CN115873856A - Phyllostachys pubescens circRNA sequence and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a moso bamboo circRNA sequence and application thereof. The nucleotide sequence of the PecircCDPK gene provided by the invention is shown in SEQ ID NO. 1. The invention obtains the PecircCDPK sequence from the Phyllostachys pubescens for the first time and verifies the biological function by over-expressing the PecircCDPK sequence in Arabidopsis thaliana. The PecircCDPK has the function of regulating and controlling the drought resistance of plants, can provide powerful support for moso bamboo transgenic research and provides valuable candidate genes for moso bamboo molecular breeding.

Description

Phyllostachys pubescens circRNA sequence and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a moso bamboo circRNA sequence and application thereof.

Background

Phyllostachys edulis (Phyllostachys edulis) also known as Phyllostachys pubescens and Phyllostachys cathayensis has the advantages of rapid growth, wide distribution, large production potential and wide application. With the change of global climate, the growth of moso bamboo is often affected by adverse environmental factors such as drought and high temperature.

Circular RNAs are a novel non-coding RNA covalently bound by a 5 'end and a 3' end. Compared with the traditional linear RNA, the circRNAs have the characteristics of closed loop structure, difficult degradation by exonuclease and the like, so that the circRNAs are regarded as shearing errors for a long time and do not have any function. In recent years, with the development of high-throughput sequencing technology and bioinformatics, circRNAs are sequentially found to be directly or indirectly involved in multiple biological processes of plant growth and development, flowering regulation, response to abiotic stress and the like, and in the moso bamboo shoot stage, the circRNAs have been identified to be involved in lignin synthesis.

However, there have been no reports on the phyllostachys pubescens circRNAs under drought stress to date. Therefore, the functional research of the moso bamboo circRNAs under drought stress is significant, and a new theoretical basis and gene resources can be provided for resistance breeding of bamboos.

Disclosure of Invention

The invention aims to provide a PecircCDPK gene and application thereof; specifically, the invention provides circRNAs related to moso bamboo drought stress.

In order to realize the purpose of the invention, in a first aspect, the invention provides a PecircCDPK gene related to drought resistance, and the nucleotide sequence of the PecircCDPK gene is shown as SEQ ID NO. 1. The PecircCDPK gene encodes a circular RNA related to plant drought resistance.

The method of the invention is used for verifying the PecircCDPK gene as follows:

(1) Extracting total RNA and DNA by using the phyllostachys pubescens leaves cultured for 3 months as materials. Total RNA was treated with RNase R enzyme and reverse transcribed into cDNA. In the invention, the total RNA and DNA of the moso bamboo can be extracted by a method for extracting total RNA and DNA of cells commonly used in the field, the total RNA adopts a Trizol method, and the DNA adopts a CTAB method.

(2) After extracting total RNA and DNA of moso bamboo, performing RNase R enzyme treatment on the total RNA and performing reverse transcription to synthesize cDNA. In the invention, the cDNA is synthesized by adopting a cDNA synthesis method which is conventional in the field, and no other special requirements exist; in the examples of the present invention, cDNA synthesis can be carried out specifically by using a cDNA synthesis kit of Takara.

(3) After obtaining cDNA and DNA, PCR amplification verification of the divergence and convergence primers of the pecrccdpk gene was performed. In the present invention, the PCR amplification system of the PecircCDPK gene is preferably a 20. Mu.L system comprising 5 XPrimeSTAR GXL Buffer 4.0. Mu.L, 2.5mM dNTP Mix 1.6. Mu.L, upstream primer 1.0. Mu.L, downstream primer 1.0. Mu.L, cDNA/gDNA 2.0. Mu.L, primeSTAR GXL DNA0.2μL，ddH ₂ O10.0. Mu.L. The PCR amplification reaction procedure is preferably: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s; annealing at 55 ℃ for 30s; extension at 72 ℃ for 10s,30 cycles; storing at 4 ℃.

Design of divergent and convergent primers with gDNA and cDNA (RNase R) respectively using Primer Premier 5 software ⁺ ) Pecircdpk was validated for the template. The primer sequences are as follows:

a divergent upstream primer: 5'-TTCAAGGCAATGGACACAGA-3' (SEQ ID NO. 5)

A divergent downstream primer: 5'-AGGAGCAACTCCATGGTCAC-3' (SEQ ID NO. 6)

Converging an upstream primer: 5'-AGAGCCTTTCAGAGGAGGAGA-3' (SEQ ID NO. 7)

A convergence downstream primer: 5'-CGCCTCCATAAGATCACGAA-3' (SEQ ID NO. 8).

(4) After PCR amplification is carried out to obtain a target fragment, sequencing is carried out on the target fragment, and the PecircCDPK gene is verified. After PCR amplification, the target fragment is preferably purified, and the purification method is not particularly limited, and may be performed using a DNA purification kit known to those skilled in the art.

(5) After purification, the purified target fragment is preferably connected to a pGEM-T Easy vector, introduced into E.coli Trans5 alpha competent cells, verified to be a positive clone by colony PCR, and sequenced.

In a second aspect, the invention provides a biomaterial containing the pecircdpk gene, wherein the biomaterial is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineered bacterium or a non-regenerable plant part.

In a third aspect, the invention claims the use of the pecircdpk gene as described above or the biomaterial as described above for the purpose of achieving any one or more of:

1) Regulating and controlling the drought resistance of the plant;

2) Preparing drought-resistant plants;

3) Preparing the drought resistance regulating substance for plants.

Specifically, in the application provided by the invention, the PecircCDPK gene or the biological material is used for preparing transgenic plants.

More specifically, in the application provided by the invention, the plants comprise arabidopsis thaliana and moso bamboo.

In a fourth aspect, the present invention provides a method for improving drought resistance of a plant, comprising: overexpression of the PecircCDPK gene in plants by genetic engineering means; preferably, the plant comprises arabidopsis thaliana, phyllostachys pubescens.

In the method for improving the drought resistance of the plant, the overexpression mode is selected from the following 1) to 5), or 1) to 5) optional combination:

1) By introducing a plasmid having the gene;

2) By increasing the copy number of the gene on the plant chromosome;

3) By altering the promoter sequence of said gene on the plant chromosome;

4) By operably linking a strong promoter to the gene;

5) By introducing an enhancer.

In the method provided by the invention, the PecircCDPK gene is transferred into an Arabidopsis plant by adopting an agrobacterium-mediated method to obtain a transgenic Arabidopsis plant over-expressed by the gene;

preferably, the PecircCDPK gene is constructed on a plant expression vector pCAMBIAsuper1300-GFP to transform agrobacterium, then an arabidopsis inflorescence is impregnated, and a transgenic arabidopsis plant is screened.

As a specific embodiment of the present invention, the expression vector carrying the target gene can be introduced into plant cells by using a conventional biotechnological method such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

Further, the PecircCDPK gene is transferred into an Arabidopsis plant by adopting an agrobacterium-mediated method to obtain a transgenic plant with the gene over-expressed.

Preferably, the PecircCDPK gene is constructed on a plant expression vector pCAMBIAsuper1300-GFP to transform agrobacterium, then an arabidopsis inflorescence is impregnated, and a transgenic plant is screened.

In a specific embodiment of the invention, a plant over-expression vector pCAMBIAsuper1300-GFP is taken as a basic vector, and the pCAM BIAsuper1300-GFP-PecircCDPK over-expression vector is obtained by modification. The specific embodiment is as follows:

1. cloning and ligation of upstream circular drive sequences

The DNA of the Phyllostachys pubescens Gene PH02Gene31251 is taken as a template, and an internal intron fragment with the length of 437bp is selected as an upstream cyclization driving sequence. XbaI and KpnI enzyme cutting site sequences are respectively introduced into two ends; connecting the amplified product to a pGEM-T Easy vector, transforming Trans5 alpha competent cells, and performing sequence determination; extracting plasmid, connecting the upstream intron fragment which is subjected to double enzyme digestion by XbaI and KpnI with pCAMBIAsuper1300-GFP, transforming, extracting plasmid, and carrying out sequence determination. Phyllostachys pubescens Gene PH02Gene31251 in Phyllostachys pubescens genome publishing sitehttp://172.26.100.143/#/)(BambooThe V2 version can be inquired, and the specific sequence information is shown in SEQ ID NO.3.

2. Cloning and ligation of downstream circularization driver sequences

The downstream circularization drive sequence is the reverse complement of the upstream circularization drive sequence. BsrGI and EcoRI restriction site sequences are respectively introduced into two ends; connecting the amplified product to a pGEM-T Easy vector, transforming Trans5 alpha competent cells, and performing sequence determination; extracting plasmid, connecting the downstream intron fragment subjected to double digestion by BsrGI and EcoRI with pCAMBIAsuper1300-GFP containing an upstream cyclization driving sequence, transforming, extracting the plasmid, and performing sequence determination.

3. Recombination expression vector with reverse complementary drive connected with flanking intron auxiliary loop sequence

In order to ensure that the target loop forming sequence can be accurately looped through a reverse splicing mode, a flanking intron sequence with two ends not less than 100bp of the target sequence is cloned simultaneously in a PCR process. The DNA of the Phyllostachys pubescens Gene PH02Gene31251 is used as a template to clone the sequence of the loop region of PecircCDPK plus a flanking intron (upstream 171bp, downstream 137 bp). Introducing KpnI and BsrGI enzyme cutting site sequences at two ends respectively; connecting and transforming the plant expression vector with pCAMBIAsuper1300-GFP containing upstream and downstream cyclization driving sequences by a homologous recombination method, extracting plasmids, performing sequence determination, and completing the construction of a plant expression vector pCAMBIAsuper 1300-GFP-PecircCDPK.

The preparation method of the transgenic arabidopsis is as follows:

transforming the constructed plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK into agrobacterium strain GV3101 competence; selecting positive clone shake bacteria, inflorescence infection and screening homozygous seeds; extracting total RNA of arabidopsis positive seedling leaves, performing RNase R enzyme treatment, performing reverse transcription to obtain cDNA, and performing PCR identification by using a divergent upstream primer PecircCDPK-F and a divergent downstream primer PecircCDPK-R.

According to the understanding of the skilled person, the invention also claims the application of the transgenic plant obtained by the method for improving the drought resistance of the plant in plant breeding.

The breeding aim is to improve the drought resistance of plants. The PecircCDPK gene participates in the drought stress response of moso bamboo, and the expression of the gene can be induced by the drought stress.

In the applications provided by the invention, breeding methods include transgenics, crosses, backcrosses, selfs or asexual propagation.

The invention has the beneficial effects that:

the invention discloses the biological function of the PecircCDPK gene for the first time, by constructing a PecircCDPK gene expression vector, combining an agrobacterium-mediated genetic transformation method, heterologously transforming arabidopsis thaliana, investigating the influence of PecircCDPK on the drought resistance of transgenic arabidopsis thaliana and simultaneously detecting the response of PecircCDPK on the drought stress of moso bamboos, the invention provides a powerful tool for moso bamboo transgenic research and provides a valuable candidate gene for moso bamboo resistance molecule breeding.

Drawings

FIG. 1 is the electrophoresis (A) of PCR products for Gene verification of PecircCDPK, the electrophoresis (B) of PCR products of intron fragments screened by the addition of flanking intron fragments in the ring forming region of PecircCDPK and the Phyllostachys Pubescens PH02Gene31251 Gene, and the electrophoresis (C) of PCR products of plant expression vectors and enzyme digestion verification (C) of PecircCDPK; wherein, the lanes in A are amplified by using a divergent primer and a convergent primer respectively; lanes 1-2 in B are respectively a PecircCDPK cyclization region plus flanking intron fragment and an intron fragment screened by a Phyllostachys pubescens PH02Gene31251 Gene, and M1-M2 are DNA markers; lanes 1-2 in C are restriction products, M1-M2 are DNA markers.

FIG. 2 is a schematic diagram of a reverse complement-driven recombinant expression vector in which the flanking intron auxiliary loop-forming sequence is linked to a constructed vector, where 1031bp = flanking intron upstream (171 bp) + exon 1 (118 bp) + middle unspliced intron (439 bp) + exon 2 (166 bp) + flanking intron downstream (137 bp), in accordance with an embodiment of the present invention.

FIG. 3 shows the relative expression of PecircCDPK gene in the leaves of Phyllostachys Pubescens under different drought stresses in the examples of the present invention.

FIG. 4 shows the root length analysis of PecircCDPK transgenic Arabidopsis and wild Arabidopsis under different drought stresses in the examples of the present invention.

FIG. 5 shows the measurement of the water loss rate and the relative water content of leaf of PecircCDPK transgenic Arabidopsis and wild Arabidopsis in the examples of the present invention.

FIG. 6 is the test of the free proline content (A), malondialdehyde content (B), superoxide dismutase activity (C) and peroxidase activity (D) of PecircCDPK transgenic Arabidopsis and wild Arabidopsis under drought stress in the examples of the present invention.

FIG. 7 shows the expression level detection of relevant CDPK genes in PecircCDPK transgenic Arabidopsis thaliana and wild Arabidopsis thaliana in the examples of the present invention.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning Manual (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or the conditions as recommended by the manufacturer's instructions.

Example 1 obtaining the full Length of the PecircCDPK Gene

The moso bamboo material used in this example was from Guangxi Zhuang autonomous region, placed in a constant temperature light incubator with day and night temperature of 25 deg.C/18 deg.C and photoperiod of 16h/8h, cultured for about three months, and 20% PEG 6000 was used to simulate drought stress, and the treated leaves of the same parts of 0h, 6h, 12h, 24h and 48h were taken and rapidly frozen in liquid nitrogenAnd storing at-80 deg.C. Extracting total RNA of moso bamboo leaves under different drought stress treatments by using a Trizol method. Total RNA was treated with rRNA removal Kit (Ribo Zero rRNAnoval Kit), followed by addition of 20U. Mu.L ^-1 RNase R was incubated at 37 ℃ for 1h to eliminate linear RNA interference. The cleavage reagent was added and the first strand cDNA was synthesized with six base random primers. The synthesized first strand cDNA product is added with the two-strand synthesis reaction reagent in sequence, and then purified. The purified product was end-repaired, base "a" added and sequencing adaptors ligated. Fragment size screening was then performed and amplification was performed using a PCR instrument. Finally, the Illumina Hiseq was used for sequencing. Finally, the full-length sequence of the circular RNA SEQ ID NO.1 is obtained as follows.

gtcatccgtggatttgtgaccatggagttgctcctgatcggcctcttgatccagctgtcctttctcgcattaagcagttctcagcaatgaataagttgaagaagatggctttgcgagtaattgctgagagcctttcagaggaggagattgcaggactaaaggaaatgttcaaggcaatggacacagataacagcggtgcaattacatatgatgagctcaaagaaggcatgagaaaatatggttcaacactaaaggatacagaaattcgtgatcttatggaggcg。

Example 2 validation of PecircCDPK Gene

In this embodiment, the moso bamboo leaves are used as a material, the total RNA of the leaves is extracted according to the instruction of the Trizol RNA extraction kit (tiangen biochemical science and technology limited), and the total DNA of the leaves is extracted according to the CTAB method. Total RNA was treated with RNase R enzyme. Mu.g of total RNA was mixed with 2-3U RNase R (Gisase biosciences, 20U/. Mu.l) and incubated for 15min in a water bath at 37 ℃. 1ng of RNase R enzyme-treated RNA was reverse-transcribed into cDNA according to a reverse transcription kit (Takara). Designing divergent Primer and convergent Primer respectively as gDNA and cDNA (RNase R) by using Primer Premier 5 software according to moso genome database http:// bambooo ⁺ ) Pecircdpk was validated for the template.

A divergent upstream primer: 5'-TTCAAGGCAATGGACACAGA-3'

A divergent downstream primer: 5'-AGGAGCAACTCCATGGTCAC-3'

Converging an upstream primer: 5'-AGAGCCTTTCAGAGGAGGAGA-3'

A convergence downstream primer: 5'-CGCCTCCATAAGATCACGAA-3'

Polymerase chain reaction:

20 μ L reaction: 5 XPrimeSTAR GXL Buffer 4.0. Mu.L, 2.5mM dNTP Mix 1.6. Mu.L, upstream primer 1.0. Mu.L, downstream primer 1.0. Mu.L, cDNA/gDNA2.0. Mu.L, primeSTAR GXL DNA 0.2. Mu.L, ddH ₂ O 10.0μL。

PCR reaction procedure: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s; annealing at 55 ℃ for 30s; extension at 72 ℃ for 10s,30 cycles; storing at 4 ℃.

The recovered product is connected to a pGEM-T Easy vector, a Trans5 alpha competent cell is transformed, a positive clone is selected for carrying out plaque PCR detection, the positive clone is carried out sequencing (Shanghai Bioengineering Co., ltd.), and the sequencing result is accurate. The nucleotide sequence of PecircCDPK is verified to be shown in SEQ ID NO. 2.

Example 3 construction of plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

In this example, a plant overexpression vector pCAMBIAsuper1300-GFP was used as a basic vector, and a PecircCDPK overexpression vector was obtained by modification.

1. Cloning and ligation of upstream circular drive sequences

A DNA of a Phyllostachys pubescens Gene PH02Gene31251 is used as a template, a partial intron fragment with the length of 437bp (SEQ ID NO. 4) is selected as an upstream cyclization driving sequence (B in a figure 1). XbaI and KpnI double enzyme cutting site sequences are respectively introduced into two ends; connecting the amplified product to pGEM-T Easy vector (Promega company), transforming Trans5 alpha competent cells, and carrying out sequence determination; extracting plasmid, connecting the upstream intron fragment which is subjected to double enzyme digestion by XbaI and KpnI with pCAMBIAsuper1300-GFP, transforming, extracting plasmid, and carrying out sequence determination.

An upstream primer Up-2-F:5'-TCTAGACTCATCACCAAGGAGGACGTC-3' (SEQ ID No. 9);

a downstream primer Up-2-R:5'-GGTACCCTCAGCAGTCGGCAAAGCGA-3' (SEQ ID NO. 10).

(1) PCR reaction with moso bamboo leaf DNA as template

20 μ L reaction: 5 XPrimeSTARGXL Buffer 4.0. Mu.L, 2.5mM dNTP Mix 1.6. Mu.L, upstream primer 1.0. Mu.L, downstream primer 1.0. Mu.L, DNA template 2.0. Mu.L, primeSTAR GXL DNA 0.4. Mu.L, ddH ₂ O 10.0μL。

PCR reaction procedure: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s; annealing at 55 ℃ for 30s; extension at 72 ℃ for 26s for 30 cycles; storing at 4 deg.C.

(2) Amplification product recovery and ligation

The recovered fragment is connected to pGEM-T Easy vector, and the Trans5 alpha competent cell is transformed to carry out sequence determination, and the sequencing result is accurate.

(3) Construction of expression vector pCAMBIAsuper 1300-GFP-upstream cyclization drive sequence

pGEM-T Easy connected with an upstream cyclization driving sequence is double-digested by XbaI and KpnI, and the recombinant plasmid is constructed by the expression vector pCAMBIAsuper1300-GFP double-digested by XbaI and KpnI, wherein the digestion system is as follows (50 mu L):

enzyme digestion is carried out for 4h at 37 ℃; the product was subjected to agarose gel electrophoresis, and the plasmid pCAMBIAsuper1300-GFP large fragment and the upstream cyclization drive sequence small fragment were recovered using a gel recovery kit (Axygen). The two recovered products were ligated using T4DNA ligase in the following ligation reaction (20. Mu.L):

ligation was performed overnight at 4 ℃ and the ligation products were all transformed into Trans 5. Alpha. Competent cells. Overnight culture at 37 ℃, selecting single clone, carrying out colony PCR verification, carrying out amplification culture, extracting a plasmid pCAMBIAsuper 1300-GFP-upstream cyclization driving sequence, and carrying out sequencing and enzyme digestion verification.

2. Cloning and ligation of downstream circularization driver sequences

The downstream circularized drive sequence is the reverse complement of the upstream circularized drive sequence. BsrGI and EcoRI restriction site sequences are respectively introduced into two ends; connecting the amplified product to a pGEM-T Easy vector, transforming Trans5 alpha competent cells, and performing sequence determination; extracting plasmid, connecting BsrGI and EcoRI double-digested downstream intron fragment with pCAMBIAsuper1300-GFP containing upstream cyclization driving sequence, transforming, extracting plasmid, and sequencing.

An upstream primer Down-2-F:5'-GAATTCCTCATCACCAAGGAGGACGTC-3' (SEQ ID NO. 11);

downstream primer Down-2-R:5'-TGTACACTCAGCAGTCGGCAAAGCGA-3' (SEQ ID No. 12).

(1) PCR reaction with moso bamboo leaf DNA as template

20 μ L reaction: 5 XPrimeSTAR GXL Buffer 4.0. Mu.L, 2.5mM dNTP Mix 1.6. Mu.L, upstream primer 1.0. Mu.L, downstream primer 1.0. Mu.L, DNA template 2.0. Mu.L, primeSTAR GXL DNA 0.4. Mu.L, ddH ₂ O 10.0μL。

PCR reaction procedure: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 30s; annealing at 55 ℃ for 30s; extension at 72 ℃ for 26s,30 cycles; storing at 4 ℃.

(2) Amplification product recovery and ligation

The recovered fragment is connected to pGEM-T Easy vector, and the Trans5 alpha competent cell is transformed to carry out sequence determination, and the sequencing result is accurate.

(3) Construction of downstream circularization drive sequence and expression vector pCAMBIAsuper 1300-GFP-upstream circularization drive sequence

The BsrGI and EcoRI are used for double digestion of pGEM-T Easy connected with a downstream cyclization driving sequence and an expression vector pCAMBIAsuper 1300-GFP-upstream cyclization driving sequence subjected to double digestion of BsrGI and EcoRI to construct a recombinant plasmid, wherein the digestion system is as follows (50 mu L):

enzyme digestion is carried out for 4h at 37 ℃; the product was subjected to agarose gel electrophoresis, and the plasmid pCAMBIAsuper 1300-GFP-large upstream loop-forming driver sequence fragment and small downstream loop-forming driver sequence fragment were recovered using a gel recovery kit (Axygen). The two recovered products were ligated using T4DNA ligase in the following ligation reaction (20. Mu.L):

ligation was performed overnight at 4 ℃ and the ligation products were all transformed into Trans 5. Alpha. Competent cells. Overnight culture at 37 ℃, selecting single clone, carrying out amplification culture after colony PCR verification, extracting plasmid pCAMBIAsuper 1300-GFP-upstream and downstream cyclization drive sequences, and carrying out sequencing and enzyme digestion verification. The resulting vector plasmid was named pCAMBIAsuper1300-GFP-OE.

3. Recombination expression vector with reverse complementary drive connected with flanking intron auxiliary loop sequence

In order to ensure that the target loop forming sequence can be accurately looped through a reverse splicing mode, a flanking intron sequence with two ends not less than 100bp of the target sequence is cloned simultaneously in a PCR process. The DNA of the Phyllostachys pubescens Gene PH02Gene31251 is used as a template, a PecircCDPK loop region plus a flanking intron (upstream 171bp, downstream 137 bp) sequence is cloned, and the construction schematic diagram of the recombinant expression vector is shown in figure 2. Introducing KpnI and BsrGI enzyme cutting site sequences at two ends respectively; connecting and transforming the plant expression vector with pCAMBIAsuper1300-GFP-PecircCDPK containing an upstream and downstream cyclization driving sequence by a homologous recombination method, extracting a plasmid, performing sequence determination, and completing the construction of a plant expression vector pCAMBIAsuper 1300-GFP-PecircCDPK.

An upstream primer circCDPK-2-F:5'-GGTACCTTCCCATGTAGAACTTCCTTG-3' (SEQ ID NO. 13);

the downstream primer circCDPK-2-R:5'-TGTACACATGTGCAAGAAACCAGTTG-3' (SEQ ID NO. 14).

The desired fragment was recovered using a gel recovery kit (Axygen). Ligation was performed according to the standard procedure of the one-step cloning kit (Nanjing Novozam) in the following (20. Mu.L):

the reaction was carried out in a water bath at 37 ℃ for 30min, and the ligation products were all transformed into Trans 5. Alpha. Competent cells. Overnight culture at 37 ℃, selecting single clone, performing colony PCR verification, performing amplification culture, extracting plasmid pCAMBIAsuper1300-GFP-PecircCDPK, and performing sequencing and enzyme digestion verification (figure 1).

Example 4 transformation of Arabidopsis thaliana with plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

The embodiment provides a method for transforming arabidopsis thaliana by using a plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK, which comprises the following specific steps:

(1) Freeze-thawing method for transforming agrobacterium GV3101 strain

Adding 1ng of recombinant expression vector plasmid into 100 mu L of competent cells GV3101, carrying out ice bath for 10min, then quickly freezing the competent cells in liquid nitrogen for 5min, quickly transferring the competent cells into a 37 ℃ constant-temperature water bath kettle for 5min, then placing the competent cells on ice for 5min, adding 600 mu L of LB liquid culture medium into a centrifugal tube, carrying out shake culture in a 28 ℃ shaking table for 2-3h, and recovering the thalli. 60 μ L of the suspension was applied to YEP solid medium containing Kan-resistant (50 mg/Ml) and Rif-resistant (50 mg/mL) and plated upside down on a shaker at 28 ℃ for about 2-3 days until white colonies grew. After monoclonal colony PCR detection, selecting positive clone shake bacteria for culture.

(2) Arabidopsis inflorescence dip-dyeing

The above-mentioned positive clones were inoculated into 10mL of YEP (50. Mu.g/mL rifampicin + 100. Mu.g/mL kanamycin) liquid medium, shake-cultured at 28 ℃ for 12 hours in an incubator (160 rpm), 2mL of the culture was transferred to 200mL of YEP (50. Mu.g/mL rifampicin + 100. Mu.g/mL kanamycin) and subjected to mass culture, shake-cultured at 28 ℃ for 12 hours in an incubator (160 rpm), and the OD of the culture concentration was OD ₆₀₀ To 1.8-2.2. Mu.g/mL, 50mL of the culture was centrifuged at 5000rpm for 5min at 4 ℃ in a 50mL centrifuge tube, vigorously suspended in a transformation medium (MS 2.2g,5% sucrose, pH adjusted to 5.8, mixed with 0.2% Silwet L-77) and the pellet was diluted to 1.0. Mu.g/mL. Approximately 200mL of the DNA was prepared for dip-staining Arabidopsis thaliana. Soaking the overground part of the arabidopsis thaliana which just blooms in the transformation liquid for 3min, wrapping the plant with a preservative film, removing the preservative film after dark culture for 12-16h, placing the plant in an incubator for culture, and waiting for seed harvesting.

(3) Screening of homozygotes

The T0 generation Arabidopsis seeds are placed in a centrifuge tube, 1mL of 70% alcohol is added for sterilization for 5min, then 1mL of 2.6% sodium hypochlorite solution is used for sterilization for 10min, and then the seeds are washed for 5 times by using sterile water. Uniformly sowing seeds on a screening culture medium 1/2MS +50mg/L hygromycin, purifying at 4 ℃ for 2 days, then placing the seeds in a climatic incubator to grow 4 cotyledons, transplanting green and normally-grown positive plants into soil for cultivation, collecting T1 generation seeds by dividing single plants after maturation, screening T1 generation seedlings by the same method, counting the proportion of positive plants and non-positive plants of each strain of the T1 generation, and transplanting the positive plants of the strain with the proportion of 3:1 into the soil for cultivation to obtain the T2 generation seeds. The T2 generation seedlings are screened by the same method to obtain T3 generation seeds.

(4) PCR identification of positive plants

Extracting positive Arabidopsis thaliana leaf RNA, performing RNase R enzyme treatment on the total RNA, performing reverse transcription to synthesize cDNA, and performing PCR identification by using a divergent primer PecircCDPK-F, pecircCDPK-R. The positive plants are all found to contain PecircCDPK, which shows that PecircCDPK is successfully transferred into Arabidopsis.

Example 5 PecircCDPK Gene expression analysis under drought stress

This example provides an analysis of the PecircCDPK gene expression under drought stress, comprising the following steps:

(1) Material treatment

The moso bamboo seeds are collected in the autonomous region of Guangxi Zhuang, placed in a constant-temperature illumination incubator, the day and night temperature is 25 ℃/18 ℃, the photoperiod is 16h/8 h/dark, the moso bamboo seeds are cultured for about three months, 20 percent PEG 6000 is used for simulating drought stress, and the treated leaves at the same positions of 0h (P1), 6h (P2), 12h (P3), 24h (P4) and 48h (P5) are respectively taken and rapidly frozen in liquid nitrogen and are frozen and preserved at-80 ℃.

(2) Synthesis of cDNA template

Extracting total RNA from Phyllostachys pubescens leaves with Trizol Reagent, removing linear RNA with RNase R enzyme, and measuring A with ultraviolet spectrophotometer ₂₆₀ And A ₂₈₀ And RNA concentration. The first strand of cDNA was synthesized by a reverse transcription kit of Takara, and the synthesized product was stored in a refrigerator at-20 ℃.

(3) Real-time fluorescent quantitative PCR

And detecting the expression condition of the target gene by real-time fluorescent quantitative PCR (qRT-PCR). UBQ gene as reference gene, UBQ-F:5'-AATAGCTGTCCCTGGAGGAGTTT-3' (SEQ ID NO. 15), UBQ-R:5'-TCTTGTTTGACACCGAAGAGGAG-3'; (SEQ ID NO. 16);

PecircCDPK-F:5'-TTCAAGGCAATGGACACAGA-3'，PecircCDPK-R:5'-AGGAGCAACTCCATGGTCAC-3'。

the 10 μ L reaction was as follows:

reaction procedure: 30s at 95 ℃;95 ℃ 15s,60 ℃ 60s,40 cycles.

Other reaction parameters are system default settings, 3 biological replicates are set for each reaction, and Roche is used

480 Analyzer data, utilize 2 ^-ΔΔCT Methodological analysis the data from 3 biological experiments were plotted using Excel.

(4) Results and analysis of the experiments

The expression pattern of the pecircdpk gene was analyzed by real-time quantitative PCR experiments, and the results showed that pecircdpk exhibited down-regulated expression in leaves under drought stress (fig. 3).

Example 6 PecircCDPK Gene transfer Arabidopsis thaliana drought resistance analysis

The embodiment provides drought resistance analysis of transgenic PecircCDPK arabidopsis thaliana, which comprises the following specific steps:

under drought treatments of different concentrations, root length changes of transgenic and wild-type plants were observed. WT and transgenic overexpressing plants were grown substantially uniformly on 1/2MS medium supplemented with 0% PEG, and the number of roots was relatively small, indicating that a small fraction of long roots was sufficient for water uptake by the plants. At 4% PEG treatment, it was observed that the total heel length of the over-expressed lines 1 and 3 was greater than WT, and the WT root length was significantly shorter. Most of the plants in OE-1 and OE-2 were found to have root lengths greater than WT while those in OE-3 plants were found to have root lengths greater than WT and WT root lengths became shorter with 8% high concentrations of PEG. In terms of root number, transgenic plants were observed to have a greater number of roots than WT both at 6% and 8% PEG treatment (figure 4).

Selecting transgenic and WT strains growing to 3-4 weeks, selecting 3 strains from each strain as a sample, respectively shearing leaves with similar growth vigor, placing the leaves in a culture dish, and weighing and recording at different time points. The water loss rate of the blade as a whole gradually increases with time. The water loss rate of the transgenic plants at each time point was lower than WT during the first 360 min. And the water content of the transgenic line is improved and is obviously higher than that of the WT (figure 5) by measuring the relative water content of the leaves.

And (3) testing the free proline content and the antioxidant enzyme activity of the transgenes and the wild arabidopsis thaliana under drought stress. Under normal growth conditions, the content of free proline (Pro content), the content of malondialdehyde (MIDA content), the activity of superoxide dismutase (SOD activity) and the activity of peroxidase (POD activity) of wild type arabidopsis thaliana and transgenic arabidopsis thaliana have no obvious difference.

After drought treatment, the content of free proline in transgenic arabidopsis thaliana and wild arabidopsis thaliana is obviously increased, the increasing amplitude of the content of free proline in transgenic lines OE-1 and OE-2 is respectively 17.2 times and 17.1 times larger than that of wild CK (10.6 times), and the content of free proline in transgenic lines OE-1 and OE-2 after treatment is obviously higher than that of the wild CK; the malondialdehyde content of the transgenic arabidopsis thaliana and that of the wild arabidopsis thaliana are both increased remarkably, but the increase amplitude of the transgenic arabidopsis thaliana is small, and the transgenic arabidopsis thaliana is 2.22 times (OE-1), 2.23 times (OE-2) and 2.74 times (CK) of that before treatment respectively; meanwhile, the malondialdehyde content of wild arabidopsis thaliana is higher than that of the transgenic arabidopsis thaliana, and the difference reaches a significant level. The activities of transgenic and wild arabidopsis thaliana superoxide dismutase and peroxidase are obviously increased compared with those without drought stress, and the activity of transgenic arabidopsis thaliana leaf peroxidase is obviously higher than that of a wild type (figure 6).

To further explore whether the increase of drought resistance of transgenic arabidopsis thaliana is related to the gene of CDPK pathway in arabidopsis thaliana. The expression level of the arabidopsis thaliana gene AtCDPK13 with the highest homology with the parent gene of PecircCDPK is detected by adopting an RT-qPCR technology. The results show that the expression level of AtCDPK13 gene is improved in the transgenic line compared with WT. And the expression level of AtCDPK13 gene in OE-1 and OE-2 is significantly higher than that of WT (FIG. 7).

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims (10)

1. The PecircCDPK gene related to drought resistance is characterized in that the nucleotide sequence of the PecircCDPK gene is shown in SEQ ID NO. 1.

2. Biomaterial containing the pecircdpk gene according to claim 1, characterized in that it is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineered bacterium or a non-regenerable plant part.

3. Use of the pecircdpk gene according to claim 1 or the biomaterial according to claim 2 for the realization of any one or more of:

1) Regulating and controlling the drought resistance of the plant;

2) Preparing drought-resistant plants;

3) Preparing the plant drought resistance regulating and controlling substance.

4. Use according to claim 3, wherein transgenic plants are produced using the PecircCDPK gene or the biological material.

5. The use of claim 4, wherein the plant comprises Arabidopsis thaliana, phyllostachys pubescens.

6. A method of increasing drought resistance in a plant comprising: overexpression of PecircCDPK gene in plants by using genetic engineering means; preferably, the plant comprises arabidopsis thaliana, phyllostachys pubescens.

7. The method of claim 6, wherein the overexpression is selected from the following 1) to 5), or 1) to 5) optionally in combination:

1) By introducing a plasmid having the gene;

2) By increasing the copy number of the gene on the plant chromosome;

3) By altering the promoter sequence of said gene on the plant chromosome;

4) By operably linking a strong promoter to the gene;

5) By introducing an enhancer.

8. The method of claim 7, wherein the PecircCDPK gene is transferred into Arabidopsis plants by Agrobacterium mediated transformation to obtain transgenic Arabidopsis plants over-expressed by the PecircCDPK gene;

preferably, the PecircCDPK gene is constructed on a plant expression vector pCAMBIAsup er1300-GFP to transform agrobacterium, then an arabidopsis inflorescence is impregnated, and a transgenic arabidopsis plant is screened.

9. Use of a transgenic plant obtained by the method of any one of claims 6 to 7 in plant breeding.

10. Use according to claim 9, characterized in that the breeding method comprises transgenesis, crossing, backcrossing, selfing or asexual propagation.

Images