CN115873858A

CN115873858A - Rice promoter regulated by amino acid and hormone, expression vector containing rice promoter and application of rice promoter

Info

Publication number: CN115873858A
Application number: CN202211215130.8A
Authority: CN
Inventors: 方中明; 潘灵辉; 李泓雨
Original assignee: Jianhe Xinxin Agricultural Science And Technology Development Co ltd; Guizhou University
Current assignee: Jianhe Xinxin Agricultural Science And Technology Development Co ltd; Guizhou University
Priority date: 2022-09-30
Filing date: 2022-09-30
Publication date: 2023-03-31

Abstract

The invention belongs to the technical field of plant genetic engineering, relates to the technical field of crop breeding, and particularly relates to an amino acid and hormone regulated rice promoter, an expression vector containing the promoter and application of the promoter. When the regulation and control mode of the OsAAP14 gene is researched, the promoter of the gene shown as SEQ ID NO.1 is obtained by cloning. The promoter is a conditional promoter gene expression control element. The promoter is applied to transgenic engineering, and can be connected with a specific effect gene to construct an expression vector and further construct a transgenic rice plant. The technical scheme overcomes the technical problem that the prior transgenic breeding mode lacks a regulatory element for the expression of the controllable target gene. After the transgenic plant is acted by exogenous hormone and amino acid, the promoter starts a large amount of expression of the effect gene, can be used in practical operation of breeding rice and other crops, and has obvious application value and wide application prospect.

Description

Rice promoter regulated by amino acid and hormone, expression vector containing rice promoter and application of rice promoter

Technical Field

The invention belongs to the technical field of plant genetic engineering, relates to the technical field of crop breeding, and particularly relates to an amino acid and hormone regulated rice promoter, an expression vector containing the promoter and application of the promoter.

Background

The transgenic plant refers to a plant in which a desired gene or a specific DNA fragment isolated from an animal, a plant or a microorganism, together with appropriate regulatory elements, is transferred into the genome of the plant by various methods using genetic engineering (DNA recombination technology) so that the gene or DNA sequence can be stably expressed and inherited. Transgenic breeding (GMB) refers to a breeding method in which one or more genes are added to the genome of an organism by modern molecular biology techniques, thereby producing an organism with improved characteristics.

In recent years, plant transgenic engineering is rapidly developed, and various exogenous genes are transferred into receptor plants through vectors and are used for improving plant characters, cultivating high-quality and high-yield crops or serving as bioreactors and the like. The construction of high-efficiency expression vector is an important link in transgenic engineering. Plants, as eukaryotes, can regulate genes at multiple levels, including DNA level, transcriptional level, post-transcriptional modification, translational level, post-translational modification, and the like, but gene regulation at the transcriptional level is a major link. The plant gene promoter is a key regulatory element on a high-efficiency expression vector, and plays an important role in determining the transcription efficiency, positioning introduction and expression enhancement of exogenous genes. In practical operation of transgenic breeding, the expression amount of the transferred target gene is low, or the expression time window of the transferred target gene cannot be effectively controlled, so that the effect of transferring the target gene is limited, and the quality of a transgenic plant is influenced. Inducible promoters are an important form of plant gene promoters. Inducible promoters generally do not initiate gene transcription or have very low transcriptional activity, and transcriptional activity can be significantly increased only when external conditions, including light, temperature, water, soil salinity, hormones, insect pests encountered, and the like, are changed. When constructing transgenic carrier, the constitutive promoter induces to express exogenous protein continuously to affect the normal growth of plant, and the inducible promoter is selected for transcription control to make exogenous gene only express under special inducing condition. At present, few inducible promoters for rice breeding influence the research process of rice genetic breeding, and a novel promoter for rice transgenic breeding needs to be researched and developed to improve the quality of transgenic breeding rice.

Disclosure of Invention

The invention aims to provide a rice promoter regulated by amino acid and hormone to solve the technical problem that the conventional transgenic breeding mode is lack of a controllable regulating element for target gene expression.

In order to achieve the purpose, the invention adopts the following technical scheme:

an amino acid and/or hormone regulated rice promoter, the nucleotide sequence of which is shown in SEQ ID NO. 1; or the nucleotide sequence is obtained by substituting, adding and/or deleting one or more nucleotides of the sequence shown in SEQ ID NO.1 and has the same function.

The principle and the advantages of the scheme are as follows:

the inventor of the technical scheme is engaged in the research of rice genetic breeding for a long time, and the research comprises the research on transporter genes related to nitrogen absorption in rice development, including ammonium transport protein (AMT), nitrate transport protein (NRT), amino acid transport protein (AAT), peptide transport Protein (PTR) and the like. When the inventor researches the expression regulation mode of the OsAAP14 gene, a section of promoter of the OsAAP14 gene shown as SEQ ID NO.1 is obtained by cloning. The promoter is connected with an effect gene GUS (beta-glucuronidase gene, beta-glucuronidase), and then transgenic rice is constructed to study the regulation and control mode of the promoter. The beta-glucuronidase can catalyze substrate reaction to develop color and is used for indicating whether the promoter can be effectively used as a switch for gene expression. Research results show that the rice promoter with the sequence shown as SEQ ID NO.1 can respond to stimulation of exogenous hormone and amino acid, and further start expression of effector genes. Thus, the promoter is a conditionally-promoted gene expression control element. The promoter is applied to transgenic engineering, and can be connected with a specific effect gene to construct an expression vector and further construct a transgenic rice plant. After the rice plant is acted by exogenous hormone and amino acid, the promoter can start the massive expression of the effect gene in the rice plant, so that the expression product of the downstream target gene under the promoter is specifically accumulated in the rice, the integral or local expression quantity of the effect gene is increased, and the rice development is promoted. Therefore, the promoter (SEQ ID NO. 1) of the OsAAP14 gene has good application prospect in transgenic engineering.

Further, the amino acid is histidine; the hormone is gibberellin or abscisic acid.

Research results show that the rice promoter with the sequence shown in SEQ ID NO.1 can respond to the stimulation of exogenous hormones and amino acids, and further starts the expression of effector genes. In particular, the promoter may respond to two phytohormones, gibberellin and abscisic acid, and may also respond to a basic amino acid, histidine. Through screening of a large number of amino acids, the promoter is only controlled by histidine which is one amino acid, and has no significant response phenomenon to other basic amino acids, acidic amino acids and neutral amino acids (see the dyeing experiment results shown in figures 7-9). Moreover, the regulation effect of histidine on the promoter shows a certain time-effect relationship along with the increase of action time, and the effect of promoting the expression of an effect gene of the promoter is more obvious as the action time of histidine is longer.

Although the inventors conducted previous studies on the expression control mode of the OsAAP14 gene, no response of the rice promoter to histidine and phytohormones as shown in SEQ ID NO.1 was found. The promoter sequence reported by the invention creates a breeding mode for rice genetic breeding, and has profound significance. More importantly, no histidine-regulated promoter sequence has been reported at present. Histidine is not a plant hormone, is used for inducing the expression of an effector gene, is safer to plants and cannot cause other effects caused by excessive hormone induction. Gibberellin and abscisic acid are applied to plants, except that effect genes on a carrier can be regulated and controlled, the genes of the plants which can respond to the gibberellin and the abscisic acid can also be regulated and controlled, and the genes which can respond to the two phytohormones are more, so that too many uncontrollable factors can be introduced to rice development. The histidine-regulated start-stop promoter sequence has obvious application value and wide application prospect in practical operation of breeding rice and other crops.

Furthermore, the downstream of the rice promoter is connected with an effector gene.

By adopting the technical scheme, the promoter of the OsAAP14 gene is connected with the effector gene, and no other gene is inserted between the promoter and the effector gene. The meaning of a promoter is that it acts like a switch to control the expression or the degree of expression of the gene to which it is linked. And then the opening and closing of a promoter switch are controlled by exogenous application of histidine and phytohormone, so that the expression of an effect gene is controlled.

Further, the rice promoter is used to enhance the expression of effector genes in rice roots after treating rice plants with histidine or gibberellin or abscisic acid.

The inventor finds that the transgenic rice can promote the expression of target genes in roots after providing amino acids and hormones from the outside. The invention discovers that the activity of the promoter of the rice OsAAP14 gene is induced by amino acid and hormone; the promoter is used in transgenic rice, so that the downstream gene of the promoter can be specifically expressed in the root of the rice, and the promoter has good application prospect in transgenic engineering, thereby providing a new idea for researching how to regulate and control nitrogen absorption and utilization.

Further, the effector gene is one of a 0sAAP14 gene, a GUS gene, an OsNRT2.4 gene and an OsAMT1.2 gene.

The GUS gene mentioned in the examples of this protocol only serves as an indicator to show whether the promoter is working or not in a relatively intuitive manner; the blue color of the GUS staining result indicates that the promoter gene is normally expressed, the blue color does not indicate that the gene controlled by the promoter is not normally expressed, and the deeper the blue color indicates that the expression amount of the gene controlled by the promoter is larger. According to the technical scheme, the GUS staining is adopted to reveal the regulation and control mode of the promoter. The GUS gene can be replaced with other indicator genes known in the art.

In addition, the promoter may be used to link any other downstream gene of interest. For example, 0sAAP14 gene, although in wild type rice, the promoter of this embodiment is an expression regulatory element of 0sAAP14 gene. However, if we want to enhance the expression of the 0sAAP14 gene in the plant, we can use the promoter of this scheme to directly connect with the 0sAAP14 gene to construct an expression vector, and then construct a transgenic plant conditionally over-expressing the 0sAAP14 gene. The inventors have demonstrated in a previously published paper that overexpression of the 0sAAP14 gene promotes tillering bud growth in rice (Yang G, wei X, fang Z. Melanonin media extraction and bud growth by improvement simulation NITROGEN and transport in Rice. Frontiers in Plant Science,2022, 2370.). For example, a gene OsNRT2.4 having a nitrate transport function and a gene OsAMT1.2 having an ammonium transport function.

The technical scheme also provides an application of the rice promoter regulated and controlled by amino acid and/or hormone in rice breeding, and when the effect gene is 0sAAP14 gene, wild-type rice plants are treated by histidine, gibberellin or abscisic acid.

As the promoter shown in the SEQ ID NO.1 is found to be regulated and controlled by histidine, gibberellin or abscisic acid, in wild rice, the promoter shown in the SEQ ID NO.1 can play a role in regulating and controlling the expression of the 0sAAP14 gene, and the up-regulation of the expression of the 0sAAP14 gene is beneficial to the development of rice. Therefore, when wild-type rice is bred, a certain amount of histidine, gibberellin or abscisic acid can be applied to the rice to promote the expression of the 0sAAP14 gene (figures 10-13), and further promote the growth of tillering buds of rice plants.

The technical scheme also provides an application of the rice promoter regulated and controlled by amino acid and/or hormone in rice breeding, which comprises the following steps in sequence:

s1: constructing an expression vector for expressing an effect gene, wherein the promoter of the effect gene is a rice promoter with a sequence shown as SEQ ID No. 1;

s2: transferring the expression vector obtained in the step S1 into a wild rice plant to obtain transgenic rice;

s3: treating the transgenic rice with histidine or gibberellin or abscisic acid.

The invention takes a promoter of an AAP gene family member OsAAP14 gene of rice as an object, firstly, a constructed promoter-GUS expression vector is transferred into callus induced by mature embryos of the rice through agrobacterium mediation to obtain a transgenic plant, then a positive plant is identified, a T1 generation transgenic plant is obtained, and further T2 generation mature seeds are obtained. And then, carrying out GUS histochemical staining on different tissues of roots, stems, leaves, ears and the like of the plants of the T2 generation at different growth periods of the seeds, determining GUS expression activity, treating the transgenic plants by using different nitrogen, detecting the GUS expression activity, and analyzing the space-time expression specificity of the transgenic plants. The result shows that the activity of the promoter can be strongly induced by basic amino acid of external amino acid, particularly histidine, and can also be strongly induced by gibberellin and abscisic acid, so as to promote the specific expression of downstream target genes in the roots of rice. The promoter is applied to transgenic engineering, can increase nitrogen absorption and transportation after spraying of soil rich in amino acid or plant hormone, promotes vegetative growth, and can also enable expression products of downstream target genes under the promoter to be specifically accumulated on roots and overground parts, so that local expression quantity is increased. Therefore, the promoter of the OsAAP14 gene has good application prospect in transgenic engineering.

Further, in S3, the working concentrations of histidine, gibberellin, and abscisic acid were 0.2mmol/L, 2. Mu. Mol/L, and 2. Mu. Mol/L, respectively.

The conditions of amino acid or hormone treatment can effectively promote the activity of the rice promoter in the scheme, thereby promoting the expression of downstream effect genes.

Further, extracting rice genome DNA in S1, and then carrying out PCR amplification on the rice genome DNA by using an upstream primer with a sequence shown as SEQ ID No.2 and a downstream primer with a sequence shown as SEQ ID No.3 to obtain a rice promoter with a sequence shown as SEQ ID No. 1; integrating a rice promoter with a sequence shown as SEQ ID NO.1 to a polyclonal locus of an empty vector to obtain an expression vector; the empty vector is integrated with an effective response gene, and the rice promoter is used for promoting the expression of the effect gene.

Effective amplification of a target promoter fragment can be realized through primers SEQ ID NO.2 and SEQ ID NO.3, and only the promoter fragment needs to be integrated into a multiple cloning site of an empty vector for plant transgenosis. Wherein, pCAMBIA1391Z empty vector is a commercial vector commonly used in the prior art for researching promoter activity, and the control of a promoter on an effector gene can be realized only by integrating a promoter fragment into a multiple cloning site of the pCAMBIA1391Z empty vector. Wherein, the multiple cloning site refers to an artificially synthesized DNA fragment contained in the vector, which contains a plurality of single enzyme cutting sites and is an insertion part of the exogenous DNA.

The technical scheme also provides an expression vector containing the rice promoter regulated by amino acid and/or hormone, which comprises an empty vector and a promoter fragment integrated on the multiple cloning site of the empty vector, wherein the sequence of the promoter fragment is shown as SEQ ID NO.1, and the promoter fragment is used for promoting the expression of an effector gene. The promoter fragment is integrated into the multiple cloning site of the empty vector, and the expression vector of the expression effect gene regulated by the SEQ ID NO.1 promoter can be obtained.

In conclusion, the technical scheme provides the promoter of the rice gene which is regulated and expressed by amino acid and hormone and the application method thereof aiming at the defects of the prior art. The promoter sequence of the OsAAP14 gene can respond to external amino acid basic amino acid and hormone, and the high expression of the promoter gene in roots is started; further, the activity of the promoter SEQ ID NO.1 of the OsAAP14 gene is improved by the induction of histidine in basic amino acid, gibberellin in hormone and abscisic acid. The invention can increase the local expression of other target genes at the root in the application of gene engineering, and strengthen the absorption of substances from the external environment or the accumulation of substances at the root.

Drawings

FIG. 1 is an agarose electrophoresis picture of PCR products of the promoter fragment of example 1 (M: DL2000 Plus DNA Marker; osAAP14 gene promoter fragment 1-3.

FIG. 2 is a schematic diagram of primer binding sites of the promoter fragment of example 1.

FIG. 3 is a map of a pCAMBIA1391Z vector of the prior art.

FIG. 4 shows the PCR and restriction enzyme digestion results of the bacterial suspension of example 1 (A: PCR electrophoresis of bacterial suspension: M: DL2000 Plus DNA Marker;1: negative control by water amplification; 2: positive control by OsAAP14 promoter fragment amplification; 3-12: osAAP14-pCAMBIA1391Z ligation product, transformation of DH 5. Alpha. Strain for bacterial suspension PCR; B: restriction enzyme digestion results: M: DL2000 Plus DNA Marker; 1-2. Positive cloning double restriction enzyme digestion).

FIG. 5 shows the results of identification of the positive plants (OsAAP 14 promoter-GUS transgenic plants) of example 1 (M: DL2000 Plus DNA Marker;1: negative control amplified with water; 2: positive control amplified with OsAAP14-pCAMBIA1391Z recombinant plasmid; 3-18: positive transgenic plants).

FIG. 6 shows the results of the OsAAP14 promoter-GUS transgenic plant staining experiment in example 2 and the results of the real-time fluorescent quantitative PCR experiment on the OsAAP14 gene of wild type Zhonghua 1 in example 4 (A, B, C, D, E, F: osAAP14 promoter-GUS transgenic plant root, leaf sheath, stem, leaf, ear staining; G, H, I, J, K: section of root, leaf sheath, stem, leaf, ear staining site; L: osAAP14 gene expression amount of Zhonghua 11 root, leaf sheath, stem, leaf, ear, expressed as stem expression amount of 1, data expressed as mean. + -. SD, n = 4).

FIG. 7 shows the effect of treatment with exogenous acidic and basic amino acids on the expression of promoter effector gene of OsAAP14 gene promoter in example 3 (A: 0.5mmol/L acidic amino acid (aspartic acid 0.2mmol/L, glutamic acid 0.3 mmol/L) treatment for 0h, 1h, and 2h OsAAP14 promoter-GUS transgenic plant roots and B:0.5mmol/L basic amino acid (arginine 0.2mmol/L, lysine 0.1mmol/L, histidine 0.2 mmol/L) treatment for 0h, 1h, and 2h OsAAP14 promoter-GUS transgenic plant roots).

FIG. 8 shows the effect of exogenous neutral amino acid treatment on the promoter effector gene expression of OsAAP14 gene promoter in example 3 (A: 1mmol/L of neutral amino acid 1 (serine 0.1mmol/L, threonine 0.2mmol/L, glycine 0.2mmol/L, alanine 0.3mmol/L, proline 0.2 mmol/L) on the root of OsAAP14 promoter-transgenic plant at 0h, 1h, 2 h; B:1mmol/L of neutral amino acid 2 (valine 0.2mmol/L, cysteine 0.1mmol/L, asparagine 0.3mmol/L, glutamine 0.3mmol/L, tyrosine 0.1 mmol/L) on the root of OsAAP14 promoter-transgenic plant at 0h, 1h, 2 h; C:1mmol/L of neutral amino acid 3 (methionine 0.1mmol/L, tryptophan 0.1mmol/L, leucine 0.2mmol/L, phenylalanine 0.3mmol/L, isoleucine 0.1 mmol/L) on the root of OsAAP14 gene promoter-transgenic plant at 0 h).

Fig. 9 is the effect of exogenous histidine, arginine and lysine treatment on the effect of promoting effector gene expression of the OsAAP14 gene promoter of example 3 a:0.2mmol/L histidine treatment is carried out on the root of the OsAAP14 promoter-GUS transgenic plant of 0h, 1h and 2 h; b:0.2mmol/L arginine treatment for 0h, 1h and 2h of the dyeing result of the root of the OsAAP14 promoter-GUS transgenic plant; c:0.2mmol/L lysine treatment of OsAAP14 promoter-GUS transgenic plant root at 0h, 1h, 2 h).

FIG. 10 shows the effect of exogenous hormone treatment on OsAAP14 gene expression in example 3 (A: real-time fluorescent quantitative PCR detection results of roots of Zhonghua 11 at 0h, 1h, and 2h in gibberellin treatment at 2. Mu. Mol/L; B: real-time fluorescent quantitative PCR detection results of roots of Zhonghua 11 at 0h, 1h, and 2h in abscisic acid treatment at 2. Mu. Mol/L; the expression level at 0h is defined as 1, and the data are expressed as mean. + -. SD, n = 4).

FIG. 11 shows the effect of treatment with exogenous acidic and basic amino acids on OsAAP14 gene expression in example 4 (C: 0.5mmol/L acidic amino acid (0.2 mmol/L aspartic acid, 0.3mmol/L glutamic acid) on the roots of Zhonghua 11 at 0h, 1h, and 2h in real-time quantitative fluorescence PCR assay; D:0.5mmol/L basic amino acid (0.2 mmol/L arginine, 0.1mmol/L lysine, and 0.2mmol/L histidine) on the roots of Zhonghua 11 at 0h, 1h, and 2h in real-time quantitative fluorescence PCR assay; the expression level at 0h is defined as 1, and the data are mean. + -. SD, n = 4).

FIG. 12 shows the effect of exogenous neutral amino acid treatment on OsAAP14 gene expression in example 4 (D: the real-time quantitative PCR detection result of neutral amino acid 1 (serine 0.1mmol/L, threonine 0.2mmol/L, glycine 0.2mmol/L, alanine 0.3mmol/L, proline 0.2 mmol/L) at the root of Zhonghua 11 at 0h, 1h, and 2h treated; E: the real-time quantitative PCR detection result of neutral amino acid 2 (valine 0.2mmol/L, cysteine 0.1mmol/L, asparagine 0.3mmol/L, glutamine 0.3mmol/L, and tyrosine 0.1 mmol/L) at the root of Zhonghua 11 at 0h, 1h, and 2h treated; F:1mmol/L neutral amino acid 3 (methionine 0.1mmol/L, tryptophan 0.1mmol/L, leucine 0.2mmol/L, isoleucine 0.3mmol/L, phenylalanine 0.3mmol/L, SD/L, and treated flower 0.1 mmol/L), SD, and the real-time quantitative PCR detection result of neutral amino acid 3 (methionine 0.1mmol/L, tryptophan 0.1 h, phenylalanine 0.1mmol/L, SD, and treated flower 11 h) at the root of the real-time quantitative PCR detection result of root of SD, and expression result of 1h expressed as. + -. 4h, expressed data.

FIG. 13 shows the effect of exogenous histidine, arginine and lysine treatment on OsAAP14 gene expression in example 4 (D: real-time quantitative PCR detection of roots of middle flowers 11 at 0h, 1h and 2h in histidine treatment 0.2 mmol/L; E: real-time quantitative PCR detection of roots of middle flowers 11 at 0h, 1h and 2h in arginine treatment 0.2 mmol/L; F: real-time quantitative PCR detection of roots of middle flowers 11 at 0h, 1h and 2h in lysine treatment 0.2 mmol/L; and the expression level at 0h is defined as 1, and the data are represented as mean. + -. SD, n = 4).

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto. The described embodiments are only some embodiments of the invention, not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the following embodiments, the gene recombination technique can be performed by reference to "molecular cloning laboratory Manual, 2 nd edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.", and the materials used, actual, are commercially available.

Example 1: construction of promoter-GUS transgenic plant of rice OsAAP14 gene

(1) Obtaining promoter fragments

DNA extraction was performed on rice leaf samples by the CTAB method according to the molecular cloning guidelines. Based on an OsAAP14 (LOC _ Os04g 56470) sequence provided by a Phytozome website (https:// Phytozome-next. Jgi. Doe. Gov /), a Primer 5.0 is used for designing a Primer amplification promoter sequence, and related primers are synthesized by Beijing Optimalaceae Biotechnology, inc. High fidelity PCR amplification was performed using 2X Phanta Mix DNA polymerase using Zhonghua 11 genomic DNA as a template. Reaction system: 2.0. Mu.L of 2X Phanta Mix DNA polymerase, 2.0. Mu.L of each of OsAAP14-GUS-F and OsAAP14-GUS-R, 1.0. Mu.L of template DNA, and the same DNA fragment as the template DNA was purified using ddH ₂ O make up to 50. Mu.L. And (3) amplification procedure: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min, 35 cycles, and final extension at 72 ℃ for 5min. The detection was performed using 1.0% agarose gel electrophoresis, and the PCR product was recovered. The purified and recovered product is sent to Beijing Ongchongke Biotechnology Ltd for sequencing, and the result of successful sequencing is compared with the homologous sequence obtained from Phytozome website to determine whether the obtained fragment is the target fragment (see FIG. 1 for agarose electrophoresis).

The reference sequence is shown in FIG. 2, and the underlined labels indicate the amplification primer binding sites. The OsAAP14 gene promoter fragment of about 2000bp is obtained by cloning, and the fragment is positioned at 2088bp upstream of ATG of the OsAAP14 gene, see SEQ ID NO.1 (5 '→ 3'):

ATGTTAAGCCATAGTTTAATTTGTTTTTTCGTTGCAACCTGTAAAAGTTAAATTTTAACTTGCATGTTTGTTAAGTGATTTATCCCATACCTATTAATCTATCTTGTTAAATTTTTTATAGCCATTTGGATGACATGCAAACAACGAGGGAATGTCCACCGAGCCACTATTGGTACCTCAAATTACTAAGAGGTATTAAAAGTTACACCATAAATTTTTACATTAGAAGATACGGTTTTATATGTCAAAATATCAAGAGGTATCAACATTTATATCAGAATTTCTTACAGTAGAAAATATCGTACCTTTAGGTACTCCATCCATCCCAGAATATAATGAATTTTGGACAGATGGGACACTTCCTAGTACTACGAACGTGCAAAAGGATTGCACGTCAATATATTAAAAACAAAAGAGTTTTTGTTACACACACAAACGGCCAGACATGCCTATGTCATGGGGAAAGAAAAGGAAAAATCAGAGCTGCAACTGGTGAAAGAAAGGGAAACTACCAAAAAAAAAAGAGAGGGCGGTAGCGGAGCCACACTACACTTCCAAGAAACCCTCCAAAATTAGCAATGCCTTTAGATTCGTAGTACTTAAAAAAATGTGTTTTAGATGGAGGAAATATTTTCTTAAAAATTGTTAATTTATCTGTCCAATATGTATGTCAGGTTTCTCTGTATAGTATATAGTGAGCATTTTTTCTCTAGTTTCTTTGCAATAATGAGCATGTCACAACATAAATAGCGGATGTCCAGAGAGGAGCATATCCCGAATTATCAAAAACCGTCTACCCCTCTGTCAAAAAAAAAAGTCCAATCCTAGTTACGAATCTCGTGCCTAAGCTCATAGCTAGAGTTTACCTTTTTTTAACAGACTAGTATCACATAATTCTCATGTAGGCACCACATGTATCATTGTACCATACTATATTTTCACATATATCAAAGAACCAATCTATATAGGCAAATAATAATAATCTCGAGGAAATAAACAAAGAAAAAGGCCGCAAATCACTACCACGTAGAAGTACCAACCACCTCATCGTCATCGGAAAGGAGATTTGCTCCCAGCCTGTTTTTATGCCCAGAGATGTGAAGACATCATATATGAACACAAAAAAAGAAACCCTGATCTTCTACACCGTGGCTTTATTCAGCCCTCGTAACCCGTATACAGAAAAAAGTTGTCAAAGCAGCTGACAAGAAGAGGTGCCGTTGACCCCACCCGTAATCCATGAAAACGAGCCCAGTGACTTGTAAGCAAGCAATGTTCAATTCATCCACGAAAAAAGCAACATGCGCATTGAAAATGATCCATAACCGTGCCGCTAATTCCCAGTCAGTCACTGTCAAAATGTTTGTGGTATATTGTGCATCCTTTCTAATCAACATAAATTTTTGGTTGGCTAGGTTTGGTATTAAACCTGTGACTCGATTATAACATAATACTACTACAGTACTACTCCCTTCATTTTTTAATAGATGACACCGTTAATTTTTTCTCACATGTTTGACCATTCATCTTATTCAAAAAATTTACATAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTCATAGTCTTTTAAGTGTGGTTTATATCTTATATATTTGTATAAAATTTTTTGAATAAGACGAATGGTCAAACATGTAAGAAAAAGTCAACAACATCACCTATTAAAAAACGGAGGTAGTACTAATATGCAGTTTAGAGGCCTTGGCAAACTACAGGCGCTCCTAGAAACCGACAATTTTGACGTGTGTTCTTGTAGTACATACAGGCTGTGCTGCAGTTGGATTTGTCAGGAGGCTACTATACAATGATTCAACGAACATGAGCAGCAGCCTCGTCTGCTCGTGCCATTTTGTACTTAAAACAAGGCGCGATTCCGGCTGTCGATACGGCAGAGTTATCCCCCAAGTTTCTTTATCCAAATCACTCACCAATCCAGTGACAACGCTAGCTTAATTGGTTAGTGGACTAG

the sequence of OsAAP14-GUS-F is (5 '→ 3'): TTGGATCCATGTTAAGCCATAGTTTA (SEQ ID NO.2, underlined is the restriction site);

the sequence of OsAAP14-GUS-R is (5 '→ 3'): TTGAATTCCTAGTCCACTAACCAATT (SEQ ID NO.3, underlined is the cleavage site).

(2) Expression vector and transgenic plant construction

Carrying out enzyme digestion on an OsAAP14 gene promoter fragment (the two ends of which are respectively provided with enzyme digestion sites BamH I and EcoR I) and pCAMBIA1391Z (a plasmid structure schematic diagram is shown in figure 3, the plasmid is a plant promoter detection report vector in the prior art and can be cloned into a promoter to be researched through MCS (coding and coding scheme), wherein the promoter sequence integrated to the polyclonal site of the plasmid can be used for regulating and controlling the expression of an effector gene GUS), and the reaction conditions are 37 ℃ and 4h, and respectively carrying out recovery and purification on two enzyme digestion reaction liquids; linking the two by using T4 DNA ligase under the reaction condition of 16 ℃ for 8h; the recombinant plasmid was transformed into escherichia coli DH5 α, the grown colonies were subjected to PCR verification to screen out positive colonies (fig. 4A), the colonies were cultured using LB liquid medium until OD600 was about 0.6, and the plasmid was extracted for enzyme digestion verification (fig. 4B). According to the conventional means in the prior art, the recombinant positive plasmid is transferred into agrobacterium and is transformed into ZH11 callus to obtain a transformed plant, when the plantlet is stronger, a leaf blade is cut by 2cm, the genome DNA of the transformed plant is extracted by using a CTAB method, and then the positive plant (OsAAP 14 promoter-GUS transgenic plant) is detected by PCR amplification through amplifying a recombinant plasmid recombinant part (a front primer is positioned in a primer sequence GUS-AAP14JD-F in an OsAAP14 promoter region, and a rear primer is positioned in a primer sequence GUS-AAP14JD-R on a pCAMBIA1391Z plasmid GUS gene). Seedlings which are positive by PCR verification are transferred to a greenhouse for planting. FIG. 5 shows an agarose electrophoresis image of the PCR amplification assay.

Wherein, the primer information for verification is as follows:

the sequence of GUS-AAP14JD-F is (5 '→ 3'): TGTCGATACGGCAGAGTT (SEQ ID NO. 4);

the sequence of GUS-AAP14JD-R is (5 '→ 3'): TTTCTACAGGACGGACCGA (SEQ ID NO. 5).

Example 2: detection of promoter-GUS expression activity of OsAAP14 promoter-GUS transgenic plant at different parts

The transgenic rice plant obtained in example 1 was cross-bred to obtain a T2-generation rice plant. GUS staining is carried out on different parts of the T2 generation homozygous transgenic plant at the tillering stage and the reproductive stage of the rice. The specific process is as follows: after the T2 generation seeds which are successfully identified are harvested, soaking the seeds in water, and culturing in a constant-temperature incubator at 37 ℃; when the bud of the seed grows to about 2cm, the seed is sown into a 96-hole plate, the seed is cultivated in water by using a total nutrient solution under the illumination of a greenhouse, the formula of the Rice nutrient solution adopts the conventional nutrient solution of the International Rice Research Institute (Yoshida S, fomo DA, cock JH, gomez KA.1976. Route procedure for growing Rice plants in culture solution. In: laboratory Manual for physical-local cultures of Rice plants, philippines: international Rice Research Institute, 61-66.), as shown in the following Table 1.

Table 1: components of conventional nutrient solution of International Rice research institute

The components required by the total nutrient solution are prepared from analytical pure medicines purchased from Sutai brand; transplanting the plantlets into soil when the plantlets grow to about 20cm, and culturing in a greenhouse under normal illumination. And (3) performing GUS staining on leaves, roots, stems and basal parts of the plants at the tillering stage.

In the reproductive stage, GUS staining was performed on different tissue parts of the T2 plant, such as leaves, stems, roots and ears, at the booting stage, heading stage, flowering stage, filling stage and mature stage, respectively (FIGS. 6A-F).

The materials are soaked in GUS staining solution and then are placed at 37 ℃ for heat preservation overnight. Then, it was decolorized 3 times with 75% alcohol and stored at 4 ℃. Observing the material decolorized by alcohol under a microscope, wherein a blue part is a GUS activity expression site; the GUS activity is found to be higher at the base part and the leaf of the rice through dyeing, and the GUS activity also has certain expression at the root, the leaf sheath and the ear, but the expression quantity is the lowest in the stem. Cutting 2mm small segments from root, leaf sheath, stem, leaf, and ear of rice, and fixing in FAA fixative for 1.5 hr. After fixation, gradient elution is carried out by using ethanol with concentration of 50%, 65%, 85% and 100%, the elution time is 10min, then the mixture is respectively transparent for 10min in the mixed solution of xylene and absolute ethanol with the ratio of 1. The treated transparent tissue is put into melted paraffin liquid, soaked for 1h, directly sliced after cooling, the thickness is 5 mu m, the slice is dried at 50 ℃, dewaxed for 2 times by dimethylbenzene, each time for 15min, finally sealed by neutral gum, observed and photographed, and the GUS gene is found to have higher expression in the epidermis and cortex of the root, mesophyll cells of the leaf and inner cells of glume (figure 6G-K).

Example 3: comparison of GUS expression activity of OsAAP14 promoter-GUS transgenic plants under different amino acids and hormones

Soaking harvested OsAAP14 promoter-GUS transgenic plant T2 seeds in water in a constant-temperature incubator at 37 ℃ for culture, sowing the seeds into a 96-well plate when the buds of the seeds grow to about 2cm, performing water culture by using a full nutrient solution under the illumination of a greenhouse, and changing nitrogen in the full nutrient solution into 5 different exogenous amino acids for treatment (namely, NH is not added into the full nutrient solution) when seedlings grow to about 3 weeks ₄ NO ₃ Replacing it with an amino acid for each treatment group). Acidic amino acids (aspartic acid 0.2mmol/L, glutamic acid 0.3 mmol/L), basic amino acids (arginine 0.2mmol/L, lysine 0.1mmol/L, histidine 0.2 mmol/L), neutral amino acids 1 (serine 0.1mmol/L, threonine 0.2mmol/L, glycine 0.2mmol/L, alanine 0.3mmol/L, proline 0.2 mmol/L), neutral amino acids 2 (valine 0.2mmol/L, cysteine 0.1mmol/L, asparagine 0.3mmol/L, glutamine 0.3mmol/L, tyrosine 0.1 mmol/L), neutral amino acids 3 (methionine 0.1mmol/L, tryptophan 0.1mmol/L, leucine 0.2mmol/L, isoleucine 0.3mmol/L, phenylalanine 0.3 mmol/L) were added to a final concentration of 0.5mmol/L, respectively. Culturing for 0h, 1h and 2h, taking roots at each time point for GUS staining, comparing GUS activity of the plants under different types of amino acid treatment, after the alkaline amino acid treatment for strong induced expression is found, respectively treating for 0h, 1h and 2h by using 0.2mmol/L arginine, lysine and histidine, taking roots at each time point for GUS staining, and comparing the GUS activity of the plants under different types of amino acid treatment. The results showed that histidine, a basic amino acid, strongly promoted the effect of the promoter of the OsAAP14 gene to promote expression of the effector gene in rice roots (fig. 7-9).

The results show that the expression level of the OsAAP14 gene can be improved by regulating and controlling the promoter of the OsAAP14 gene when histidine-rich soil or gibberellin and abscisic acid are sprayed, so that the absorption and transportation of nitrogen are increased, and the vegetative growth is promoted; and the expression products of other downstream target genes can be specifically accumulated in roots (the promoter of the OsAAP14 gene is used for controlling the expression of an effector gene), and the local expression level is increased, so that the promoter of the OsAAP14 gene has good application prospect in transgenic engineering.

Example 4: analysis of OsAAP14 Gene expression Using real-time fluorescent quantitative PCR

In the wild type middle flower 11 reproductive period, root, base, leaf sheath, stem, sword leaf and ear are taken, and Trizol plant total RNA extraction method is used for extracting RNA of each part. After obtaining cDNA using HisScript II Q RT Supermix for qPCR (+ gDNA wiper) reverse transcription kit, real-time fluorescence PCR was performed using OsAAP14 real-time fluorescence primers 5-: taq Pro Universal SYBR qPCR Master Mix 5. Mu.L, primers qPCR-AAP14-F and qPCR-AAP 14-R1. Mu.L each, ddH ₂ mu.L of O2 and 1. Mu.L of cDNA were used to determine the expression level of OsAAP14 in different tissues of rice (FIG. 6L). The experimental results show that: the amino acid permease gene OsAAP14 has expression in all tissues of rice, and has higher expression level in the basal part and leaf of rice under normal conditions.

And (3) simultaneously adopting the amino acid treatment method of example 3 for the wild type medium flower 11 plantlets, extracting root RNA by using a Trizol plant total RNA extraction method, carrying out reverse transcription to obtain cDNA, and determining the expression quantity of OsAAP14 under the induction of different amino acids. And respectively treating the wild type medium flower 11 seedlings for 0h, 1h and 2h by adopting 2 mu mol/L gibberellin and abscisic acid, extracting root RNA by using a Trizol plant total RNA extraction method, carrying out reverse transcription to obtain cDNA, and determining the expression quantity of OsAAP14 under the induction of exogenous hormones. It was further confirmed that histidine, which is a basic amino acid, strongly promoted the expression of the OsAAP14 gene in rice roots, and that gibberellin and abscisic acid in rice roots also promoted the expression of the OsAAP14 gene (FIGS. 10 to 13). When exogenous amino acid and hormone are treated, the expression quantity in roots is increased sharply, which indicates that the OsAAP14 gene may be mainly involved in the transportation of the amino acid on the overground part of the rice under the normal condition, but when the content of the external amino acid and hormone is increased, the OsAAP responds to the external environment and further participates in the transportation of the amino acid on the roots of the rice.

The above description is only an example of the present invention, and the general knowledge of the known specific technical solutions and/or characteristics and the like in the solutions is not described herein too much. It should be noted that, for those skilled in the art, without departing from the technical solution of the present invention, several variations and modifications can be made, and these should also be considered as the protection scope of the present invention, which will not affect the effect of the implementation of the present invention and the practicability of the patent. The scope of the claims of the present application shall be defined by the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.

Claims

1. An amino acid and/or hormone regulated rice promoter, characterized in that: the nucleotide sequence is shown as SEQ ID NO. 1; or the nucleotide sequence is obtained by substituting, adding and/or deleting one or more nucleotides of the sequence shown in SEQ ID NO.1 and has the same function.

2. The amino acid and/or hormone regulated rice promoter of claim 1, wherein: the amino acid is histidine; the hormone is gibberellin or abscisic acid.

3. The amino acid and/or hormone regulated rice promoter of claim 2, wherein: the downstream of the rice promoter is connected with an effector gene.

4. An amino acid and/or hormone regulated rice promoter according to claim 3 wherein: after treating rice plants with histidine or gibberellin or abscisic acid, the rice promoter is used for promoting the expression of effector genes at the roots of rice.

5. The amino acid and/or hormone regulated rice promoter of claim 4, wherein: the effector gene is one of 0sAAP14 gene, GUS gene, osNRT2.4 gene and OsAMT1.2 gene.

6. The use of an amino acid and/or hormone regulated rice promoter according to any one of claims 1 to 5 in rice breeding, wherein: when the effector gene is 0sAAP14 gene, wild-type rice plants are treated with histidine or gibberellin or abscisic acid.

7. The use of an amino acid and/or hormone regulated rice promoter according to any one of claims 1 to 5 in rice breeding, wherein: comprises the following steps in sequence:

8. The use of an amino acid and/or hormone regulated rice promoter in rice breeding as claimed in claim 7 wherein the working concentrations of histidine, gibberellin and abscisic acid in S3 are 0.2mmol/L, 2 μmol/L and 2 μmol/L, respectively.

9. The application of the rice promoter regulated by the amino acid and/or the hormone in rice breeding as claimed in claim 8, characterized in that in S1, rice genome DNA is extracted, and then PCR amplification is carried out on the rice genome DNA by using an upstream primer with a sequence shown as SEQ ID No.2 and a downstream primer with a sequence shown as SEQ ID No.3 to obtain the rice promoter with a sequence shown as SEQ ID No. 1; integrating a rice promoter with a sequence shown as SEQ ID NO.1 to a multiple cloning site of an empty vector to obtain an expression vector; the empty vector is integrated with an effective response gene, and the rice promoter is used for promoting the expression of an effect gene.

10. An expression vector containing a rice promoter regulated by amino acid and/or hormone is characterized by comprising an empty vector and a promoter fragment which is integrated on a multiple cloning site of the empty vector and has a sequence shown as SEQ ID NO.1, wherein the promoter fragment is used for promoting the expression of an effector gene.