CN115873909B

CN115873909B - Preparation method of arformoterol chiral intermediate

Info

Publication number: CN115873909B
Application number: CN202211554996.1A
Authority: CN
Inventors: 马向辉; 侯伟宏; 薛洪泽
Original assignee: Tianjin Famoxi Biomedical Technology Co ltd
Current assignee: Tianjin Famoxi Biomedical Technology Co ltd
Priority date: 2022-12-06
Filing date: 2022-12-06
Publication date: 2023-08-11
Anticipated expiration: 2042-12-06
Also published as: CN115873909A

Abstract

The invention provides a preparation method of an arformoterol chiral intermediate, wherein 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is catalyzed by one of alcohol dehydrogenase and an alcohol dehydrogenase mutant and nitroreductase to obtain the arformoterol chiral intermediate (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV); formylation of (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV) affords arformoterol key chiral intermediate (R) -N- [ 2-benzyloxy-5- (2-bromo-1-hydroxyethyl) phenylcarboxamide (formula V). The invention constructs chiral carbon center in a two-step enzymatic reaction mode, reduces nitro into amino, has safe process and simple operation, increases the utilization rate of raw materials, reduces the production of byproducts and isomers, reduces three wastes, reduces the synthesis cost and is suitable for the requirement of industrial mass production.

Description

Preparation method of arformoterol chiral intermediate

Technical Field

The invention belongs to the technical field of pharmaceutical chemistry, and particularly relates to a preparation method of an arformoterol chiral intermediate.

Background

Arformoterol (CAS: 67346-49-0), chemical name N- (2-hydroxy-5- ((1R) -1-hydroxy-2- (((1R) -2- (4-methoxyphenyl) -1-methylethyl) amino) ethyl) phenyl) carboxamide (formula a), is a single isomer of the drug formoterol, also known as (R, R) -formoterol. Arformoterol was developed by the company Sepracor, usa for the treatment of Chronic Obstructive Pulmonary Disease (COPD), emphysema and chronic bronchitis. Arformoterol is a long-acting beta 2 adrenergic receptor agonist, and by combining with beta 2 adrenergic receptor in the airway, the arformoterol excites the beta 2 receptor to relax the smooth muscle of the airway, thereby achieving the effect of dilating the airway and relieving symptoms such as wheezing.

Molecular structure of afatino of formula a

The chiral intermediate of the arformoterol is a compound V shown below, the chemical name of which is (R) -N- [ 2-benzyloxy-5- (2-bromo-1-hydroxyethyl) phenylformamide (CAS number: 201677-59-0), and the compound is an important intermediate for synthesizing the arformoterol. The key point in the preparation of the compound of formula (V) is the synthesis of chiral alcohol intermediates, and the current methods for synthesizing chiral alcohol intermediates mainly comprise the following two types:

the first method uses racemate as raw material, and the target product (bioorg. Med. Chem. Lett.2012,22, 1523-1526) with single configuration is obtained through resolution. The chromatographic resolution method is high in cost for obtaining a single-configuration product, large-scale production cannot be achieved, and half of ineffective enantiomer is produced, so that the chromatographic resolution method is only suitable for initial use in research and development, and is not suitable for industrial mass production. The racemate is used as a raw material, and a target product with a single configuration can be obtained by adopting a dynamic resolution method, and the cost is reduced, but the production process is more complicated, and the problem of ineffective enantiomer generation also exists.

The second method uses chiral catalysis to asymmetrically reduce alpha-bromoketone to obtain the target product (org.process Res.Dev.1998,2,96-99;Org Process Res.Dev.2000,4,567-570;CHIRALITY 2010,22,206-211; WO2007146867A2, CN201810653697.0). The method can be used for selectively reducing to obtain chiral products. Compared with the former two methods, the method avoids the generation of a large amount of ineffective enantiomer and reduces the production cost. However, the chiral purity of the chiral alcohol intermediate obtained by reduction by the method still cannot meet the production requirement of the medicine (only about 97%). In addition, metal catalysts and pressurized hydrogenation reduction are needed in the synthesis process, and the process has poor safety, high cost and poor environmental protection.

Disclosure of Invention

In view of the defects of the above-mentioned method for synthesizing the arformoterol chiral intermediate, the invention provides a preparation method of the arformoterol chiral intermediate, which adopts two-step enzymatic reactions to reduce nitro and carbonyl respectively, and then combines an organic synthesis method to realize the directional synthesis of the arformoterol chiral intermediate with single configuration.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the invention provides a preparation method of an arformoterol chiral intermediate (formula V), which has the following reaction formula:

the method comprises the following steps: 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is catalyzed by one of alcohol dehydrogenase and alcohol dehydrogenase mutant and nitroreductase to obtain arformoterol chiral intermediate (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV); formylation of (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV) to yield arformoterol key chiral intermediate (R) -N- [ 2-benzyloxy-5- (2-bromo-1-hydroxyethyl) phenylcarboxamide (formula V); the amino acid sequence of the alcohol dehydrogenase mutant is one of SEQ ID NO.39, 41 and 43.

3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is subjected to two-step enzymatic reduction reaction in the same water phase system containing one of alcohol dehydrogenase and alcohol dehydrogenase mutant and nitroreductase to obtain the arformoterol chiral intermediate (formula IV).

3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is reduced to (R) -1- (4 '-benzyloxy-3' -nitrophenyl) -2-bromoethanol (formula II) by alcohol dehydrogenase or alcohol dehydrogenase mutant, and then reduced to (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV) by nitro reductase, wherein alcohol dehydrogenase or alcohol dehydrogenase mutant is used to reduce the carbonyl of 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I), and nitro reductase is used to reduce the nitro of (R) -1- (4 '-benzyloxy-3' -nitrophenyl) -2-bromoethanol (formula II);

alternatively, 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is reduced to 3 '-amino-4' -benzyloxy-2-bromoacetophenone (formula III) by a nitroreductase, and then reduced to (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV) by an alcohol dehydrogenase or alcohol dehydrogenase mutant, in which process the nitro group of 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is reduced by a nitroreductase, and the carbonyl group of 3 '-amino-4' -benzyloxy-2-bromoacetophenone (formula III) is reduced by an alcohol dehydrogenase or alcohol dehydrogenase mutant.

Preferably, the reducing power required in the carbonyl and nitro reduction process is provided by one of the following two methods: 1) Formate dehydrogenase catalyzes the oxidation of ammonium formate; 2) Glucose dehydrogenase catalyzes the oxidation of glucose; more preferred of these two methods: glucose dehydrogenase catalyzes the oxidation of glucose.

The alcohol dehydrogenase gene provided by the invention is derived from wild genes or mutants of Arthrobacter sp.TS-15, candida parapsilosis, candida maris, empedobacter brevis, lactobacillus brevis, lactobacillus fermentum, novosphingobium aromaticivorans, serratia marcescens BCRC 10948 and Thermoanaerobium brockii. The nucleotide sequences of the wild genes subjected to codon optimization aiming at escherichia coli are shown as SEQ ID NO.2, 4, 6, 8, 10, 12, 14, 16 and 18, and the amino acid sequences of the alcohol dehydrogenase are shown as SEQ ID NO.1, 3, 5, 7, 9, 11, 13, 15 and 17. Wherein "wild type" refers to a form found in nature. For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence that is present in an organism, can be isolated from a natural source and is not artificially manipulated, intentionally modified. The inventors found that the mutant produced by mutating the amino acid at some positions of Seq ID No.11 to other amino acids can obtain a better reaction effect than the wild-type alcohol dehydrogenase, wherein the mutated amino acids are isoleucine at position 18, asparagine at position 88, isoleucine at position 91, and tyrosine at position 183. The amino acid sequence of the alcohol dehydrogenase mutant is one of SEQ ID NO.39, 41 and 43, the amino acid sequence SEQ ID NO.39 is obtained by mutation Y183 of SEQ ID NO.11, and the amino acid sequence SEQ ID NO.41 is obtained by mutation Y183, I91 and N88 of the amino acid sequence SEQ ID NO. 11; the amino acid sequence SEQ ID NO.43 is obtained by mutating the amino acid sequence SEQ ID NO.11 by Y183, N88, I18.

The nitroreductase genes provided by the invention are derived from wild-type genes or mutants of Pseudomonas putida, hydrogenovibrio thermophilus, escherichia coli, salmonella typhimurium, bacillus amyloliquefaciens, bacillus licheniformis, enterobacter cloacae, vibrio fischeri, sphaerobacter thermophilus and Tepidiphilus thermophilus. The nucleotide sequence of the wild nitroreductase gene is shown as SEQ ID NO.20, 22, 24, 26, 28, 30, 32, 34, 36 and 38, and the amino acid sequence of the nitroreductase gene is shown as SEQ ID NO.19, 21, 23, 25, 27, 29, 31, 33, 35 and 37.

The invention is constructed by connecting alcohol dehydrogenase gene, nitroreductase gene, and glucose dehydrogenase gene or formate dehydrogenase gene to various prokaryotic expression vectors or eukaryotic expression vectors, such as pGEX, pMAL, pET series and the like, and eukaryotic expression vectors, more preferably selected from pET series, by a conventional method in the art, singly or in combination. The reducing force required in the carbonyl and nitro reduction process adopted by the invention is provided by one of the following two methods: 1) Formate dehydrogenase catalyzes the oxidation of ammonium formate; 2) Glucose dehydrogenase catalyzes the oxidation of glucose. These two enzymes are available in the art from various published databases, journals, and patent materials.

The invention adopts the following strategies to construct the recombinant vector: 1) The plasmid vector used is pET-24a, and an alcohol dehydrogenase gene, a nitroreductase gene, a glucose dehydrogenase gene or a formate dehydrogenase gene is singly connected to a pET24a plasmid to form a recombinant vector; 2) The plasmid vector used was pET-24a, and an operon was constructed by connecting alcohol dehydrogenase gene, nitroreductase gene and formate dehydrogenase gene in series, and inserted into pET24a plasmid to form a recombinant vector.

The invention also provides engineering bacteria for producing the alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene, wherein the engineering bacteria comprise the alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene or the recombinant expression vector. Among them, the host cell of the genetically engineered bacterium is preferably Escherichia coli Escherichia coli BLR (DE 3).

Specifically, the invention also provides a method for preparing the alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene, which comprises the steps of fermenting and culturing the genetically engineered bacterium, and collecting and preparing recombinant enzyme.

The method comprises the step of industrially preparing the alcohol dehydrogenase mutant under certain fermentation conditions of a production tank; the fermentation conditions of the production tank are preferably as follows: DO is above 20% and air flow is 1:1-2 vvm.

The alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene can be applied to catalytic reduction of the compound of the formula I to prepare optical chiral alcohol.

The alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene are applied to catalytic reduction of the compound of the formula I, and when optical chiral alcohol is prepared, different enzymes are combined, and the yield and the optical purity of the prepared compound IV are shown in the table 1.

TABLE 1 yields and chiral purities of products prepared from alcohol dehydrogenase and nitroreductase compositions

The invention has the following beneficial effects:

1. according to the invention, nitro and carbonyl are reduced respectively by a two-step enzymatic reaction method, and a chiral compound is obtained by combining an organic synthesis method, so that the arformoterol chiral intermediate with a single configuration is directionally synthesized. For some alcohol dehydrogenases and corresponding reaction systems, the chiral purity of the product is >99.8%.

2. In the enzymatic reaction system, the alcohol dehydrogenase gene, the nitroreductase gene and the glucose dehydrogenase gene can act in the same reaction system, intermediate products (such as compounds shown in the formulas II and III) are not required to be extracted, and the process flow is simplified;

3. in the enzymatic reaction system, the reaction temperature is 30-37 ℃, the pH is 6.5-8.5, and the reaction pressure is normal pressure. Compared with the conditions of high temperature, high pressure, organic solvent, noble metal catalyst and the like required by organic synthesis, the method has the advantages of shorter steps, low cost, high product quality, no need of heavy metal catalyst, less generation of three wastes and the like.

4. Compared with the existing method, the method has the advantages of safe process, simpler operation, increased raw material utilization rate, reduced production of byproducts and isomers, reduced three wastes, reduced synthesis cost and suitability for industrial mass production.

Detailed Description

The present invention will be described in detail with reference to examples for better understanding of the technical scheme of the present invention by those skilled in the art.

Example 1: establishment of wild alcohol dehydrogenase and mutant genetically engineered bacteria

The sequence of the wild-type gene sequences Arthrobacter sp.TS-15 (Uniprot code: A0A545BBR 2), candida parapsilosis (Uniprot code: A1X 808), candida maris (Uniprot code: F5HSY 1), empedobacter brevis (Uniprot code: A0A0X9Q4M 6), lactobacillus brevis (Uniprot code: Q84EX 5), lactobacillus fermentum (Uniprot code: A0A806IGI 2), novosphingobium aromaticivorans (Uniprot code: A4XEP 2), serratia marcescens BCRC 10948 (Uniprot code: V5YUZ 7), thermoanaerobium brockii (Uniprot code: P14941) and the enzyme mutant sequences described in Table 1 were sequence-optimized, and the whole gene fragments (nucleotide sequences shown in SEQ ID Nos. 2, 4, 6, 8, 10, 12, 14, 16, 18) were artificially synthesized, and the gene was inserted into pET-24a by means of NdeI and BamHI restriction endonucleases, and the ligated gene vectors were transformed into E.coli (DE 3) wild-type gene vectors were created.

Example 2: establishment of wild nitroreductase enzyme genetic engineering bacteria

The sequence was optimized according to NCBI-recorded carbonyl reductase wild-type gene sequences Pseudomonas putida (Uniprot code: I7BE 08), hydrogenovibrio thermophilus (Uniprot code: A0A451G 461), escherichia coli (Uniprot code: P38489), salmonella typhimurium (Uniprot code: P15888), bacillus amyloliquefaciens (Uniprot code: I2C2N 9), bacillus licheniformis (Uniprot code: Q65MA 7), enterobacter cloacae (Uniprot code: Q01234), vibrio ficschei (Uniprot code: P46072), sphaerobacter thermophilus (Uniprot code: D1C 882), tepidiphilus thermophilus (Uniprot code: A0A0K6IWV 2), and the whole gene fragments (nucleotide sequences shown as SEQ ID NO.20, 22, 24, 26, 28, 30, 32, 34, 36, 38) were artificially synthesized, and the genes were inserted into pET-24a plasmids by NdeI and the ligated vector was transformed into E.coli R (BLR 3) gene engineering strain, DE type carbonyl reductase.

Example 3: establishment of co-expression carbonyl reductase, nitroreductase and glucose dehydrogenase genetically engineered bacteria

Sequentially concatenating glucose dehydrogenase, alcohol dehydrogenase gene and nitroreductase gene, wherein the intermediate sequence of glucose dehydrogenase and carbonyl reductase gene is:

"TAAGCAATCAATGTCGGATGCGGCGCGAGCGCCTTATCCGACCAACATATCATA AAGGAGGTATCGCA"; the intermediate sequence of the carbonyl reductase gene and the nitroreductase gene is TAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT, the gene is inserted into pET-24a plasmid through NdeI and BamHI endonucleases after the whole gene fragment is artificially synthesized, and the connected vector is transferred into escherichia coli BLR (DE 3) to establish wild-type carbonyl reductase gene engineering bacteria.

Example 4: acquisition of alcohol dehydrogenase mutants

The amino acid sequence of the mutant of alcohol dehydrogenase shown in Table 1 is the amino acid sequence of the wild-type alcohol dehydrogenase shown in SEQ ID NO.11, has a mutation site in the mutated amino acid sequence, and has more than 90% of homology with the mutated amino acid sequence.

Specifically, the alcohol dehydrogenase mutant gene library is established by the following method:

the three-dimensional structure of the enzyme is obtained by a linear protein structure prediction tool, and the alcohol dehydrogenase (PDB ID:7p7 y) with the highest similarity to the three-dimensional structure is searched in a PDB database for comparison. The binding pattern is then simulated by means of molecular docking software on the basis of the three-dimensional structure of the compounds of the formula I with the alcohol dehydrogenase and amino acids possibly associated with substrate binding, NAD proton transfer are selected as mutation sites by means of a Pymol analysis.

On the other hand, alcohol dehydrogenases were protein engineered by error-prone PCR random mutagenesis. Error-prone PCR (polymerase chain reaction) is used for amplifying a target gene by using DNA polymerase, and the mutation frequency in the amplification process is changed by adjusting reaction conditions (comprising increasing magnesium ion concentration, adding manganese ion, changing dNTP concentration of four kinds in a system or applying low-fidelity DNA polymerase, and the like), so that mutation is randomly introduced into the target gene at a certain frequency, and a random mutant of protein molecules is obtained.

This example uses Taq polymerase with lower fidelity while using Mn ²⁺ Substitution of the natural cofactor Mg ²⁺ Increasing the probability of error.

The 50. Mu.L PCR system was as follows:

in the case of the mutation of the alcohol dehydrogenase group, primers on the pET24a plasmid were used, which were located upstream and downstream of the alcohol dehydrogenase gene, respectively.

The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 30s, annealing at 50-65℃for 40s and extension at 72℃for 40s for 35 cycles; the extension was continued at 72℃for 10min and cooled to 4 ℃.

Amplifying the alcohol dehydrogenase gene by PCR according to the method and inserting the gene into the pET24a plasmid to serve as a gene mutation template; error-prone PCR (polymerase chain reaction) amplification of the alcohol dehydrogenase gene, linking the amplified gene fragment to a pET24a vector, and transferring the linked vector into E.coli BLR (DE 3) to establish an alcohol dehydrogenase gene mutation library.

The highly active mutant was selected as described in example 7 using E.coli BLR (DE 3) as host and pET24a plasmid as vector to express the extended mutant alcohol dehydrogenase. The mutated high-activity alcohol dehydrogenase is subjected to gene identification, the nucleotide sequences of the mutated high-activity alcohol dehydrogenase are shown as SEQ ID NO.40, 42 and 44, and the amino acid sequences of proteins coded by the mutated high-activity alcohol dehydrogenase are shown as SEQ ID NO.39, 41 and 43.

Example 5: small-scale production of alcohol dehydrogenase and nitroreductase in shake flasks

A single microbial colony of E.coli containing a plasmid of the target alcohol dehydrogenase (or mutant thereof) gene, nitroreductase, and glucose dehydrogenase gene was inoculated into 100mL of LB medium containing kanamycin sulfate (100. Mu.g/mL) (peptone 10g/L, yeast extract 5g/L, naCl 10g/L, pH 7.2). Coli was shake-cultured in a shaker at 37℃and 250rpm for 16 hours. Then, according to 1:100 proportion, 1mL of the bacterial culture solution is added into 100mL of LB culture medium containing kanamycin sulfate, and the bacterial culture solution is subjected to shaking culture under the same conditions, and the absorbance (OD) of the bacterial culture solution at 600nm is measured at regular time ₆₀₀ ) To monitor the cell growth density. When the OD of the culture ₆₀₀ When the value increased to 0.6 to 0.8, alcohol dehydrogenase gene expression was induced by adding isopropyl β -D-thiogalactoside (IPTG) at a final concentration of 1mM, followed by incubation at 18℃for overnight (10-16 hours). The cells were collected by centrifugation (10000 rpm, 10min, 4 ℃) and the supernatant was discarded, and the cell pellet was resuspended in 100mM Tris-HCl buffer pH7.5 at 4℃and centrifuged (13000 r after ultrasonicationpm, 30min, 4 ℃) to remove cell debris, collecting supernatant to prepare crude enzyme solution, and storing at-20 ℃.

Example 6: fermentation production of alcohol dehydrogenase and nitroreductase

The fermentation method comprises the following steps: coli containing recombinant plasmids of the target alcohol dehydrogenase (or mutant thereof), nitroreductase and glucose dehydrogenase genes was inoculated with a single colony of microorganisms in 120mL LB medium (peptone 10g/L, yeast extract 5g/L, naCl 10g/L, pH 7.2) containing kanamycin sulfate (100 mg/mL), and shake-cultured overnight (10-16 hours) in a shaker at 37℃and 250 rpm. Inoculating the seed solution into a 15L fermentation tank containing 6L fermentation medium according to an inoculum size of 2%, maintaining pH7.0-7.2 of the fermentation liquid by adding ammonia water, controlling dissolved oxygen at about 20% during fermentation at 37 ℃ and stirring speed of 300-900rpm, controlling air flow at 1:1-2 vvm, culturing for 8 hours, adding IPTG with final concentration of 1mmol/L for induction expression, continuing fermentation for 12-16 hours, and keeping the tank temperature at 18 ℃. During fermentation, the growth of the culture was maintained by adding a feed solution (containing 200g/L glucose, 100g/L yeast extract, pH 7.2). After fermentation, the culture is directly homogenized and crushed by a high-pressure homogenizer, and is subjected to centrifugation, filtration and ultrafiltration concentration to prepare crude enzyme liquid, and the crude enzyme liquid is stored at the temperature of minus 20 ℃.

Example 7: bioconversion process for producing compounds of formula IV

The bioconversion system consists of:

the compound of formula I was premixed with 30mM and 50mL of DMSO to prepare a substrate solution, the reaction solution (0.1M Tris-HCl buffer, 200mM glucose, 3mM NADP,3mM NAD,2mM EDTA,3mM DTT, 50mL of DMSO, pH 8.0) was added to a volume of 600mL, and then 400mL of crude enzyme solution was added to start the reaction. The mixture was stirred in a water bath at 30℃under nitrogen. During the reaction, formic acid was used to adjust the pH to 8.0. After the reaction was carried out for 24 hours, the yield was checked by HPLC.

The pH was adjusted to 2.0 with concentrated hydrochloric acid to terminate the enzymatic reaction, the supernatant was collected by filtration, 10g of sodium sulfite was added, the pH was slowly adjusted to 8.5 with sodium hydroxide solution under nitrogen protection, and the toluene and tetrahydrofuran mixture was extracted 2 times. The organic phase is dehydrated by anhydrous magnesium sulfate and then concentrated to dryness to obtain oily substance, namely the compound IV.

Example 8: synthesis of Compound V

The obtained compound IV is added into 100mL of tetrahydrofuran and 100mL of toluene for stirring and dissolution, then cooled to 5-10 ℃ and stirred for 10min. And (3) dropwise adding a mixed solution of 8g of formic acid and 10g of acetic anhydride, and reacting for 20min at the temperature of 5-10 ℃ after the dropwise adding is completed for 30 min. The reaction solution is decompressed, distilled, concentrated and dried, 300mL of toluene is added for pulping for 4 to 6 hours, and the compound shown in the formula V is obtained.

In addition, the specific examples described in the present specification may vary in host bacteria, vectors, gene names, and the like. All equivalent or simple changes of the route, the characteristics and the principle according to the conception of the present invention are included in the protection scope of the present invention. Those skilled in the art may make various modifications or additions to the described embodiments or substitutions in a similar manner without departing from the scope of the invention as defined in the accompanying claims.

The embodiments of the present invention have been described in detail by way of examples, but the descriptions are merely exemplary of the embodiments of the present invention and are not to be construed as limiting the scope of the embodiments of the present invention. The protection scope of the embodiments of the invention is defined by the claims. In the technical scheme of the embodiment of the invention, or under the inspired by those skilled in the art, similar technical schemes are designed within the spirit and the protection scope of the embodiment of the invention, or equivalent changes and improvements made to the application scope are still included in the patent coverage protection scope of the embodiment of the invention.

Claims

1. A process for the preparation of an arformoterol chiral intermediate, comprising the steps of: 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is catalyzed by one of alcohol dehydrogenase and alcohol dehydrogenase mutant and nitroreductase to obtain arformoterol chiral intermediate (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV); formylation of (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV) to yield arformoterol key chiral intermediate (R) -N- [ 2-benzyloxy-5- (2-bromo-1-hydroxyethyl) phenylcarboxamide (formula V); the amino acid sequence of the alcohol dehydrogenase mutant is one of SEQ ID NO.39, 41 and 43; the amino acid sequence of the alcohol dehydrogenase is one of SEQ ID NO.1, 3, 5, 7, 9, 11, 15 and 17.

2. The process for the preparation of an arformoterol chiral intermediate according to claim 1, characterized in that 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is reduced to (R) -1- (4 '-benzyloxy-3' -nitrophenyl) -2-bromoethanol (formula II) by an alcohol dehydrogenase or an alcohol dehydrogenase mutant, and then to (R) -1- [3 '-amino-4' - (benzyloxy) phenyl ] -2-bromoethanol (formula IV), in which process the carbonyl group of 3 '-nitro-4' -benzyloxy-2-bromoacetophenone (formula I) is reduced by an alcohol dehydrogenase or an alcohol dehydrogenase mutant, and the nitro group of (R) -1- (4 '-benzyloxy-3' -nitrophenyl) -2-bromoethanol (formula II) is reduced by a nitro reductase;

3. The method for preparing the arformoterol chiral intermediate according to claim 2, characterized in that the reducing power required in the carbonyl and nitro reduction process is provided by one of the following two methods: 1) Formate dehydrogenase catalyzes the oxidation of ammonium formate; 2) Glucose dehydrogenase catalyzes the oxidation of glucose.

4. The method for preparing the arformoterol chiral intermediate according to claim 1, wherein the nucleotide sequence of the alcohol dehydrogenase gene is one of the nucleotide sequences shown in SEQ ID nos. 2, 4, 6, 8, 10, 12, 16 and 18.

5. The method for preparing the arformoterol chiral intermediate according to claim 1, wherein the amino acid sequence of said nitroreductase is one of the amino acid sequences shown in SEQ ID nos. 19, 21, 23, 25, 27, 29, 31, 33, 35, 37.

6. The method for preparing the arformoterol chiral intermediate according to claim 5, wherein the nucleotide sequence of the nitroreductase gene is one of the nucleotide sequences shown in SEQ ID NO.20, 22, 24, 26, 28, 30, 32, 34, 36 and 38.