CN115896302A - SNP molecular markers related to pig reproductive traits and their application - Google Patents

Abstract

The invention discloses a SNP molecular marker related to pig reproductive traits. The gene fragment containing the SNP molecular marker is shown in SEQ ID NO: 1, and the gene fragment includes 3 SNP sites related to pig reproductive traits: The G>A mutation represented by M at the 32nd position in the sequence shown in SEQ ID NO:1, the A>G mutation represented by R at the 512th position, and the T represented by S at the 1153rd position > A mutation. By applying the obtained SNP molecular markers to the fields of breeding pigs with superior reproductive traits, breeding pig lines with superior reproductive traits, genetic improvement of pig reproductive traits, etc., the breeding period can be greatly shortened, the breeding efficiency can be improved, and the genetic improvement process of pigs can be accelerated. .

Description

SNP molecular markers related to pig reproductive traits and their application

technical field

The invention relates to the fields of molecular markers and animal genetic breeding, in particular to a SNP molecular marker related to pig reproductive traits and its application.

Background technique

my country is a big pig raising country, and the economic benefits of pig farming directly affect the stability of national food security. In order to reduce costs and increase efficiency to obtain higher returns, it is particularly important to improve the reproductive performance of sows. However, the genetic structure of reproductive traits is relatively complex, and due to its low heritability, the progress of conventional selection has been slow. Therefore, the application of molecular marker-assisted breeding is particularly important for improving reproductive traits of sows.

Follistatin, also known as FSH inhibitory protein, is a single-chain glycoprotein. Initially, it was thought that follistatin was just a binding protein of activin (Activin, ACT), and regulated the reproductive activity of animals through the Activin/Follistatin system. However, experiments in recent years have shown that Follistatin interacts with many members of the transforming growth factor-β (TGF-β, transforming growth factor-13) superfamily, such as bone morphogenetic protein (BMP, bone morphogenetic protein) in a paracrine or autocrine manner. ), myostatin (myostatin) and other combinations play an important role in organs and tissues other than the reproductive system. However, there are few studies on its expression and polymorphism in pigs, especially there is no report on the correlation analysis between FST gene polymorphisms and pig reproductive traits.

Contents of the invention

The purpose of the present invention is to provide a SNP molecular marker related to pig reproductive traits and its application, so as to solve the above problems.

According to one aspect of the present invention, a SNP molecular marker related to pig reproductive traits is provided, the gene fragment containing the SNP molecular marker is shown in SEQ ID NO: 1, and the gene fragment includes 3 genes related to pig reproductive traits Relevant SNP sites: the G>A mutation represented by M at the 32nd position in the sequence shown in SEQ ID NO: 1, the A>G mutation represented by R at the 512th position, and the A>G mutation at the 512th position The T>A mutation represented by S at position 1153.

In certain embodiments, the three SNP molecular markers are fully linked inheritance.

In some embodiments, the reproductive traits include one or more of the following traits of Large White sows: paternity index, teat number, stillbirth number, litter weight, and gestation period.

According to the second aspect of the present invention, the application of a SNP molecular marker in breeding pigs with dominant reproductive traits is provided. and pigs whose allele type at the 1153 site is GG/AA/TT or AG/GA/AT genotype;

Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when breeding individuals with the trait of short gestation period, select pigs whose allelic types at the 32nd, 512th and 1153rd positions are AG/GA/AT genotypes.

In some embodiments, the method for use in breeding pigs with advantageous reproductive traits includes:

1) detecting the SNP molecular markers of the 32nd, 512nd and 1153rd positions in the sequence shown in said SEQ ID NO: 1 to piglets;

2) When breeding pigs with dominant sire index or teat number traits, select and retain the allele types of the 32nd, 512th and 1153rd loci detected in step 1) as GG/AA/TT or AG/GA/AT genotyped pig;

Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes;

Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes;

3) Breeding the pigs selected in step 2) to obtain pigs with superior reproductive traits.

According to a third aspect of the present invention, a kind of SNP molecular marker is provided to cultivate and have the application on breeding pig line of superior reproductive traits, the gene segment that contains this SNP molecular marker is shown in SEQ ID NO:1, in described gene The fragment includes 3 SNP sites related to pig reproductive traits: in the sequence shown in the SEQ ID NO: 1, the G>A mutation at the 32nd position is represented by M, and the mutation at the 512th position is represented by R The A>G mutation indicated by , and the T>A mutation indicated by S at the 1153rd position.

In some embodiments, the methods for use in breeding pig lines with superior reproductive traits include:

1) detect the molecular markers at positions 32, 512 and 1153 in the sequence shown in SEQ ID NO: 1 for alternative breeding pigs to be reserved;

2) When breeding pigs with dominant sire index or teat number traits, select and retain the allele types of the 32nd, 512th and 1153rd loci detected in step 1) as GG/AA/TT or AG/GA/AT genotyped pig;

Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes;

Or when breeding individuals with the trait of less stillbirth, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes;

3) The pigs selected in step 2) are used as breeding pigs for mating, and breeding is carried out to cultivate breeding pig strains with superior reproductive traits.

According to the fourth aspect of the present invention, an application of a SNP molecular marker in the genetic improvement of pig reproductive traits is provided, the gene fragment containing the SNP molecular marker is shown in SEQ ID NO: 1, and the gene fragment includes 3 SNP sites related to pig reproductive traits: the G>A mutation represented by M at the 32nd position in the sequence shown in the SEQ ID NO: 1, and the A represented by R at the 512th position >G mutation, T>A mutation represented by S at position 1153.

In certain embodiments, the methods applied in the genetic improvement of reproductive traits include:

1) detect the molecular markers at positions 32, 512 and 1153 in the sequence shown in SEQ ID NO: 1 for alternative breeding pigs to be reserved;

2) When breeding pigs with dominant sire index or teat number traits, select and retain the allele types of the 32nd, 512th and 1153rd loci detected in step 1) as GG/AA/TT or AG/GA/AT genotyped pig;

Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes;

Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes;

3) The pig individuals selected in step 2) are used as breeding pigs for mating, and the offspring continue to select and retain the genotype pigs with corresponding dominant traits as described in claim 4, and eliminate other genotype pigs to increase the corresponding dominant alleles from generation to generation Type frequency, thereby improving and improving the reproductive traits of offspring pigs.

Beneficial effects of the present invention:

1. Obtain 3 SNP sites related to pig reproductive traits on the FST gene, laying an application foundation for subsequent gene chip research and genetic breeding.

2. Apply the obtained 3 SNP sites to breeding sows with superior reproductive traits. You can select sows with superior reproductive traits by detecting the base mutation of the corresponding SNP sites during the piglet period. Greatly improve breeding efficiency and save production costs.

3. Applying the obtained 3 SNP sites to breeding pig strains with superior reproductive traits can greatly shorten the breeding period and efficiently obtain breeding pig strains with corresponding superior reproductive traits.

4. Applying the obtained 3 SNP loci to the genetic improvement of reproductive traits can improve the reproductive traits of pig breeds, especially Large White pig breeds, and improve the competitiveness of sows.

5. The 3 SNP molecular markers at the 32nd, 512nd and 1153rd positions are completely linked inheritance, which can be studied as a whole in gene chip research and subsequent genetic breeding research, saving time and speeding up efficiency.

Description of drawings

Fig. 1 is the SNPs peak diagram of FST gene;

Fig. 2 is FST gene SNPs gene linkage genetic analysis;

Fig. 3 is a prediction map of the secondary structure of FST gene mRNA.

Detailed ways

1. Test material

The test pigs were all from Tiankang Livestock Breeding Farm in Wujiaqu, Xinjiang (316 large white sows), with consistent feeding and management conditions, healthy and disease-free. Ear tissue samples were collected, put into 1.5ml centrifuge tubes containing 75% ethanol, and brought back to the laboratory in an ice box for storage in a -20°C refrigerator for subsequent extraction of tissue DNA. And sort out the relevant reproductive traits data for future use.

2. DNA extraction

Cut a little pig ear tissue sample into a sterile 1.5ml centrifuge tube, and perform DNA extraction according to the instructions of Beijing Tiangen Biochemical Co., Ltd. Blood, Cell and Tissue DNA Extraction Kit. Nano 2000 was used to measure the DNA concentration, and the samples whose 260/280 value was between 1.7 and 2.0 and the concentration was greater than 50ng/μL were screened, and stored in a -20°C refrigerator for subsequent use.

3. Primer design

According to the full-length sequence of the porcine FST gene (Ensembl number: ENSSSCG00000016892) provided by the Ensembl database, PrimerPrimier 5.0 was used to design primers for PCR amplification. The primers were synthesized by Shanghai Sangong, and the primer sequences are shown in Table 1.

Table 1 Primer Sequence

4. Mixed pool sequencing

40 qualified DNA samples were randomly selected, and 10 μl of each sample was used to construct a DNA pool for PCR amplification. PCR reaction program: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 60 s, a total of 35 cycles; final extension at 72°C for 10 min; storage at 4°C. After the size of the target band was detected by electrophoresis, it was sent to Shanghai Sangon Biotech for sequencing. The sequencing results were analyzed by chromas 2.6.5 software (the peak diagram is shown in Figure 1), and the forward and reverse sequencing sequences were compared with the sequences obtained by Ensembl. DNAMAN 6.0 software was used to compare and detect the SNPs of genes.

5. Typing of polymorphic sites

基于多重PCR的靶向测序基因型分型技术对候选的SNPs进行基因分型。Entrust Shijiazhuang Bo Ruidi Company to use the screened polymorphic sites

Candidate SNPs were genotyped using multiplex PCR-based targeted sequencing genotyping technology.

6. Data acquisition

Record the number of teats at birth, the age at 100kg body weight and the thickness of 100kg backfat of the tested pigs, and calculate the corrected data of the above phenotypes with reference to "Procedures for Measuring Production Performance of Breeding Pigs" (NY/T 822-2004). The EBV of each index is evaluated by the best linear unbiased prediction (BLUP) established by the pig farm based on the phenotype and pedigree information of each trait, and calculated by using the EBV of 100kg body weight day-old and 100kg backfat thickness according to the calculation formula in the following example The sire index of the tested sows. The number of stillbirths, litter weight at birth, and length of gestation of the offspring were counted.

Paternity Index: TLI=100-4.8xBVBF-2.0xBVDAYS. Among them, BVBF is the corrected 100Kg backfat thickness breeding value, and VDAYS is the corrected 100Kg body weight day-age breeding value.

7. Data statistics and analysis

Use Excel 2016 to sort out the data and count the results of each typing, refer to the literature (Hou Haobin, Li Haijing, Yang Li, et al. Association analysis between polymorphisms in the NCAPG-DCAF16 gene region of Texas donkeys and growth traits[J]. Journal of Animal Husbandry and Veterinary Medicine, 2019,50(02):302-313.) method to analyze genotype frequency, gene frequency, genetic homozygosity (Ho), genetic heterozygosity (He), effective number of genes (Ne), polymorphism Information content (PIC), Hardy-Weinberg test, and online software RNAfold web server were used to predict the secondary structure of mRNA before and after exon region mutation, and Haploview 4.2 software was used to analyze the linkage disequilibrium of FST gene SNPs.

The correlation analysis between each SNP site of the FST gene and the lifelong reproductive traits of the tested pigs, including: the number of stillbirths, litter weight and gestation period, used the general linear model (General LinearModel) of SPSS 26.0, and the model was as follows:

y _ijk =μ+G _i +P _j +e _ijk

In the formula, y _ijk is the observed value of traits, μ is the overall mean, G _i is the genotype effect, P _j is the parity effect, e _ijk is the random error, assuming that e _ijk are independent of each other and obey the N(0, σ ² ) distribution .

SPSS 26.0 One-way ANOVA was used to analyze the association between FST gene SNPs and the paternity index and the number of teats of the tested sow group, and the traits corresponding to different genotypes were expressed in the form of "mean ± standard deviation" Indicates that P<0.05 is considered as the significance of the difference. 9. FST effective SNPs site information

Through the above test methods and analysis, the three SNPs sites in Table 2 were obtained, among which g.32808636 had a single base mutation of G>A; g.32809116 had a single base mutation of A>G, without changing its coded Glu; g.32809757 had a single base mutation of T>A; they were named P1, P2 and P3 respectively. The nucleotide sequence of the three SNP sites is shown in SEQ ID NO: 1: TGGTGGGTTCCCCCTAACTGCCTCCAGCCCCM[A/G]GTAAGCCATTGGCGTTGAATTTTGGCAGTCGTATACCACAGGCAAAACAAGATCTGCAGAGGTGACCTCTTAGCCAAATGCGGTGGTGACACCAGCCAGCCTCTCACTTTGAGAGAGATTTGGGATTGGGAACCAAAATCCCCGTCCG TAGACCCCTCAGGCTTGAACTCCCGGCTGCGCGATTGCGCAAGGCACCCGAAGCCCTCCTGGCTGACCTGTTTGGTGCCTGGCCCTGGTTTTAATCCCCCTGCCTCTTCCAACTCTTAGAAACGTGCGAGAACGTGGACTGTGGGCCCGGGAAAAAATGCCGAATGAACAAGAAGAACAAACCCTGCTGCGTCTGCGCCCCGGGATTGGTTCTAACATCCACCTGGAAGT TACCGCAACGAATGTGCTCTCCTCAAGGCCAGATGTAAAGAR[G/A]CAGCCGGAACTGGAAGTCCAGTACCAAGGCAAATGTAAAAGTAGGTCACCCTCCTCCAGCTTTCAACCTGAGGTAGTCCCGCAGCAAGACCCCTGGGGTTTGGTGTAGTCACAGTAAGAGCCTAATGATATCAAATAAAGGAACCCTTTTTCTAATGACTCCTTAAGAACGCTAGGCACCATTTAG TCCCAAAATAAATTTTTGAAAGCTGGATGCTTCCATTCATGATTTCCTTGATAGTATCAAATGCTGAGTCCCAAAGTACCAGGAAGGTGCCTATTAACGTGTGTTTCTCCTTTGTTTCAGAGACCTGTCGGGATGTTTTCTGTCCAGGCAGCTCCACATGTGTGGTGGACCAGACTAATAATGCCTACTGTGTGACATGTAACCGGATTTGTCCAGAGCCACCTCTCACGAACG TCCAGTGCCTGTCACCTGAGAAAGGCTACCTGCCTACTGGGCAGATCTATTGGATTGGCCTATGAGGGAAAGTGTATCAGTAGGTATTCTGGATTGAGAAAGGAAAAGAAATAAATGGGAAAAGGGAAAAAGGCTAATTCTGTCATTAAAAS[A/T]AAGCCTAAAGCCCCCCAAACACACTTCGCTTCAGCAAAGGGACAAGGATTCCAGTTTCAGTCGTCAAA CACATATATTGAAATGGCAGCAAGACACAGGAAACAATTTTCCTTCATAGAAACCCAAGACCTCACTCACTTTTACACATCTTTTAAAGTGCTAGACTTGCTGGAAGCAAGAAATAATTACTTAACAGTTCCTAAAATCTGTTCTCAGATTCTGATAACTAATGGAACTTTTTTTTTTTTAAGATCCCACTTATGGGAAATAAATAAATATGTATATTTAACTCACAGATATTGTCAATCCAATC ATTATAGTATGAAGGGTGTGTGTGTGTGTGTTGAGTTTCACCGGTTTTTTAAAAGAACATTTTTGCACCATATCTCCATTAAC

Among them, the 32nd position (P1) is represented by M as G>A mutation, the 512th position (P2) is represented by R as A>G mutation, and the 1153rd position (P3) is represented by S as T>A mutation.

Table 2 FST gene SNPs site information

10. FST gene polymorphism information content, heterozygosity, effective allele number and chi-square test

Through the typing detection of the above 3 SNPs, 3 genotypes (as shown in Table 3) were detected in the 3 candidate loci in the Large White sow herd (as shown in Table 3), and 2 of the 316 samples failed to be typed and succeeded. The rate is greater than 99.36%. Among them, P1 is GG>AG>AA in the Large White herd, and G is the dominant gene; P2 is AA>GA>GG in the Large White herd, and A is the dominant gene; P3 is TT>AT>AA in the Large White herd, T is the dominant gene. The chi-square result test showed that the three SNPs in the Large White pig population were in accordance with the Hardy-Weinberg equilibrium law, and the polymorphism analysis showed that P1, P2 and P3 were in low polymorphism in the Large White pig population.

Table 3 FST gene polymorphism information content, heterozygosity, effective number of alleles and chi-square test

Note: χ ² =5.99 when df=2, P=0.05; ^P =0.01, χ ^{2 =} 9.21; Low polymorphism; 0.25≤PIC<0.5 is moderate polymorphism; PIC≥0.5 is high polymorphism.

11. Linkage disequilibrium analysis of FST gene

According to the SNPs information of FST gene, linkage disequilibrium analysis was carried out by using Haploview 4.2 software. As shown in Fig. 2, the three loci of FST gene P1, P2 and P3 are in complete linkage in Large White sow herd (D'=1, R ² =1) (Fig. 2).

12. Prediction of mRNA secondary structure after exon mutation of FST gene

It can be seen from Figure 3 that when the P2 synonymous mutation occurs in the CDS region of the FST gene, the secondary structure of the FST gene mRNA does not change (Figure 3), but the wild-type and mutant free energy changes, wherein the minimum free energy of the wild-type It is -1752.37kcal/mol, while the minimum free energy of the mutant is -1763.62kcal/mol, and the free energy of the wild type is higher than that of the mutant.

13. The effect of polymorphic sites of FST gene on paternity index and number of teats of sows tested

At P1/P2/P3 loci, the paternity index and the number of nipples at birth were significantly lower in AA/GG/AA type individuals than in GG/AA/TT type individuals and AG/GA/AT type individuals (P<0.05) (Table 4).

Table 4 Association analysis of FST gene polymorphisms and reproductive traits of sows

Note: Different lowercase letters on the shoulder labels of the same site in the same row of data indicate significant differences (P<0.05), and different uppercase letters indicate extremely significant differences (P<0.01).

14. Effects of FST gene polymorphisms on lifelong reproductive performance of sows

At the P1/P2/P3 site, the litter weight of GG/AA/TT individuals was significantly higher than that of AA/GG/AA individuals (P<0.05), and the number of stillbirths of GG/AA/TT individuals was significantly less than that of AA/GG/AA type individuals (P<0.05), AA/GG/AA type individuals were extremely significantly longer than AG/GA/AT type individuals (P<0.01), significantly longer than GG/AA/TT type individuals ( P<0.05) (Table 5).

Table 5 Effects of FST gene polymorphisms on lifelong reproductive performance of tested sows

Note: Different lowercase letters on the shoulder labels of the same site in the same row of data indicate significant differences (P<0.05), and different uppercase letters indicate extremely significant differences (P<0.01).

15. The application of FST gene polymorphism molecular markers in breeding pigs with superior reproductive traits. Detect the SNP molecular markers of P1/P2/P3 sites on the FST gene in piglets;

When it is necessary to breed pigs with dominant sire index or birth teat number traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT or AG/GA/AT genotypes;

Or when it is necessary to select and breed individuals with superior litter weight traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT genotypes;

Or when selecting and breeding individuals with the traits of fewer stillbirths, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when it is necessary to select and breed individuals with traits of short gestation period, select the pigs whose alleles at the P1/P2/P3 sites are AG/GA/AT genotypes;

Pigs with corresponding advantageous reproductive traits can be obtained by breeding the above-mentioned selected pigs with corresponding advantageous traits.

16. The application of FST gene polymorphic trait molecular markers in the breeding of breeding pig lines with superior reproductive traits

Detect the SNP molecular markers of the P1/P2/P3 sites on the FST gene for the alternative breeding pigs to be reserved;

When it is necessary to breed pigs with dominant sire index or birth teat number traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT or AG/GA/AT genotypes;

Or when it is necessary to select and breed individuals with superior litter weight traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT genotypes;

Or when it is necessary to select and breed individuals with traits that have a small number of stillbirths, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when it is necessary to select and breed individuals with traits of short gestation period, select the pigs whose alleles at the P1/P2/P3 sites are AG/GA/AT genotypes;

The pigs with corresponding advantageous traits selected above are used as breeding pigs for mating and breeding to cultivate breeding pig strains with superior reproductive traits.

17. Application of FST gene polymorphic trait molecular markers in genetic improvement of reproductive traits

Detect the SNP molecular markers of the P1/P2/P3 sites on the FST gene for the alternative breeding pigs to be reserved;

When it is necessary to breed pigs with dominant sire index or birth teat number traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT or AG/GA/AT genotypes;

Or when it is necessary to select and breed individuals with superior litter weight traits, select pigs whose alleles at the P1/P2/P3 sites are GG/AA/TT genotypes;

Or when it is necessary to select and breed individuals with traits that have a small number of stillbirths, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes;

Or when it is necessary to select and breed individuals with traits of short gestation period, select the pigs whose alleles at the P1/P2/P3 sites are AG/GA/AT genotypes;

The above-mentioned selected pigs with corresponding advantageous traits are used as breeding pigs for breeding, and the offspring continue to select and retain the genotype pigs with corresponding advantageous traits as described in claim 4, and eliminate other genotype pigs to increase the corresponding dominant alleles from generation to generation. Type frequency, thereby improving and improving the reproductive traits of offspring pigs.

What have been described above are only some embodiments of the present invention. For those skilled in the art, without departing from the inventive concept of the present invention, several modifications and improvements can be made, and these all belong to the protection scope of the present invention.

Claims (9)

1. SNP molecular markers related to pig reproductive traits, wherein the gene fragment containing said SNP molecular markers is shown in SEQ ID NO: 1, including 3 SNP sites related to pig reproductive traits in said gene fragments: In the sequence shown in SEQ ID NO: 1, the G>A mutation represented by M at the 32nd position, the A>G mutation represented by R at the 512th position, and the S at the 1153rd position The T>A mutation. 2. The SNP molecular marker according to claim 1, wherein the three SNP molecular markers are completely linked inheritance. 3. The SNP molecular marker according to claim 1, wherein the reproductive traits include one or more combinations of the following traits of Large White sows: paternity index, teat number, stillbirth number, litter weight, pregnancy. 4. The application of the SNP molecular marker according to claim 3 in breeding pigs with dominant reproductive traits, wherein, when breeding pigs with dominant paternal index or teat number traits, the 32nd, 512th and 1153rd positions are selected Pigs whose allelic type is GG/AA/TT or AG/GA/AT genotype; Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes; Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes; Or when breeding individuals with the trait of short gestation period, select pigs whose allelic types at the 32nd, 512th and 1153rd positions are AG/GA/AT genotypes. 5. The application according to claim 4, wherein the method of the application comprises: 1) detect the SNP molecular marker as described in claim 1 to piglet; 2) When breeding pigs with dominant sire index or number of teats at birth, the allelic types of the 32nd, 512nd and 1153rd loci detected in step 1) are GG/AA/TT or AG/GA/ AT genotype pigs; Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes; Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes; Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes; 3) Breeding the pigs selected in step 2) to obtain pigs with superior reproductive traits. 6. The application of the SNP molecular marker according to any one of claims 1-3 in cultivating breeding pig strains with dominant reproductive traits. 7. The application according to claim 6, wherein the method of the application comprises: 1) detect the molecular marker as described in claim 1 for the alternative breeding pigs to be reserved; 2) When breeding pigs with dominant sire index or number of teats at birth, the allelic types of the 32nd, 512nd and 1153rd loci detected in step 1) are GG/AA/TT or AG/GA/ AT genotype pigs; Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes; Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes; Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes; 3) The pigs selected in step 2) are used as breeding pigs for mating, and breeding is carried out to cultivate breeding pig strains with superior reproductive traits. 8. The application of the SNP molecular marker described in any one of claims 1-3 in the genetic improvement of pig reproductive traits. 9. The application according to claim 8, wherein the method of the application comprises: 1) detect the molecular marker as described in claim 1 for the alternative breeding pigs to be reserved; 2) When breeding pigs with dominant sire index or number of teats at birth, the allelic types of the 32nd, 512nd and 1153rd loci detected in step 1) should be GG/AA/TT or AG/GA/ AT genotype pigs; Or when breeding individuals with superior litter weight traits, select pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are GG/AA/TT genotypes; Or when breeding individuals with traits of less stillbirths, select pigs whose alleles at the 32nd, 512th and 1153rd positions are GG/AA/TT genotypes; Or when selecting and breeding individuals with short gestational traits, select and retain the pigs whose allele types at the 32nd, 512th and 1153rd sites detected in step 1) are AG/GA/AT genotypes; 3) The pig individuals selected in step 2) are used as breeding pigs for mating, and the offspring continue to select and retain the genotype pigs with corresponding dominant traits as described in claim 4, and eliminate other genotype pigs to increase the corresponding dominant alleles from generation to generation Type frequency, thereby improving and improving the reproductive traits of offspring pigs.

Images