muscle cells. In some more specific embodiments, the smooth muscle cells are arterial smooth muscle cells.

On the other hand, the invention also provides application of the long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation interacting with MYH9 protein.

According to a particular embodiment of the invention, TPRG1-AS1 interacts with MYH9 proteins to promote MYH9 protein degradation and/or to hinder F-actin stress fiber formation.

According to a specific embodiment of the invention, TPRG1-AS1 interacts with MYH9 protein to regulate smooth muscle cell migration.

According to a particular embodiment of the invention, VSMC-specific TPRG1-AS1 overexpression reduces MYH9 protein levels in atherosclerotic plaques, reducing atherosclerotic lesions.

On the other hand, the invention also provides application of the MYH9 gene and/or protein in preparation of a reagent for regulating and controlling smooth muscle cell migration.

In some embodiments of the invention, analyzing TPRG1-AS1 expression using the genotype-tissue expression (GTEx) database, the atherosclerosis-associated GEO dataset, and the platelet-derived growth factor BB (PDGFBB) -induced HASCAS cell model, TPRG1-AS1 that is significantly up-regulated in atherosclerotic plaques is identified AS a true lncRNA and its full-length and subcellular localization of transcripts in HASCAC is described. Functionally, TPRG1-AS1 can regulate HASMC migration rather than proliferation. Mechanistically, in HASMCs, TPRG1-AS1 promotes MYH9 protein degradation and hinders F-actin stress fiber formation through direct interaction with the MYH9 protein. Smooth muscle cell specific TPRG1-AS1 transgenes significantly reduced neointimal formation and significantly reduced the extent of atherosclerotic lesions in Apoe-/-mice.

In general, the invention proves the application of the long-chain non-coding RNA TPRG1-AS1 in the aspects of inhibiting HASMC migration, neointimal formation and/or atherosclerotic lesion and the like through specific experiments.

Drawings

FIGS. 1A-1E show TPRGRG 1-AS1 expression in the genotype-tissue expression (GTEx) database, the atherosclerosis-associated GEO data set, and the PDGFBB-induced HASMCs cell model. FIG. 1A: expression levels of TPRG1-AS1 in different human tissues in the GTEx database. FIG. 1B: TPRG1-AS1 expression in human carotid atherosclerotic plaques and Internal Mammary Artery (IMA) (n = 9). FIG. 1C: expression level of TPRG1-AS1 in the chip dataset (GSE 97210). FIG. 1D: expression level of TPRG1-AS1 in RNA-seq dataset (GSE 120521). FIG. 1E: PDGF-BB-induced downregulation of TPRG1-AS1 expression levels in HASMCs (n = 6).

FIG. 2 shows the strategy for rapid cloning of full-length 5 'and 3' -unknown sequences of TPRG1-AS1 transcripts.

FIG. 3A shows the result of detecting the product of 5' -RACE PCR by 1.0% agarose gel electrophoresis, wherein lane 1 is DL2500 Marker, lane 2 is the product of RACE PCR amplification by TPRG101-R108, and the marked band is F493. FIG. 3B shows the result of detecting 3' -RACE PCR products by 1.0% agarose gel electrophoresis, wherein lane 1 is DL2500 Marker, lane 2 is nested PCR amplification products with TPRG101-F344 and TPRG101-F493, and the marked band is 2F493.

FIG. 4 shows Northern blot experiments to verify the transcript size and expression abundance of TPRG1-AS1 in HUVEC and VSMC, with U6 AS an internal reference.

FIG. 5 shows RNA FISH detection of the subcellular localization of TPRG1-AS1 in HASMCs. TPRG1-AS1 is stained red by a specific TPRG1-AS1 fluorescent probe, and the nucleus is stained blue by DAPI fluorescent dye.

FIG. 6 shows an in vitro transcription-translation experiment of TPRG1-AS 1.

FIG. 7 shows the effect of TPRG1-AS1 on the proliferation of HASMCs. Wherein, picture a: CCK8 measures the effect of knockdown of TPRG1-AS1 on cell proliferation in HASMCs. Picture B: CCK8 measures the effect of over-expression of TPRG1-AS1 on cell proliferation in HASMCs.

FIG. 8 shows the effect of TPRG1-AS1 on HASMCs migration. Wherein, picture a: the Transwell experiment detects the influence of over-expressing TPRG1-AS1 in HASMCs on the migration capacity of cells. Picture B: the Transwell experiment detects the influence of knocking-down TPRG1-AS1 in HASMCs on the migration capacity of cells. Picture C: effects of overexpression of TPRG1-AS1 in HASMCs on cell migration in the presence of PDGFBB stimulatory factors.

FIG. 9 shows RNA Pull-down identifies TPRG1-AS1 bound proteins. input: extracting the whole protein of the cell; sense: the result of the sense chain pull down of TPRG1-AS 1; anti-sense: the pull down result of the antisense strand of lncRNA TPRG1-AS 1; beads: pull down result of empty magnetic beads.

FIG. 10 shows CHIRP experiments demonstrating the interaction of TPRG1-AS1 with the MYH9 protein within HASMCs. Wherein, picture a: the level of target RNA enriched by the TPRG1-AS1 probe was measured by qRT-PCR, and GAPDH and LacZ probes were used AS negative controls. Picture B: western Boting detected the MYH9 protein to which TPRG1-AS1 and control probes bound.

FIG. 11 shows RIP experiments demonstrating the interaction of TPRG1-AS1 with MYH9 protein within HASMCs. Wherein, picture a: western Boting detects MYH 9-specific antibodies and IgG-bound proteins in the RIP assay. Picture B: qPCR detects the expression levels of TPRG1-AS1 and GAPDH in RNA to which MYH 9-specific antibodies and IgG bind. GAPDH was used as a negative control.

FIG. 12 shows that TPRG1-AS1 does not affect MYH9 mRNA levels. Wherein, picture a: qRT-PCR examined the effect of over-expressing TPRG1-AS1 in HASMCs on MYH9 mRNA levels. Picture B: knocking down TPRG1-AS1qRT-PCR to detect MYH9 mRNA level in HASCACs.

FIG. 13 shows that interaction of TPRG1-AS1 with MYH9 protein affects MYH9 protein levels. Wherein, picture a: western blot was used to examine the effect of over-expressing TPRG1-AS1 in HASCACS on the level of MYH9 protein. Picture B: western blot detects the influence of knocking down the expression level of an endogenous TPRG1-AS1 gene on the protein level of MYH9 in HASCACs. Picture C: HASCACs were treated with the protein synthesis inhibitor Cycloheximide (CHX) to determine the half-life of the MYH9 protein. And (5) picture D: treatment of HASMCs with protease inhibitor MG132 identified the pathway of MYH9 protein degradation.

FIG. 14 shows that the MYH9 gene regulates HASMCs migration. Wherein, picture a: effects of knockdown of MYH9 in HASMCs on cell migration. Picture B: effect of overexpression of MYH9 in HASMCs on cell migration. Picture C: effect of knockdown of TPRG1-AS1 and MYH9 in HASMCs on cell migration.

FIG. 15 shows that interaction of TPRG1-AS1 with MYH9 protein affects cellular F-actin stress fiber formation. Wherein, picture a: the effect of overexpression or knockdown of MYH9 in HASMCs on F-actin stress fiber formation. Picture B: effect of overexpression of TPRG1-AS1 in HASMCs on PDGFBB-induced F-actin stress fiber formation. Picture C: effect of knockdown of endogenous MYH9 Gene expression in HASMCs on knockdown of F-actin stress fiber formation induced by endogenous TPRG1-AS1 expression. Nuclei were stained blue specifically by DAPI and F-actin was stained red specifically by Phalloidin-iFluor647 reagent.

FIG. 16 shows that TPRG1-AS1 overexpression inhibits neointimal formation induced by carotid balloon injury in rats. Wherein, picture a: 14 days after balloon injury, ad-TPRG1-AS 1-and Ad-GFP-infected rat carotid arteries. Picture B: the internal membrane area of the carotid artery of Ad-TPRG1-AS 1-and Ad-GFP-infected rats. Picture C: the intima/media ratio of Ad-TPRG1-AS 1-and Ad-GFP-infected rat carotid arteries.

FIG. 17 shows the reduction of neointima in VSMC-specific TPRG1-AS1 transgenic mice. Wherein, picture a: qPCR detects TPRG1-AS1 expression in MASMC isolated from TPRG1-AS1 transgenic mice. Picture B and picture C: western blot assay MYH9 protein expression levels in MASMC. And (5) picture D: the Effect of TPRG1-AS1 overexpression on MASMCs stress fiber formation. Picture E and picture F: effect of TPRG1-AS1 overexpression on migration of MASMCs. Picture G: TPRG1-AS1 after 14 days of guidewire injury ^SMCKI Carotid arteries of mice and control mice. Picture H: TPRG1-AS1 ^SMCKI Carotid intimal area in mice and control mice. Picture I: TPRG1-AS1 ^SMCKI Carotid intima/media ratio in mice and control mice.

FIG. 18 shows that VSMC-specific TPRG1-AS1 overexpression attenuates atherosclerosis. Wherein, picture a and picture B: oil Red O staining high fat induced TPRG1-AS1 for 20 weeks ^SMCKI Apoe ^-/- And aorta of control mice. Picture C and picture D: HE staining TPRG1-AS1 ^SMCKI Apoe ^-/- Aortic root of mice and control mice. Picture E: MYH9 (green) immunofluorescent staining TPRG1-AS1 ^SMCKI Apoe ^-/- Aortic root of mice and control mice. Picture F: percentage of MYH9 positive area (green) in aortic root atherosclerotic plaques.

Detailed Description

For a more clear understanding of the technical features, objects and advantages of the present invention, the technical solutions of the present invention will now be described in detail with reference to specific embodiments, which should be understood as merely illustrative and not limitative of the scope of the present invention. In the examples, each raw reagent material is commercially available, and the experimental method not specifying the specific conditions is a conventional method and a conventional condition well known in the art, or a condition recommended by an instrument manufacturer.

Unless specifically defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the relevant art.

Some of the reagent instruments used in the experiments are shown in table 1.

TABLE 1

/>

The main experimental method comprises the following steps:

1. RNA Fluorescence in situ hybridization (RNA-FISH) assay for determining co-localization of TPRG1-AS1 and MYH9 proteins in HASCACs

HASMCs divides board and climbing piece: culturing HASMCs in a T75 cell culture bottle to a logarithmic growth phase, wherein the state is good, the cell confluency reaches about 80%, and digesting cells; putting a circular cover glass into the bottom of a 24-hole plate in advance, washing the circular cover glass for 3 times by using PBS, and airing the circular cover glass in a biological safety cabinet; cells were uniformly diluted to 2X 10 ⁴ mL, adding 500uL of the cell suspension to a 24-well cell culture plate previously loaded with a round slide, at a content of 5% CO ₂ And, the culture was continued in the 37 ℃ incubator for 24 hours.

Rna FISH: preparing a fluorescence labeling TPRG1-AS1 probe, wherein the sequence (183bp, SEQ ID NO: <xnotran> GTACTCTGTCTCTGTCCTGGGTGTTCGGGATCAAGGCCTTTTGAACCAATTCCGGAATCCGCCACCGGGCGGTGGTAGGAGAGAGCCAGAGGATTCGTCAGTAAGTGTGCGTGCGTGACAGAGGGCTTTTAAATAGATCGCTTTGTATCTAGCACGGTAGCACCTGCTTCTAAGCTTCCAACG; </xnotran> Hybridization was performed according to the hybridization kit instructions.

2. RACE assay

The full-length transcript of TPRG1-AS1 was confirmed by a cDNA end Rapid Amplification (RACE) assay using SMARTer RACE 5'/3' kit (Clontech Laboratories, mountain View, CA, USA). Manufacturer's instructions. For nested PCR, at least two sets of primers were designed and synthesized. The PCR products were separated on a 1.0% agarose gel. The electrophoresis results confirmed that the amplified band was sequenced by cloning into pEASY-Blunt Simple and then converted into a trans T1 bacterium. Individual colonies were selected for sequencing, and the sequencing results were compared and analyzed. The cycle parameters are: race 25X (94 ℃ 30s,68 ℃ 30s,72 ℃ 3 min). The sequences of the oligonucleotide primers and probes used for reverse transcription RACE PCR are shown in table 2.

TABLE 2

3、Northern blot

Total RNA was extracted from HASMC using Trizol reagent (Invitrogen life technologies, carlsbad, calif., USA). Using 20. Mu.g of total RNA, 7.5M urea-12% formaldehyde (PAA) denaturing gel electrophoresis was performed and transferred to Hybond N + nylon membrane (Amersham, fleberg, germany). The film was crosslinked by UV irradiation for 2 minutes. An antisense DNA probe to TPRG1-AS1 was used for hybridization. The membranes were washed 2 times for 20 minutes with 2 XSSC +0.1% SDS solution (Invitrogen life technologies, carlbad, CA, USA) at 42 ℃. The U6 probe served as a positive control. Primer sequences are shown in Table 3.

TABLE 3

4. Testing the role of TPRG1-AS1 and MYH9 genes in the phenotypic transformation of HASCACs

Cell proliferation was detected using CCK8 kit: cells were routinely digested, single cell suspensions were prepared in groups, plated in 96-well plates in parallel, and plated in 2-step (2X 10) ³ And 4X 10 ³ Cells/well) inoculation; each well was 100. Mu.L of medium, and 3 wells were provided in parallel. At 24 hours after transfection or infection, respectively,A group of cells were taken at 48 hours and 72 hours, 5mg/ml of CCK8 solution (10. Mu.L/well) was added to each well, the culture was continued for 4 hours, the culture solution in the wells was carefully aspirated, and the OD value (wavelength: 490 nm) of each well was measured with a microplate reader to plot a cell growth curve.

Cell migration was detected using a Transwell chamber: digested 24 hours after transfection or infection, 100. Mu.L (2.5X 10), respectively ⁵ Individual cells) was added to the upper chamber, and 600. Mu.L of SMCM medium was added to the lower chamber, the content was 10% of FBS, 5% of CO at 37% ₂ And culturing for 24 hours in an incubator, taking out the upper chamber, carefully removing cells on the upper surface of the chamber membrane by using a cell swab or a cotton swab, staining the cells on the lower surface by using crystal violet, and analyzing the number of the migrated cells by using Image J software.

5. RNA pulldown, silver staining and mass spectrometry

Biotinylated RNA probes were incubated with streptavidin magnetic beads (Invitrogen, cat. No. 15942-050). Total cellular proteins were extracted using RIPA lysis buffer containing complete protease inhibitors (Roche, germany). A total of 1mg total cellular protein was added to the RNA-bound streptavidin magnetic beads and the complexes were incubated for 1 hour at room temperature. The complex was then centrifuged at 1000rpm for 10 minutes and washed three times. With a wash buffer. RNA-binding proteins were eluted in 50. Mu.l 5 XSDS sample buffer, denatured at 95 ℃ for 10 min, and then separated by SDS-PAGE on an 8% acrylamide gel (Bio-Rad, hercules, calif.). RNA-bound proteins were visualized by silver staining (Beyotime, china, cat. # P0017S), and protein bands of interest were excised and sequenced by Mass Spectrometry (MS) at Shanghai LuMing Biological Technology co.ltd (Shanghai, china).

6. RIP experiments prove the in vivo interaction of TPRG1-AS1 and MYH9 protein

The experimental operation was performed according to the Kit (EZ-Magna RIP RNA-Binding Protein immunopropraction Kit, millipore-17-701) instructions, using precooled PBS to prepare cell lysate, adding the cell lysate into the complex of magnetic bead-MYH 9 Protein antibody (ab 238131), purifying RNA, and qRT-PCR to detect the level of enrichment of TPRG1-AS 1. Rabbit IgG (ab 172730) was used as negative control.

The primers used were as follows:

TPRG1-AS1-F:TCAAAAGGCCTTGATCCCGA(SEQ ID NO:21)

TPRG1-AS1-R:AAGGACTCTGCTTCATGGGTG(SEQ ID NO:22)

GAPDH-F：GTCTCCTCTGACTTCAACAGCG(SEQ ID NO:23)

GAPDH-R:ACCACCCTGTTGCTGTAGCCAA(SEQ ID NO:24)。

7. ChIRP assay

The 20-mer antisense DNA probe targeting TPRG1-AS1 RNA and the negative control lacZ RNA were designed such that 1 probe covered every 100bp of RNA with a target GC% of 45. All probes were biotinylated at the 3' end. First, cultured cells (A), (B)>2.0×10 ⁶ Individual cells) were cross-linked to 960mJ by 240mJ UV and cells were scraped off by adding 1mL of pre-cooled PBS containing 10 μ L stop mix. 1mL lysis buffer suspension cells containing protease inhibitors were added to UV cross-linked cells. If a sticky mass is produced, the genome can be disrupted by sonication. TPRG1-AS1 and its interacting proteins were precipitated using streptavidin magnetic beads (Invitrogen, ca, USA). The RNA was eluted with RNA pK buffer and proteinase K and then isolated using Trizol reagent. The proteins were eluted with a mixture of RNase a (Sigma-Aldrich) and RNase H (Epicenter) and DNase I (Invitrogen). The TPRG1-AS1 after separation is analyzed and verified by qRT-PCR, and the protein is identified by Western blot. The primers and probes used are shown in Table 4.

TABLE 4

8. Detecting the influence of TPRG1-AS1 on MYH9 protein

AdGFP and AdTPRG1-AS1 are respectively infected or siNC and siTPRG1-AS1 are respectively transfected into HASCACs, cell proteins are extracted after 48 hours, and the change of MYH9 protein is detected by Western blot.

9. Detection of MHY9 protein half-life

Respectively transfecting HASCACs by the sinC and the siTPRG1-AS1, treating the cells by using a protein synthesis inhibitor cycloheximide (500 mu M) after 24 hours, respectively extracting cell protein at 0 hour, 8 hours and 16 hours of treatment, and detecting MYH9 protein change by Western blot.

10. Detection of MYH9 protein stability

Respectively transfecting HASCACs by the sinC and the siTPRG1-AS1, treating the cells by using MG132 (40 mu M) AS a control after 24 hours, extracting cell protein after 24 hours, and detecting MYH9 protein change by Western blot.

11. Effect of interaction of TPRG1-AS1 and MYH9 protein on HASMCs F-actin skeleton formation

F-actin staining 24 hours after HASMCs infection or transfection detects HASMCs F-actin backbone formation: one day before treatment, the HASMCS cells grown to logarithmic phase and in good condition were trypsinized, inoculated into 12-well cell culture plates, the bottom of which was previously provided with small disks (i.e., cell climbing sheets), and cultured in a 5% CO2 incubator at 37 ℃ for 24 hours; the next day, the original medium in the plate was discarded, replaced with fresh complete medium and treatment reagents, and the plates were incubated for 24 hours in a 5% CO2,37 ℃ incubator; taking out the treated cells, and washing the cells with PBS (1 mL) gently for 2 times; adding 500 mu L of 4% paraformaldehyde solution into each hole, and fixing for 30 minutes at room temperature; gently wash the cells 2 times with 1mL of PBS; 0.1% Triton X-100 by adding 500. Mu.L per well, and permeabilizing the cells for 5 minutes; gently wash the cells 2 times with 1mL of PBS; add 500. Mu.L F-actin fluorescently labeled antibody per well (1, red Fluorescence-cytopathiinter, ab 112127) and stain for 90min at room temperature; washing with PBS gently for 2 times, 1mL each time; add 500. Mu.L of DAPI staining solution (1, ab104139) to each well and stain for 10 min at room temperature; the cells were washed 2 times with 1mL of PBS each time; the glycerol is dropped on a glass slide, a round small round piece is inverted on the glass slide, and the picture is taken and observed under a confocal fluorescence microscope under the condition of keeping out of the sun.

12. Return formation assay Using cytoskeleton F-actin

And knocking down the TPRG1-AS1 and MYH9 gene at the same time, and detecting HASCAS F-actin skeleton formation by F-actin staining, thereby determining the influence of the interaction of the TPRG1-AS1 and MYH9 protein on the formation of the HASCAS F-actin skeleton.

13. Application of cell migration and cytoskeleton formation recovery experiments

And (3) knocking down TPRG1-AS1, simultaneously using DMSO AS a control, applying an F-actin polymerization inhibitor Cytochalasin D (Cytochalasin D) to treat cells (10-7 mu M) for 24 hours, performing a transwell migration experiment, performing F-actin staining in parallel to detect HASMCs F-actin framework formation, and determining that the HASMCs F-actin formation is necessary for knocking down TPRG1-AS1 to induce HASMCs to migrate.

14. Rat carotid artery sacculus injury model study TPRG1-AS1 function in angiogenesis intima formation

The left carotid artery of the rat was balloon-expanded, and the right carotid artery was used as a control without balloon injury. Male Sprague-Dawley rats weighing 350-400g were anesthetized with sodium pentobarbital (30 mg/kg body weight) and the left carotid artery was exposed. A balloon catheter of diameter 2.0mm was inserted into the left common carotid artery via the external carotid artery. The balloon was inflated in the left common carotid artery and removed, inserted, and repeated three times. After balloon injury, ad-TPRG1-AS1 (1.5X 108 pfu/mL) and Ad-GFP (1.5X 108 pfu/mL) solutions (100. Mu.L) were injected into the left common carotid artery ligation segment for 30 min, and 14 days after balloon injury, animals were sacrificed, arteries were isolated and harvested, fixed with 10% paraformaldehyde for 24 h, and embedded in paraffin. Each specimen was evenly cut into 5-8 sections at the wound site. Hematoxylin/eosin staining, quantification of neointimal formation degree. The intima-media (I/M) area ratio was measured using ImageJ software.

15. Vascular remodeling study of smooth muscle cell-specific TPRG1-AS1 transgenic mice

A. Primary culture of mouse aortic smooth muscle cells: isolation of mice from Experimental group (TPRG 1-AS 1) ^SMCKI ) And control group mouse (TPRG 1-AS 1) ^WT ) The primary culture system is established by the aortic smooth muscle cells: anesthetizing a mouse (more than 8 weeks old) by a conventional method, soaking the mouse in 75% ethanol for 5 minutes, opening the chest and the abdominal cavity, and exposing the heart; cutting a cut at the right atrium by ophthalmic scissors, puncturing the left ventricle by a 5mL syringe, and flushing the aorta by PBS buffer solution; completely separating aorta, placing into 35mm sterile plate, preparing 1mg/mL collagen I with serum-free DMEM, and filtering to obtain new centrifuge tube; completely removing the extra-vascular connective tissue under a microscope, and digesting collagen I for 30 minutes to 1 hour; the adventitia of the blood vessel is stripped under a microscope, and the inner part of the blood vessel is gently scraped by sterile forcepsA film; placing the three blood vessels into a 5mL centrifuge tube, shearing the three blood vessels into pieces (1 mm multiplied by 1 mm), transferring the tissues into a primary cell culture bottle, and digesting the tissues for 2 hours at 37 ℃; centrifuging at 1000RPM for 5 minutes, and carefully discarding the supernatant; the pellet was resuspended in 20% FBS, added to a flask, and incubated absolutely static for 3 days, 3 days after which the cells were essentially confluent, fresh medium was replaced, and the cells were transferred to a 6cm dish as long as 80%.

B. Effect of over-expression of TPRG1-AS1 on MYH9 protein levels: two groups of genotype smooth muscle cell proteins are respectively extracted, western blot is used for detecting MYH9 protein expression change, and the influence of over-expression TPRG1-AS1 on the level of MYH9 protein of mouse arterial smooth muscle cells is researched.

Effect of tprg1-AS1 overexpression on cell migration: two groups of cell migration conditions are detected by using a Transwell migration experiment, and the influence of over-expression of TPRG1-AS1 on the migration of mouse arterial smooth muscle cells is researched.

Influence of TPRG1-AS1 overexpression on the formation of cytoskeleton F-actin: the fluorescent-labeled phalloidin is used for detecting the formation of the F-actin in the two groups of cells, and the influence of over-expression TPRG1-AS1 on the formation of the F-actin in the aortic smooth muscle cytoskeleton of the mouse is researched.

E. Carotid guidewire injury model: mice weighing 25 to 35 grams (8-12 weeks), 3% chloral hydrate, dosed at 0.2ml/25g body weight, i.p. injected; fixing the mouse in a supine position, removing hair, sterilizing three times by using an aseptic cotton swab, and sterilizing instruments in advance; performing carotid artery operation under a dissecting microscope, cutting a midline incision at the ventral side of the neck, exposing and separating the left carotid artery, and ligating the proximal end of the left common carotid artery; placing a ligature at the bifurcation of the carotid artery and on the internal carotid artery, and ligating the internal carotid artery; placing two ligature wires (operation wires, size 6-0) at the carotid bifurcation and on the external carotid artery for distal ligation; making an incision between two ligations, inserting a bent flexible guide wire (diameter 0.35 mm) through the incision into the common carotid artery for 1cm, rotating the guide wire along the blood vessel for three times, and taking out the guide wire; the proximal end of the external carotid incision was ligated, the internal carotid ligature and the common carotid ligature were disconnected to restore blood flow, and the skin incision was closed with two suture clips (7.5 × 1.75 mm). After 14 days, the mice were sacrificed, carotid arteries were harvested, 4% paraformaldehyde was fixed overnight, paraffin embedded, and HE staining was used to detect femoral artery intimal thickening.

16、TPRG1-AS1 ^SMCKI Apoe ^-/- Mouse atherosclerosis model study

TPRG1-AS1 ^SMCKI Mice with Apoe ^-/- Mouse hybridization, propagation and identification are carried out, and a sufficient amount of TPRG1-AS1 is finally obtained ^SMCKI ；Apoe ^-/- Male mice.

A. Induction of high fat diet: experimental group (TPRG 1-AS 1) ^SMCKI ；Apoe ^-/- ) Mouse, control group (TPRG 1-AS 1) ^SMCKI ) Mice, all male, 8 weeks old. High fat diet (Huafukang H10141) for 20 weeks (TPRG 1-AS 1) ^SMCKI ；Apoe ^-/- Group, TPRG1-AS1 ^SMCKI Group), 10 mice in each group, 40 mice in total, and feeding in a single cage, wherein the room temperature is 18-25 ℃, the relative humidity is 50% -80%, the illumination is 12 hours per day, and the food intake and the water drinking are free.

B. And (3) measurement of physiological indexes: observing and recording the vitality and survival condition of each group of mice, and measuring the body weight; the DSI implanted physiological signal remote measuring system is used for recording real-time physiological indexes of the mouse, such as blood pressure, body temperature, electrocardio, respiration, activity and the like in one week.

C. Blood collection and blood lipid concentration (TC, TG, HDL-c, and LDL-c) determination: 3% chloral hydrate, according to the dosage of 0.2ml/25g body weight through abdominal cavity anesthesia mouse, the retroorbital venous plexus obtains the blood sample, collect in 1.5ml microcentrifuge tube, after standing still and waiting it to solidify at room temperature, centrifuge at 3000rpm for 10 minutes, take the supernatant in the new centrifuge tube, and record the volume, dilute to total volume 500. Mu.l with normal saline, the full-automatic biochemical analyzer detects Total Cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL-c) and low density lipoprotein cholesterol (LDL-c).

D. Abdominal aorta material taking, morphological observation by an oil red O staining method and analysis of arterial lesion degree: after the aorta was fixed by retrograde perfusion from the left ventricle with saline and 4% paraformaldehyde, the entire aorta was dissected from the aortic root to the abdominal aortic end.

Obtaining the general blood vessels: dissecting the mouse, exposing thoracic and abdominal aorta, stripping adventitia, separating tissue, and keeping aortic root (including aortic arch bifurcation) to iliac artery bifurcation; fixing in 4% paraformaldehyde. Fix both ends with needles under the scope of the body mirror, carefully strip the peripheral fat until no obvious residue. The aorta is carefully cut off longitudinally under the stereoscope with a pair of microscopical eye scissors, and the aortic arch three-branch and the iliac artery branch are also cut off. The cut aorta is spread on a water-containing black rubber plate, the lumen surface faces upwards, the aorta is fixed by fine needles from top to bottom in sequence, the needles face towards the outside, and the blood vessel is exposed so as to be convenient for taking a picture.

E. Dyeing with oil red O: the oil red O working solution is oil red O storage solution and distilled water according to the weight ratio of 3:2, and filtering the mixture by a 0.22 mu m filter for later use. Discarding water in the black rubber plate, and dripping 60% isopropanol into aorta for 10 minutes; removing redundant isopropanol, dropwise adding oil red O working solution, and dyeing for 30 minutes to 1 hour; washing with distilled water dropwise for 3 times to remove excessive dye solution; clean distilled water was added to submerge the vessels, and a photograph was taken.

Placing the dyed aorta on the surface of rubber, taking a digital camera for microspur shooting, analyzing by using Image Pro Plus software, and detecting the total lipid area dyed by oil red O and the total surface area of the aorta: index of plaque formation = (total oil red O positive staining area/total surface area of aorta) × 100%.

F, HE staining: 4 μm thick paraffin sections were HE stained by an automatic HE staining apparatus according to standard procedures.

G. And (3) immunofluorescence staining: paraffin sections were blocked in blocking buffer with goat serum for 1 hour, then incubated with MYH9 (ab 75590, 1. After 1 hour of rewarming at 37 ℃, sections were washed with PBS and incubated with a fluorescently labeled secondary antibody (Alexa Fluor 488 goat anti-rabbit IgG (h + L), invitrogen, a11008,1 500) for hours at 37 ℃. Nuclei were stained with DAPI and photographed using a confocal laser scanning microscope.

Example 1 expression of TPRG1-AS1 in the genotype-tissue expression (GTEx) database, atherosclerosis-associated GEO dataset, and PDGFBB-induced HASMCs cell model

The TPRG1-AS1 expression condition is analyzed by applying a genotype-tissue expression (GTEx) database, an atherosclerosis related GEO data set and a platelet-derived growth factor BB (PDGFBB) induced HASCAS cell model.

The results are shown in FIGS. 1A to 1E. Data from GTEx demonstrate that TPRG1-AS1 is expressed in human arterial tissue, including aorta and coronary arteries (fig. 1A). The qRT-PCR experiment detects the expression of TPRG1-AS1 in atherosclerotic plaque and mammary artery (IMA) specimens of patients obtained from Carotid Endarterectomy (CEA) in coronary artery bypass surgery, and the expression level of TPRG1-AS1 in carotid atherosclerotic plaque is obviously increased (FIG. 1B). lncRNA/mRNA expression profile (GSE 97210) data from human normal intima and late unstable atherosclerotic plaques showed a significant increase in TPRG1-AS1 expression in atherosclerotic plaques (fig. 1C). RNA sequencing data (GSE 120521) of stable and unstable sections of human atherosclerotic plaques demonstrated a significant increase in the expression level of TPRG1-AS1 in the area of plaque instability (fig. 1D). HASCACs treated with PDGF-BB showed a significant decrease in TPRG1-AS1 expression (FIG. 1E).

Example 2 TPRG1-AS1 full Length of transcript and subcellular localization in HASMC

Obtaining a TPRG1-AS1 transcript full-length sequence by applying 3 'and 5' -RACE (Rapid amplification of cDNA ends, RACE) experiments and Sanger sequencing, and verifying the size of the TPRG1-AS1 transcript by Northern blot experiments; determining subcellular localization in TPRG1-AS1HASMCs using RNA FISH (fluorescence in situ hybridization, FISH); analyzing the conservatism of the TPRG1-AS1 by using PholoCSF software; the protein coding ability of TPRG1-AS1 is predicted by BLAST software, and the protein coding ability is proved by in vitro transcription-translation experiment.

3 'and 5' -RACE experiments and Sanger sequencing confirmed that the TPRG1-AS1 full-length sequence is 1279nt (FIG. 2, FIG. 3A and FIG. 3B, SEQ ID NO; northern blot experiments show that the length of the transcript of TPRG1-AS1 in HASMCs and Human Umbilical Vein Endothelial Cells (HUVECs) is about 1200nt, the length of the transcript is basically consistent with that of the full-length sequence obtained by RACE, and the expression level of the TPRG1-AS1 in the HASMCs is higher than that of the HUVECs (figure 4); RNA FISH results showed that TPRG1-AS1 is localized to the cytoplasm and nucleus of HASCAS (FIG. 5).

UCSC online software analyzes species conservation of TPRG1-AS 1. Scoring of TPRG1-AS1 protein coding capacity prediction by PhyloCSF software. The analysis result shows that TPRG1-AS1has low conservation among more than 100 vertebrate species and has no protein coding capacity. ORF finder analyses the Open Reading Frame (ORF) of TPRG1-AS 1. SMART BLAST was used to compare ORF's of identification + against ORF's of maximum length 14. The alignment result shows that no polypeptide with homology to TPRG1-AS1 exists, and the polypeptide does not have the ability of amino acid coding.

The results of in vitro transcription-translation experiments showed that the TPRG1-AS1has no protein-encoding product in the product translated in vitro (FIG. 6). The results show that the TPRG1-AS1has no protein coding capacity and is a real long-chain non-coding RNA.

Example 3 TPRG1-AS1 Regulation of HASMCs migration

In HASMCs, a gain-of-function strategy and a loss-of-function strategy are adopted to carry out a cell proliferation experiment (CCK-8) and a Transwell experiment, and the regulation and control effects of TPRG1-AS1 on the proliferation and migration phenotypes of HASMCs are respectively detected.

CCK-8 proliferation experiments showed that neither overexpression nor knockdown of the TPRG1-AS1 gene in HASMCs affected cell proliferation (FIG. 7). The results of Transwell experiments show that the TPRG1-AS1 is over-expressed in HASMCs to remarkably inhibit the migration of cells, and the TPRG1-AS1 knocking-down remarkably promotes the migration of cells. Overexpression of TPRG1-AS1 significantly inhibited PDGFBB-induced HASMCs migration, indicating that TPRG1-AS1 is involved in PDGFBB-induced HASMCs migration (FIG. 8).

Example 4 interaction of TPRG1-AS1 with MYH9 protein

RNA pulldown and mass spectrometry are used for analyzing and screening binding protein interacting with TPRG1-AS1, and Western blot is used for verification; verifying the interaction of TPRG1-AS1 and binding protein in cells by using RNA binding protein immunoprecipitation (RNA binding protein immunoprecipitation) experiment and CHIRP co-immunoprecipitation (CHIRP) experiment; the subcellular co-localization of TPRG1-AS1 and its binding protein in HASMCs was determined by immunofluorescence technique.

RNA pull down (FIG. 9), mass spectrometry (Table 5, table 6) and results of the ChIRP experiment (FIG. 10) indicate that TPRG1-AS1 binds to MYH9 protein.

Table 5: mass spectrometry of protein band No. 1 of RNA pulled down

Table 6: mass spectrometry of protein band No. 2 of RNA pulled down

RNA RIP experiments further confirmed the interaction of intracellular TPRG1-AS1 with MYH9 protein (FIG. 11).

These results all indicate that TPRG1-AS1 can interact with MYH9 protein.

Example 5 interaction of TPRG1-AS1 with MYH9 protein affects MYH9 protein levels, HASCACs migration, and F-actin stress fiber formation

The influence of the interaction of TPRG1-AS1 and MYH9 protein on MHY9 protein level, HASMCs migration and HASMCs F-actin stress fiber formation is respectively detected by applying western blot and Transwell experiments and F-actin fluorescent staining technology.

Overexpression or knockdown of TPRG1-AS1 in HASMCs did not affect mRNA expression levels of the MYH9 gene (FIG. 12); overexpression of TPRG1-AS1 in HASCACS significantly reduced MYH9 protein levels, while knock-down of TPRG1-AS1 significantly increased MYH9 protein levels, indicating that TPRG1-AS1 affects MYH9 protein levels by interacting with MYH9 proteins. The result of treating HASMCs with protein synthesis inhibitor Cycloheximide (CHX) shows that the half-life of MYH9 protein is prolonged after TPRG1-AS1 knockdown in HASMC. The results of treating HASMCs with proteasome inhibitor MG132 indicated that MYH9 protein could also be degraded by the proteasome pathway in HASMC, and knocking down endogenous TPRG1-AS1 prevented MYH9 protein degradation by the proteasome pathway (FIG. 13).

Overexpression of the MYH9 gene in HASMCs significantly promotes cell migration, and knocking down the expression level of the endogenous MYH9 gene can significantly inhibit cell migration. Cell migration reversion experimental results show that knocking down MYH9 gene significantly inhibits HASMCs migration induced by knocking down endogenous TPRG1-AS1 expression (FIG. 14). The interaction of TPRG1-AS1 with MYH9 protein was shown to affect HASMCs migration.

Consistent with the migration phenotype, overexpression of MYH9 gene expression in HASMCs significantly enhances F-actin stress fiber formation, while knock-down is the opposite; and the over-expression of TPRGRG 1-AS1 can obviously inhibit F-actin stress fiber formation induced by PDGFBB. The results of the recovery experiments show that knocking-down MYH9 obviously inhibits HASMCs F-actin stress fiber bundle increase induced by knocking-down TPRG1-AS1 (figure 15). Showing that the interaction of TPRG1-AS1 and MYH9 protein influences F-actin stress fiber formation.

Example 6 smooth muscle cell specific TPRG1-AS1 transgene significantly reduced neointima formation and significantly reduced Apoe ^-/- Atherosclerotic lesion extent in mice

The method comprises the steps of (1) over-expressing TPRG1-AS1 by using a rat balloon injury model, and detecting the effect of the TPRG1-AS1 on the formation of a blood vessel neointima; construction of smooth muscle cell-specific TPRG1-AS1 transgenic mouse, TPRG1-AS1 transgene and Apoe by CRISPR/Cas9 technology ^-/- A mouse; detecting the influence of TPRG1-AS1 overexpression on vascular remodeling by applying a smooth muscle cell specific TPRG1-AS1 transgenic mouse carotid artery guide wire injury model; application of smooth muscle cell specific TPRG1-AS1 transgenes and Apoe ^-/- Mice were tested for the effect of TPRG1-AS1 overexpression on the extent of atherosclerotic lesions.

The effect of TPRG1-AS1 on rat neointimal formation in blood vessels was evaluated by using a rat carotid artery balloon injury model, and the results showed that overexpression of AdTPRG1-AS1 significantly inhibited neointimal formation, the intima area was reduced, and the intima/media ratio was decreased, compared to Ad-GFP (FIG. 16). The over-expression of TPRG1-AS1 is shown to inhibit the neointimal formation induced by the rat carotid balloon injury.

The CRISPR/Cas9 technology is applied to construct a smooth muscle specific TPRG1-AS1 transgenic mouse and establish the TPRG1-AS1 transgenic mouse. TPRG1-AS1 were isolated separately ^SMCKI And primary Murine Aortic Smooth Muscle Cells (MASMCs) of control mice. In thatHigh expression of TPRG1-AS1 can be detected in MASMC of transgenic mice. TPRG1-AS1 compared to control mice ^SMCKI MYH9 protein levels were significantly reduced in MASMCs in mice. TPRG1-AS1 compared to control mice ^SMCKI Mice had reduced MASMCs and F-actin stress fiber bundles and significantly reduced migratory capacity. The effect of TPRG1-AS1 on the neointimal formation of the rat vessels was evaluated using a mouse carotid artery guidewire injury model. The results show that TPRG1-AS1 compares to control mice ^SMCKI Neointimal formation was significantly inhibited in mice, the intima area decreased, and the intima/media ratio decreased (fig. 17). The vascular smooth muscle specific TPRG1-AS1 transgene is shown to inhibit the neointimal formation induced by carotid artery guide wire injury of mice.

Smooth muscle specific TPRG1-AS1 transgenic mice and Apoe ^-/- Mating mice and establishing smooth muscle specific TPRG1-AS1 transgenic Apoe ^-/- A mouse. TPRG1-AS1 at 8 weeks of age ^SMCKI Apoe ^-/- Mice and control mice were induced for 20 weeks on a high fat diet to establish an atherosclerosis model. Oil Red O staining showed TPRG1-AS1 compared to control mice ^SMCKI Apoe ^-/- Gross oil red staining of mice showed a significant reduction in plaque area. Aortic root H&E staining shows TPRG1-AS1 compared to control mice ^SMCKI Apoe ^-/- The plaque area at the aortic root was significantly reduced in mice. Immunofluorescent staining of aortic root showed TPRG1-AS1 compared to control mice ^SMCKI Apoe ^-/- The percentage of plaque area of MYH9 positive cells was significantly reduced in mice. These results indicate that VSMC-specific TPRG1-AS1 overexpression reduced MYH9 protein levels in atherosclerotic plaques, reducing atherosclerotic lesions (fig. 18). The vascular smooth muscle specific TPRG1-AS1 transgene is shown to inhibit the atherosclerosis of the mice.

Claims (10)

1. Application of long-chain non-coding RNA TPRG1-AS1 in preparation of a reagent for regulating and controlling smooth muscle cell migration.

2. Application of long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation for inhibiting neointimal formation of blood vessels.

3. The use of claim 2, wherein TPRG1-AS1 inhibits atherosclerotic lesions by inhibiting smooth muscle cell neointimal formation.

4. The use of any one of claims 1-3, wherein the smooth muscle cells are vascular smooth muscle cells.

5. The use of claim 4, wherein the smooth muscle cells are arterial smooth muscle cells.

6. Application of long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation interacting with MYH9 protein.

7. The use of claim 6, wherein TPRG1-AS1 interacts with MYH9 proteins to promote MYH9 protein degradation and/or to block F-actin stress fiber formation.

8. The use of claim 6, wherein TPRG1-AS1 interacts with MYH9 protein to regulate smooth muscle cell migration.

9. The use of claim 6, wherein VSMC-specific TPRG1-AS1 overexpression reduces MYH9 protein levels in atherosclerotic plaques, reducing atherosclerotic lesions.

Use of a myh9 gene and/or protein in the preparation of a reagent for modulating smooth muscle cell migration.

Images