CN115873856A - Phyllostachys pubescens circRNA sequence and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a moso bamboo circRNA sequence and application thereof. The nucleotide sequence of the PecircCDPK gene provided by the invention is shown in SEQ ID NO. 1. The invention obtains the PecircCDPK sequence from the Phyllostachys pubescens for the first time and verifies the biological function by over-expressing the PecircCDPK sequence in Arabidopsis thaliana. The PecircCDPK has the function of regulating and controlling the drought resistance of plants, can provide powerful support for moso bamboo transgenic research and provides valuable candidate genes for moso bamboo molecular breeding.

Description

A moso bamboo circRNA sequence and its application

technical field

The invention relates to the technical field of plant genetic engineering, in particular to a circRNA sequence of moso bamboo and its application.

Background technique

Phyllostachys edulis, also known as Phyllostachys edulis, has rapid growth, wide distribution, great production potential and is widely used. As the global climate changes, the growth of moso bamboo is often affected by adverse environmental factors such as drought and high temperature.

Circular RNAs (circular RNAs, circRNAs) are a new type of non-coding RNA covalently bound by the 5' and 3' ends. Compared with traditional linear RNAs, circRNAs have the characteristics of a closed-loop structure and are not easily degraded by exonucleases, making them long regarded as shearing errors without any function. In recent years, with the development of high-throughput sequencing technology and bioinformatics, circRNAs have been found to be directly or indirectly involved in multiple biological processes such as plant growth and development, flowering regulation, and response to abiotic stress. CircRNAs have also been identified to be involved in lignin synthesis.

However, so far there is no related report on circRNAs of Moso bamboo under drought stress. Therefore, it is of great significance to study the function of circRNAs in Moso bamboo under drought stress, which can provide new theoretical basis and genetic resources for resistance breeding of bamboo.

Contents of the invention

The purpose of the present invention is to provide the PecircCDPK gene and its application; specifically, the present invention provides a circRNAs related to the drought stress of Phyllostachys pubescens.

In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a PecircCDPK gene related to drought resistance, the nucleotide sequence of which is shown in SEQ ID NO.1. The PecircCDPK gene encodes a circular RNA related to plant drought resistance.

The present invention uses the following methods to verify the PecircCDPK gene:

(1) Total RNA and DNA were extracted from leaves of Phyllostachys pubescens cultured for 3 months. Total RNA was treated with RNase R and reverse transcribed into cDNA. In the present invention, the extraction of total RNA and DNA of Phyllostachys pubescens can be carried out by the methods commonly used in the field for extracting total RNA and DNA of cells. In the embodiments of the present invention, the Trizol method is used for total RNA, and the CTAB method is used for DNA.

(2) After the total RNA and DNA of Phyllostachys pubescens were extracted, the total RNA was treated with RNase R enzyme and reverse transcribed to synthesize cDNA. In the present invention, conventional cDNA synthesis methods in the art can be used for the synthesis of cDNA, without other special requirements; in the embodiments of the present invention, the cDNA synthesis kit of Takara Company can be used for cDNA synthesis.

(3) After the cDNA and DNA are obtained, verify the PCR amplification of the divergent primers and convergent primers of the PecircCDPK gene. In the present invention, the PecircCDPK gene PCR amplification system is preferably a 20 μL system, including 5×PrimeSTAR GXL Buffer 4.0 μL, 2.5mM dNTP Mix 1.6 μL, upstream primer 1.0 μL, downstream primer 1.0 μL, cDNA/gDNA 2.0 μL, PrimeSTAR GXL DNA. .2 μL, _ddH2O 10.0 μL. The preferred PCR amplification reaction program is: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 72°C for 10s, 30 cycles; storage at 4°C.

Divergent primers and convergent primers were designed with Primer Premier 5 software, and PecircCDPK was verified using gDNA and cDNA (RNase R ⁺ ) as templates, respectively. The primer sequences are as follows:

Divergent upstream primer: 5′-TTCAAGGCAATGGACACAGA-3′ (SEQ ID NO.5)

Divergent downstream primer: 5′-AGGAGCAACTCCATGGTCAC-3′ (SEQ ID NO.6)

Convergent upstream primer: 5′-AGAGCCTTTCAGAGGAGGAGA-3′ (SEQ ID NO.7)

Convergent downstream primer: 5'-CGCCTCCATAAGATCACGAA-3' (SEQ ID NO. 8).

(4) After the target fragment is obtained by PCR amplification, the target fragment is sequenced to verify the PecircCDPK gene. After PCR amplification, the target fragment is preferably purified, and there is no special limitation on the purification method, which can be carried out by using a DNA purification kit well known to those skilled in the art.

(5) After the purification is completed, the purified target fragment is preferably connected to the pGEM-T Easy vector, introduced into Escherichia coli Trans5α competent cells, and sequenced after being verified as a positive clone by colony PCR.

In a second aspect, the present invention provides a biological material containing the above-mentioned PecircCDPK gene. The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant parts.

In the third aspect, the present invention claims to protect the application of the above-mentioned PecircCDPK gene or the above-mentioned biological material in realizing any one or more of the following:

1) Regulating plant drought resistance;

2) preparing drought-resistant plants;

3) Prepare plant drought resistance regulating substances.

Specifically, in the application provided by the present invention, the PecircCDPK gene or the biological material is used to prepare transgenic plants.

More specifically, in the application provided by the present invention, the plants include Arabidopsis and Phyllostachys thaliana.

In the fourth aspect, the present invention provides a method for improving drought resistance of plants, comprising: using genetic engineering means to overexpress PecircCDPK gene in plants; preferably, the plants include Arabidopsis thaliana and Moso bamboo.

In a method for improving drought resistance of plants provided by the present invention, the overexpression method is selected from the following 1) to 5), or an optional combination of 1) to 5):

1) by introducing a plasmid with the gene;

2) by increasing the copy number of said gene on the plant chromosome;

3) by changing the promoter sequence of the gene on the plant chromosome;

4) by operably linking a strong promoter to said gene;

5) By introducing enhancers.

In the method provided by the present invention, the PecircCDPK gene is transferred into Arabidopsis plants by using the Agrobacterium-mediated method to obtain transgenic Arabidopsis plants overexpressing the gene;

Preferably, the PecircCDPK gene is constructed on the plant expression vector pCAMBIAsuper1300-GFP, transformed into Agrobacterium, and then inflorescences of Arabidopsis thaliana are infiltrated to screen transgenic Arabidopsis plants.

As a specific embodiment of the present invention, in the present invention, the expression vector carrying the target gene can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. .

Further, the PecircCDPK gene was transferred into Arabidopsis plants by using the Agrobacterium-mediated method to obtain transgenic plants overexpressing the gene.

Preferably, the PecircCDPK gene is constructed on the plant expression vector pCAMBIAsuper1300-GFP, transformed into Agrobacterium, and then infected with Arabidopsis inflorescences to screen transgenic plants.

In a specific embodiment of the present invention, the pCAM BIAsuper1300-GFP-PecircCDPK overexpression vector is obtained by transforming the plant overexpression vector pCAMBIAsuper1300-GFP as the basic vector. The specific implementation plan is as follows:

1. Cloning and Ligation of the Upstream Circularization Driver Sequence

Using the DNA of the moso bamboo gene PH02Gene31251 as a template, an internal intron fragment with a length of 437 bp was selected as the upstream circularization driver sequence. Introduce XbaI and KpnI restriction site sequences at both ends; connect the amplified product to the pGEM-TEasy vector, transform Trans5α competent cells, and perform sequence determination; extract the plasmid, and the upstream intron is double-digested by XbaI and KpnI The fragment was ligated with pCAMBIAsuper1300-GFP, transformed, the plasmid was extracted, and sequenced. The moso bamboo gene PH02Gene31251 can be found in the public website of the moso bamboo genome http://172.26.100.143/#/) ( Bamboo V2 version, see SEQ ID NO.3 for specific sequence information.

2. Cloning and Ligation of the Downstream Circularization Driver Sequence

The downstream circularization driver sequence is the reverse complement of the upstream circularization driver sequence. BsrGI and EcoRI restriction site sequences were introduced at both ends; the amplified product was connected to the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced; The sub-fragment was ligated with pCAMBIAsuper1300-GFP containing the upstream circularization driver sequence, transformed, the plasmid was extracted, and sequenced.

3. Recombination expression vector driven by reverse complementation driven by flanking intron-assisted loop-forming sequence

In order to ensure that the target loop-forming sequence can be accurately looped by back splicing, it is necessary to simultaneously clone the flanking intron sequences of not less than 100 bp at both ends of the target sequence during the PCR process. Using the DNA of the moso bamboo gene PH02Gene31251 as a template, the PecircCDPK loop region plus the flanking intron (upstream 171 bp, downstream 137 bp) sequence was cloned. KpnI and BsrGI restriction site sequences were introduced at both ends; the homologous recombination method was used to connect and transform pCAMBIAsuper1300-GFP containing the upstream and downstream circularization driver sequences, and the plasmid was extracted for sequence determination. The plant expression vector pCAMBIAsuper1300-GFP- The construction of PecircCDPK is complete.

The preparation method of transgenic Arabidopsis is as follows:

The constructed plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK was transformed into competent Agrobacterium strain GV3101; the positive clones were selected to shake the bacteria, inflorescence infection and homozygous seed screening; the total RNA of Arabidopsis positive seedling leaves was extracted and treated with RNase R enzyme. It was reverse transcribed into cDNA, and identified by PCR with divergent upstream primer PecircCDPK-F and divergent downstream primer PecircCDPK-R.

According to the understanding of those skilled in the art, the present invention also claims the application of the transgenic plants obtained by the method for improving the drought resistance of plants in plant breeding.

The purpose of the breeding is to improve the drought resistance ability of the plants. The PecircCDPK gene is involved in the drought stress response of Phyllostachys pubescens, and the expression of this gene can be induced by drought stress.

In the application provided by the present invention, the breeding method includes transgenic, hybridization, backcrossing, selfing or asexual reproduction.

The beneficial effects of the present invention are:

The present invention reveals the biological function of the PecircCDPK gene for the first time, by constructing the PecircCDPK gene expression vector, combined with the genetic transformation method mediated by Agrobacterium, heterologously transforming Arabidopsis, investigating the effect of PecircCDPK on the drought resistance of transgenic Arabidopsis, and simultaneously Detecting the response of PecircCDPK to the drought stress of Moso bamboo will provide a powerful tool for transgenic research of Moso bamboo, and provide valuable candidate genes for molecular breeding of Moso bamboo resistance.

Description of drawings

Fig. 1 is the electrophoresis diagram (A) of the PCR product of PecircCDPK gene verification in the embodiment of the present invention, the PecircCDPK loop-forming region plus the flanking intron fragment and the intron fragment PCR product electrophoresis of Phyllostachys PH02Gene31251 gene screening (B) and the plant expression of PecircCDPK Vector and enzyme digestion verification map (C); among them, the lanes in A were amplified with divergent primers and convergent primers; lanes 1-2 in B were the PecircCDPK looping region plus flanking intron fragments and the Phyllostachys PH02Gene31251 gene screening Intron fragments, M1-M2 are DNA Markers; lanes 1-2 in C are digested products, M1-M2 are DNA Markers.

Figure 2 is a schematic diagram of constructing a flanking intron-assisted loop-forming sequence connected with a reverse complement-driven recombinant expression vector in an embodiment of the present invention, wherein, 1031bp=upstream of the flanking intron (171bp)+exon 1 (118bp) + Middle unspliced intron (439bp) + Exon 2 (166bp) + Flanking intron downstream (137bp).

Fig. 3 is the relative expression level of PecircCDPK gene in the leaves of Phyllostachys pubescens under different drought stress in the example of the present invention.

Fig. 4 is the root length analysis of PecircCDPK gene-transferred Arabidopsis and wild-type Arabidopsis under different drought stresses in the embodiment of the present invention.

Fig. 5 is the determination of leaf water loss rate and relative water content of PecircCDPK gene-transferred Arabidopsis and wild-type Arabidopsis in the embodiment of the present invention.

Fig. 6 is the free proline content (A), malondialdehyde content (B), superoxide dismutase activity (C) of transgenic Arabidopsis thaliana and wild-type Arabidopsis in the embodiment of the present invention under drought stress ) and peroxidase activity (D).

Fig. 7 is the detection of expression levels of related CDPK genes in PecircCDPK gene-transferred Arabidopsis and wild-type Arabidopsis in the embodiment of the present invention.

Detailed ways

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all in accordance with conventional experimental conditions, such as Molecular Cloning Experiment Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or in accordance with the conditions suggested by the manufacturer's instructions.

Example 1 Obtaining the full length of PecircCDPK gene

The moso bamboo material used in this example comes from Guangxi Zhuang Autonomous Region, placed in a constant temperature light incubator, the day and night temperature is 25°C/18°C, and the photoperiod is light/dark 16h/8h, cultivated to about three months, with 20% PEG 6000 was used to simulate drought stress, and the leaves of the same parts were taken at 0h, 6h, 12h, 24h, and 48h after treatment, and were quickly frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted from leaves of Phyllostachys pubescens under different drought stress treatments by Trizol method. The total RNA was treated with the rRNA removal kit (RiboZero rRNARemoval Kit), and then 20 U·μL ^-1 RNase R was added and placed in a water bath at 37°C for 1 h to eliminate interference from linear RNA. A breaking reagent is added, and the first-strand cDNA is synthesized by a six-base random primer. The second-strand synthesis reaction reagents are sequentially added to the synthesized first-strand cDNA product, followed by purification. The purified product was end-repaired, "A" base was added and sequencing adapters were ligated. Then carry out fragment size screening, and use a PCR instrument to amplify. Finally, IlluminaHiseq was used for sequencing. Finally, obtain the circular RNA full-length sequence SEQ ID NO.1, as follows.

gtcatccgtggatttgtgaccatggagttgctcctgatcggcctcttgatccagctgtcctttctcgcattaagcagttctcagcaatgaataagttgaagaagatggctttgcgagtaattgctgagagcctttcagaggaggagattgcaggactaaaggaaatgttcaaggcaatggacacagataacagcggtgcaattacatatgatgagctcaaagaaggcatgagaaaatatggttcaacactaaaggatacagaaattcgtgatcttatggaggcg。

Example 2 Verification of PecircCDPK gene

In this example, leaves of Phyllostachys pubescens were used as materials, and the total RNA of the leaves was extracted according to the instructions of the Trizol RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd.), and the total DNA of the leaves was extracted according to the CTAB method. Total RNA was treated with RNase R enzyme. Each μg of total RNA was mixed with 2-3U RNase R (20U/μl), and incubated in a water bath at 37°C for 15min. 1 ng of RNA treated with RNase R was reverse-transcribed into cDNA according to the reverse transcription kit (Takara). According to the bamboo genome database http://bamboo.bamboogdb.org/#/, divergent primers and convergent primers were designed with Primer Premier 5 software, and PecircCDPK was verified using gDNA and cDNA (RNase R ⁺ ) as templates, respectively.

Divergent upstream primer: 5′-TTCAAGGCAATGGACACAGA-3′

Divergent downstream primer: 5′-AGGAGCAACTCCATGGTCAC-3′

Convergent upstream primer: 5′-AGAGCCTTTCAGAGGAGGAGA-3′

Convergent downstream primer: 5′-CGCCTCCATAAGATCACGAA-3′

Polymerase Chain Reaction:

20 μL reaction system: 5×PrimeSTAR GXL Buffer 4.0 μL, 2.5mM dNTP Mix 1.6 μL, upstream primer 1.0 μL, downstream primer 1.0 μL, cDNA/gDNA 2.0 μL, PrimeSTAR GXL DNA 0.2 μL, ddH ₂ O 10.0 μL.

PCR reaction program: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 72°C for 10s, 30 cycles; storage at 4°C.

The recovered product was connected to the pGEM-T Easy vector, transformed into Trans5α competent cells, and the positive clones were selected for plaque PCR detection, and the positive clones were sequenced (Shanghai Sangon Bioengineering Co., Ltd.), and the sequencing results were accurate. The verified nucleotide sequence of PecircCDPK is shown in SEQ ID NO.2.

Example 3 Construction of plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

In this example, the plant overexpression vector pCAMBIAsuper1300-GFP was used as the basic vector to obtain the PecircCDPK overexpression vector through transformation.

1. Cloning and ligation of the upstream circularization driver sequence

Using the DNA of the moso bamboo gene PH02Gene31251 as a template, a part of the intron fragment with a length of 437 bp (SEQ ID NO.4) was selected as the upstream circularization driving sequence (B of FIG. 1 ). XbaI and KpnI double restriction site sequences were introduced at both ends; the amplified product was connected to the pGEM-T Easy vector (Promega Company), transformed into Trans5α competent cells, and sequenced; the plasmid was extracted and subjected to XbaI and KpnI double enzymes The cut upstream intron fragment was ligated with pCAMBIAsuper1300-GFP, transformed, and the plasmid was extracted for sequence determination.

Upstream primer Up-2-F: 5'-TCTAGACTCATCACCAAGGAGGACGTC-3' (SEQ ID NO.9);

Downstream primer Up-2-R: 5'-GGTACCCTCAGCAGTCGGCAAAGCGA-3' (SEQ ID NO. 10).

(1) Carry out PCR reaction with DNA of moso bamboo leaves as template

20 μL reaction system: 5×PrimeSTAR GXL Buffer 4.0 μL, 2.5mM dNTP Mix 1.6 μL, upstream primer 1.0 μL, downstream primer 1.0 μL, DNA template 2.0 μL, PrimeSTAR GXL DNA 0.4 μL, ddH ₂ O 10.0 μL.

PCR reaction program: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 72°C for 26s, 30 cycles; storage at 4°C.

(2) Amplified product recovery and connection

The recovered fragments were connected to the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The sequencing results were accurate.

(3) Construction of expression vector pCAMBIAsuper1300-GFP-upstream circularization driver sequence

Use XbaI and KpnI to double digest the pGEM-T Easy linked with the upstream circularization driver sequence, and construct the recombinant plasmid with the expression vector pCAMBIAsuper1300-GFP that is double digested with XbaI and KpnI. The digestion system is as follows (50 μL):

Digestion at 37°C for 4 hours; the product was subjected to agarose gel electrophoresis, and the large fragment of plasmid pCAMBIAsuper1300-GFP and the small fragment of the upstream circularization driver sequence were recovered with a gel recovery kit (Axygen). Ligate the two recovered products with T4 DNA ligase, and the ligation reaction system is as follows (20 μL):

The ligation reaction was carried out overnight at 4°C, and all the ligation products were transformed into Trans5α competent cells. Cultivate overnight at 37°C, select a single clone, and after colony PCR verification, expand the culture, extract the plasmid pCAMBIAsuper1300-GFP-upstream circularization driver sequence, and perform sequencing and enzyme digestion verification.

2. Cloning and ligation of the downstream circularization driver sequence

The downstream circularization driver sequence is the reverse complement of the upstream circularization driver sequence. BsrGI and EcoRI restriction site sequences were introduced at both ends; the amplified product was connected to the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced; The sub-fragment was ligated with pCAMBIAsuper1300-GFP containing the upstream circularization driver sequence, transformed, the plasmid was extracted, and sequenced.

Upstream primer Down-2-F: 5'-GAATTCCTCATCACCAAGGAGGACGTC-3' (SEQ ID NO.11);

Downstream primer Down-2-R: 5'-TGTACACTCAGCAGTCGGCAAAGCGA-3' (SEQ ID NO. 12).

(1) Carry out PCR reaction with DNA of moso bamboo leaves as template

20 μL reaction system: 5×PrimeSTAR GXL Buffer 4.0 μL, 2.5mM dNTP Mix 1.6 μL, upstream primer 1.0 μL, downstream primer 1.0 μL, DNA template 2.0 μL, PrimeSTAR GXL DNA 0.4 μL, ddH ₂ O 10.0 μL.

PCR reaction program: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 72°C for 26s, 30 cycles; storage at 4°C.

(2) Amplified product recovery and connection

The recovered fragments were connected to the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The sequencing results were accurate.

(3) Construction of downstream circularization driver sequence and expression vector pCAMBIAsuper1300-GFP-upstream circularization driver sequence

Use BsrGI and EcoRI to digest pGEM-T Easy linked with the downstream circularization driver sequence, and construct the recombinant plasmid with the expression vector pCAMBIAsuper1300-GFP-upstream circularization driver sequence digested with BsrGI and EcoRI. The digestion system is as follows (50 μL) :

Digested at 37°C for 4 hours; the product was subjected to agarose gel electrophoresis, and the plasmid pCAMBIAsuper1300-GFP-upstream circularization driver sequence large fragment and downstream circularization driver sequence small fragment were recovered with a gel recovery kit (Axygen). Use T4 DNA ligase to ligate the two recovered products, and the ligation reaction system is as follows (20 μL):

The ligation reaction was carried out overnight at 4°C, and all the ligation products were transformed into Trans5α competent cells. Cultivate overnight at 37°C, select a single clone, and after colony PCR verification, expand the culture, extract the plasmid pCAMBIAsuper1300-GFP-upstream and downstream circularization driver sequences, and perform sequencing and enzyme digestion verification. The obtained vector plasmid was called pCAMBIAsuper1300-GFP-OE.

3. Recombinant expression vector driven by reverse complementation driven by flanking intron-assisted loop-forming sequence

In order to ensure that the target loop-forming sequence can be accurately looped by back splicing, it is necessary to simultaneously clone the flanking intron sequences of not less than 100 bp at both ends of the target sequence during the PCR process. Using the DNA of the moso bamboo gene PH02Gene31251 as a template, clone the PecircCDPK loop region plus flanking intron (upstream 171bp, downstream 137bp) sequence, the schematic diagram of recombinant expression vector construction is shown in Figure 2. KpnI and BsrGI restriction site sequences were introduced at both ends; the homologous recombination method was used to connect and transform pCAMBIAsuper1300-GFP-OE containing the upstream and downstream circularization driver sequences, extract the plasmid, and perform sequence determination. The plant expression vector pCAMBIAsuper1300- The construction of GFP-PecircCDPK is completed.

Upstream primer circCDPK-2-F: 5'-GGTACCTTCCCATGTAGAACTTCCTTG-3' (SEQ ID NO.13);

Downstream primer circCDPK-2-R: 5'-TGTACACATGTGCAAGAAACCAGTTG-3' (SEQ ID NO.14).

The fragment of interest was recovered using a gel recovery kit (Axygen). The ligation reaction was carried out according to the standard operation procedure of the one-step cloning kit (Nanjing Nuoweizan), and the ligation reaction system was as follows (20 μL):

React in a water bath at 37°C for 30 minutes, and transform all the ligation products into Trans5α competent cells. Cultivate overnight at 37°C, select a single clone, and after colony PCR verification, expand the culture, extract the plasmid pCAMBIAsuper1300-GFP-PecircCDPK, and perform sequencing and enzyme digestion verification (Figure 1).

Example 4 Transformation of Arabidopsis thaliana with plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

This embodiment provides a method for transforming Arabidopsis thaliana with the plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK, and the specific steps are as follows:

(1) Transformation of Agrobacterium strain GV3101 by freeze-thaw method

Add 1 ng of the recombinant expression vector plasmid to 100 μL of competent cells GV3101, ice-bath for 10 minutes, freeze the competent cells in liquid nitrogen for 5 minutes, quickly transfer them to a constant temperature water bath at 37°C for 5 minutes, and place them on ice for 5 minutes. Add 600 μL of LB liquid medium to the centrifuge tube, shake and culture in a shaker at 28°C for 2-3 hours, and recover the bacteria. Draw 60 μL of the bacterial liquid and spread it on the YEP solid medium containing Kan resistance (50 mg/Ml) and Rif (50 mg/mL) resistance, and invert the plate in a constant temperature shaker at 28 ° C for about 2-3 days until the growth White colonies. After picking a single clone colony for PCR detection, select positive clones for shake culture.

(2) Arabidopsis inflorescence dipping

The above positive clones were inoculated in 10 mL of YEP (50 μg/mL rifampicin + 100 μg/mL kanamycin) liquid medium, cultured in a 28°C incubator with shaking (160 rpm) for 12 hours, and 2 mL of the culture solution was transferred to 200 mL of YEP (50 μg /mL rifampicin+100μg/mL kanamycin) for mass culture, 28°C incubator shaking culture (160rpm) for 12h, the OD ₆₀₀ of the culture solution reached 1.8-2.2μg/mL, take 50mL of the culture solution, and use Centrifuge the 50mL centrifuge tube at 5000rpm at 4°C for 5min, vigorously suspend it with transformation solution (2.2g MS, 5% sucrose, adjust the pH to 5.8, add 0.2% SilwetL-77 to mix), and dilute the precipitate to 1.0μg/mL. Prepare about 200mL for dipping Arabidopsis. Soak the shoots of Arabidopsis thaliana that have just bloomed in the transformation solution for 3 minutes, wrap the plants with plastic wrap, culture in dark for 12-16 hours, remove the plastic wrap, put the plants in an incubator for cultivation, and wait for the seeds to be harvested.

(3) Homozygous screening

Place T0 generation Arabidopsis seeds in a centrifuge tube, add 1 mL of 70% alcohol to disinfect for 5 minutes, then use 1 mL of 2.6% sodium hypochlorite solution to disinfect for 10 minutes, and then wash with sterile water 5 times. Sow the seeds evenly on the screening medium with 1/2MS+50mg/L hygromycin, purify at 4°C for 2 days, and then culture them in an artificial climate incubator until 4 cotyledons grow. The plants are transplanted into the soil for cultivation, and after maturity, the seeds of the T1 generation are collected in a single plant, and the seedlings of the T1 generation are screened by the same method, and the ratio of the positive plants and the non-positive plants of each strain of the T1 generation is counted, and the ratio is about 3: The positive plants of strain 1 were transplanted into the soil for cultivation to obtain T2 generation seeds. Apply the same method to screen T2 generation seedlings to obtain T3 generation seeds.

(4) PCR identification of positive plants

The positive Arabidopsis leaf RNA was extracted, and the total RNA was treated with RNase R and reverse-transcribed to synthesize cDNA, which was identified by PCR with divergent primers PecircCDPK-F and PecircCDPK-R. It was found that all positive plants contained PecircCDPK, indicating that PecircCDPK was successfully transferred into Arabidopsis.

PecircCDPK gene expression analysis under the drought stress of embodiment 5

This embodiment provides an analysis of the expression of the PecircCDPK gene under drought stress, and the specific steps are as follows:

(1) Material handling

Moso bamboo seeds were collected in Guangxi Zhuang Autonomous Region, placed in a constant temperature light incubator, the day and night temperature was 25°C/18°C, the photoperiod was light/dark 16h/8h, cultivated for about three months, and simulated drought stress with 20% PEG 6000 , take the leaves of the same parts at 0h (P1), 6h (P2), 12h (P3), 24h (P4), and 48h (P5) after treatment, freeze them rapidly in liquid nitrogen, and store them at -80°C.

(2) Synthesis of cDNA template

The total RNA in the leaves of Phyllostachys pubescens was extracted by using Trizol Reagent reagent, the linear RNA was removed by RNase R enzyme, and the ratio of A ₂₆₀ to A ₂₈₀ and RNA concentration were measured by UV spectrophotometer. The first strand of cDNA was synthesized by the reverse transcription kit of Takara Company, and the synthesized product was stored in a -20°C refrigerator.

(3) Real-time fluorescent quantitative PCR

The expression of the target gene was detected by real-time fluorescent quantitative PCR (qRT-PCR). The UBQ gene is used as an internal reference gene, UBQ-F: 5'-AATAGCTGTCCCTGGAGGAGTTT-3' (SEQ ID NO.15), UBQ-R: 5'-TCTTGTTTGACACCGAAGAGGAG-3'; (SEQ ID NO.16);

PecircCDPK-F: 5'-TTCAAGGCAATGGACACAGA-3', PecircCDPK-R: 5'-AGGAGCAACTCCATGGTCAC-3'.

The 10μL reaction system is as follows:

Reaction program: 95°C for 30s; 95°C for 15s, 60°C for 60s, 60°C for 60s, 40 cycles.

480仪分析数据，利用2^-ΔΔCT法分析3次生物学实验数据，用Excel进行作图。Other reaction parameters are the default settings of the system, each reaction is set to 3 biological repeats, and Roche

The data were analyzed by 480 instrument, the data of three biological experiments were analyzed by 2 ^-ΔΔCT method, and the graphs were drawn by Excel.

(4) Experimental results and analysis

The expression pattern of PecircCDPK gene was analyzed by real-time quantitative PCR experiment, and the results showed that PecircCDPK was down-regulated in leaves under drought stress ( FIG. 3 ).

Example 6 Analysis of Drought Resistance of Arabidopsis thaliana Transduced with PecircCDPK Gene

This example provides the drought resistance analysis of Arabidopsis transgenic PecircCDPK gene, the specific steps are as follows:

Under different concentrations of drought treatment, the root length changes of transgenic and wild-type plants were observed. On the 1/2MS medium supplemented with 0% PEG, the growth of WT and transgenic overexpression plants was basically the same, and the number of roots was relatively small, indicating that a small number of long roots were sufficient for the plants to absorb water. Under 4% PEG treatment, it could be observed that the total heel length of overexpression lines 1 and 3 was greater than that of WT, and the root length of WT was significantly shorter. Under the high concentration of 8% PEG treatment, the root length of most plants in OE-1 and OE-2 was longer than that of WT, while the root length of OE-3 plants was longer than that of WT, and the root length of WT became shorter. Regarding the number of roots, it was observed that the number of roots of the transgenic plants was greater than that of the WT under 6% and 8% PEG treatment (Fig. 4).

The transgenic and WT lines grown to 3-4 weeks were selected, and 3 plants were selected from each line as a sample, and the leaves with similar growth were cut and placed in petri dishes, and weighed and recorded at different time points. On the whole, the water loss rate of leaves gradually increased with the increase of time. In the first 360min, the water loss rate of transgenic plants was lower than that of WT at all time points. By measuring the relative water content of the leaves, it was found that the water content of the transgenic lines was increased and was significantly higher than that of the WT (Fig. 5).

Examination of free proline content and antioxidant enzyme activity of transgenic and wild-type Arabidopsis under drought stress. Free proline content (Pro content), malondialdehyde content (MIDA content), superoxide dismutase activity (SOD activity) and peroxidase activity in wild-type Arabidopsis and transgenic Arabidopsis under normal growth conditions activity (POD activity) was not significantly different.

After drought treatment, the free proline content of transgenic and wild-type Arabidopsis thaliana increased significantly, and the free proline content of transgenic lines OE-1 and OE-2 increased significantly compared with wild-type CK (10.6 times), respectively. The content of free proline in transgenic lines OE-1 and OE-2 after treatment was significantly higher than that of wild-type CK; the content of malondialdehyde in both transgenic and wild-type Arabidopsis was significantly increased, but the increase of transgenic Arabidopsis was small, they were 2.22 times (OE-1), 2.23 times (OE-2) and 2.74 times (CK) before treatment; meanwhile, wild type Arabidopsis C The content of dialdehyde was higher than that of the transgenic type, and the difference reached a significant level. The superoxide dismutase and peroxidase activities of transgenic and wild-type Arabidopsis thaliana were significantly increased compared with those not subjected to drought stress, and the peroxidase activity of transgenic Arabidopsis leaves was significantly higher than that of wild-type (Figure 6).

In order to further explore whether the increased drought resistance of transgenic Arabidopsis is related to the genes of CDPK pathway in Arabidopsis. The expression level of the Arabidopsis gene AtCDPK13 with the highest homology to the parental gene of PecircCDPK was detected by RT-qPCR technology. The results showed that the expression level of AtCDPK13 gene was increased in transgenic lines compared with WT. And the expression level of AtCDPK13 gene in OE-1 and OE-2 was significantly higher than that in WT (Fig. 7).

Although the present invention has been described in detail with general descriptions and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, the modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the protection scope of the present invention.

Claims (10)

1. The PecircCDPK gene related to drought resistance, characterized in that the nucleotide sequence of the PecircCDPK gene is shown in SEQ ID NO.1. 2. The biological material containing the PecircCDPK gene of claim 1, wherein the biological material is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineering bacterium or a non-renewable plant part. 3. the application of the PecircCDPK gene described in claim 1 or the biological material described in claim 2 in realizing any one or more of the following: 1) Regulating plant drought resistance; 2) preparing drought-resistant plants; 3) Prepare plant drought resistance regulating substances. 4. The application according to claim 3, characterized in that the PecircCDPK gene or the biological material is used to prepare transgenic plants. 5. application according to claim 4, is characterized in that, described plant comprises Arabidopsis, Phyllostachys thaliana. 6. A method for improving drought resistance of plants, characterized in that it comprises: using genetic engineering means to overexpress PecircCDPK gene in plants; preferably, said plants include Arabidopsis thaliana and bamboo. 7. The method according to claim 6, characterized in that the overexpression method is selected from the following 1) to 5), or any combination of 1) to 5): 1) by introducing a plasmid with the gene; 2) by increasing the copy number of said gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to said gene; 5) By introducing enhancers. 8. The method according to claim 7, characterized in that, the PecircCDPK gene is transferred into the Arabidopsis plant by using the Agrobacterium-mediated method to obtain the transgenic Arabidopsis plant overexpressed of the gene; Preferably, the PecircCDPK gene is constructed on the plant expression vector pCAMBIAsuper er1300-GFP, transformed into Agrobacterium, and then inflorescences of Arabidopsis thaliana are infiltrated to screen transgenic Arabidopsis plants. 9. The use of the transgenic plant obtained by the method according to any one of claims 6-7 in plant breeding. 10. The application according to claim 9, characterized in that the breeding method comprises transgenic, hybridization, backcrossing, selfing or asexual reproduction.

Images