CN115869398A - anti-GARP antibodies - Google Patents

anti-GARP antibodies Download PDF

Info

Publication number
CN115869398A
CN115869398A CN202211442176.3A CN202211442176A CN115869398A CN 115869398 A CN115869398 A CN 115869398A CN 202211442176 A CN202211442176 A CN 202211442176A CN 115869398 A CN115869398 A CN 115869398A
Authority
CN
China
Prior art keywords
amino acid
seq
acid sequence
antibody
positions
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211442176.3A
Other languages
Chinese (zh)
Inventor
佐藤一纪
平原一树
渡边一郎
天野正人
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Daiichi Sankyo Co Ltd
Original Assignee
Daiichi Sankyo Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Daiichi Sankyo Co Ltd filed Critical Daiichi Sankyo Co Ltd
Publication of CN115869398A publication Critical patent/CN115869398A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/02—Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C12N5/12—Fused cells, e.g. hybridomas
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51—Complete heavy chain or Fd fragment, i.e. VH + CH1
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515—Complete light chain, i.e. VL + CL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567—Framework region [FR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present invention relates to anti-GARP antibodies. The present invention relates to antibodies that bind to GARP and are useful as therapeutic agents for tumors, and methods for treating tumors using the same. The present invention aims to provide an antibody which inhibits Treg function in tumors and is thus useful as a pharmaceutical product having a therapeutic effect, a method for treating tumors using the above antibody, and the like. An anti-GARP antibody that binds to GARP and exhibits an inhibitory activity on Treg function and exhibits ADCC activity is obtained, and a pharmaceutical composition for tumor therapy comprising the above antibody and the like is obtained.

Description

anti-GARP antibodies
The present application is a divisional application of an invention patent application entitled "anti-GARP antibody" having the international application number 201680056149.9, filed in china from international application PCT/JP2016/078067, 2016, 9, 23.
Technical Field
The present invention relates to antibodies that bind to GARP and are useful as therapeutic agents for tumors, and methods for treating tumors using the same.
Background
Regulatory T cells (tregs) are the major causative cells that induce immune tolerance, which is observed in tumor regions of cancer patients. That is, in cancer patients, immune cell populations that essentially act to kill tumors are made immunosuppressive by activated tregs in the tumors, and this leads to malignant progression of the tumors [ non-patent document 1].
A Glycoprotein a repeat dominant sequence (GARP) is a protein having a single transmembrane structure [ non-patent document 2], and this protein is expressed on the cell surface of activated tregs and forms a complex with latent TGF- β, which is a precursor of TGF- β that is an important molecule for inducing immune tolerance [ non-patent document 3].
TGF- β is matured from latent TGF- β and secreted from tregs by GARP on the cell surface of tregs due to intercellular interaction between tregs and target cells on which tregs induce immunosuppression, and immunosuppressive signals of TGF- β are directly transmitted to the target cells [ non-patent documents 4, 5]. It has been confirmed that membrane-bound GARP expressed on the cell surface is essential for such maturation of TGF-. Beta. [ non-patent document 5]. On the other hand, it has also been confirmed that soluble GARP lacking a transmembrane region suppresses proliferation of CD 4-positive T cells when it is directly added to a cell culture [ non-patent document 6]. Thus, immunosuppressive mechanisms of GARP that do not require TGF- β maturation on the cell membrane cannot be excluded.
GARPs are expressed not only by tregs in the peripheral blood when they become activated, but also by tumor-infiltrating T cells at the tumor site of cancer patients in the clinical setting [ non-patent document 7], by tregs present in ascites [ non-patent document 8], and by tregs circulating in the peripheral blood of cancer patients [ non-patent document 9 ].
In a report investigating the effect of inhibition of GARP expression on Treg function, sirnas targeting GARP inhibit the immunosuppressive function of Treg in the proliferative response of helper T cells, but such inhibitory effect is partial [ non-patent document 10].
In another report, anti-GARP antibodies (MHG-8 and LHG-10) which have been obtained for their ability to inhibit TGF- β maturation inhibit the suppressive function of the proliferative response of A1 cells to helper T cells [ patent document 1 and non-patent document 12], the A1 cells being Treg cell lines established by hemochromatosis patients [ non-patent document 11]. However, it is not known whether the above antibodies effectively exhibit such an inhibitory effect on tregs in a tumor microenvironment, and an anti-GARP antibody having such an effect has not been reported so far. An antibody recognizing both GARP and TGF- β is also known [ patent document 2].
It has been demonstrated that the over-presence and activation of tregs in patients with malaria and HIV infection show a correlation with disease status [ non-patent documents 13 and 14], and that the removal of tregs leads to remission of disease status in murine models of disease [ non-patent documents 15 and 16].
Reference list
Patent document
Patent document 1: WO2015/015003
Patent document 2: WO2016/125017
Non-patent literature
Non-patent documents: 1: int J cancer. 2010 Aug 15;127 (4): 759-67.
Non-patent literature: 2: PLoS one. 2008;3 (7): e2705.
non-patent documents: 3: proc Natl Acad Sci USA 2009;106 (32): 13445-50.
Non-patent documents: 4: eur J immunol. 2009;39 (12): 3315-22.
Non-patent documents: 5: mol Biol cell. 2012;23 (6): 1129-39.
Non-patent literature: 6: blood, 2013;122 (7): 1182-91.
Non-patent documents: 7: eur J immunol. 2012 Jul;42 (7): 1876-85.
Non-patent documents: 8: clin immunol. 2013 Oct;149 (1): 97-110.
Non-patent documents: 9: cancer Res.2013; 73:2435.
non-patent literature: 10: proc Natl Acad Sci USA, 2009 Aug 11;106 (32): 13445-50.
Non-patent documents: 11: eur J immunol. 2009;39 (12): 869-82.
Non-patent documents: 12: sci Transl Med. 2015 Apr 22;7 (284)
Non-patent documents: 13: PLoS one. 2008 Apr 30;3 (4): e2027.
non-patent documents: 14: clin Exp Immunol. 2014 Jun;176 (3): 401-9.
Non-patent literature: 15: j immunol. 2012 Jun 1;188 (11): 5467-77.
Non-patent documents: 16: PLoS pathog.2013; 9 (12): e1003798.
disclosure of Invention
Technical problem
The present invention aims to provide an antibody which inhibits Treg function in a tumor and is thus useful as a pharmaceutical product having a therapeutic effect, a method for treating a tumor using the above antibody, and the like.
Means for solving the problems
The present inventors have conducted intensive studies directed to achieving the above object. Accordingly, the inventors have found an antibody that specifically binds to GARP and exhibits an activity of inhibiting Treg function via antibody-dependent cytotoxicity, thereby completing the present invention. Specifically, the present invention includes the following inventive aspects.
(1) An antibody having the following properties:
(a) Specifically binds to glycoprotein a repeat dominant sequence (GARP);
(b) Has inhibitory activity on the immunosuppressive function of regulatory T cells;
(c) Has antibody-dependent cellular cytotoxicity (ADCC) activity; and
(d) Has antitumor activity in vivo.
(2) The antibody according to the above (1), wherein the GARP is a GARP consisting of SEQ ID NO:1, or a pharmaceutically acceptable salt thereof.
(3) The antibody according to the above (1) or (2), which binds to:
(a) SEQ ID NO:1 at amino acid positions 366 to 377, 407 to 445 and 456 to 470,
(b) The amino acid sequence of SEQ ID NO:1 at amino acid positions 54-112 and 366-392,
(c) SEQ ID NO:1 from amino acid position 352 to amino acid sequence portion shown in 1, or
(d) SEQ ID NO:1 from amino acid position 18 to 112.
(4) The antibody according to any one of the above (1) to (3), which has a competitive inhibitory activity against binding to GARP against an antibody having:
(a) Consisting of SEQ ID NO:2 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:3 in a sequence of amino acids shown in SEQ ID NO,
(b) Consisting of SEQ ID NO:4 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:5 in a sequence of amino acids shown in SEQ ID NO,
(c) Consisting of SEQ ID NO:25 and a light chain consisting of the amino acid sequence shown in SEQ ID NO:27, or of the amino acid sequence shown in
(d) Consisting of SEQ ID NO:29 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:31, or a light chain consisting of the amino acid sequence shown in seq id no.
(5) The antibody of any one of (1) to (4) above, wherein the tumor is cancer.
(6) The antibody according to the above (5), wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer or hematological cancer.
(7) The antibody according to any one of the above (1) to (6), which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:2, CDRH1 consisting of the amino acid sequence shown in amino acid positions 26 to 35 in SEQ ID NO:2 and a CDRH2 consisting of the amino acid sequence shown in SEQ ID NO:2, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 99 to 107 in SEQ ID NO:3, CDRL1 consisting of the amino acid sequence shown in amino acid positions 23 to 36 as set forth in SEQ ID NO:3 and CDRL2 consisting of the amino acid sequence shown in amino acid positions 52 to 58 in SEQ ID NO:3 from amino acid position 91 to 101 as shown in 3,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:4, CDRH1 consisting of the amino acid sequence shown in amino acid positions 26 to 35 in SEQ ID NO:4 and a CDRH2 consisting of the amino acid sequence shown in amino acid positions 50 to 66 in SEQ ID NO:4, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 99 to 112 in SEQ ID NO:5, CDRL1 consisting of the amino acid sequence shown in amino acid positions 23 to 36 as set forth in SEQ ID NO:5, and CDRL2 consisting of the amino acid sequence shown in amino acid positions 52 to 58 in SEQ ID NO:5 from amino acid position 91 to 100 as shown in,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:25, CDRH1 consisting of the amino acid sequence shown in amino acid positions 45 to 54 in SEQ ID NO:25 and CDRH2 consisting of the amino acid sequence shown in amino acid positions 69 to 78 and a CDRH sequence consisting of the amino acid sequence shown in SEQ ID NO:25, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 118 to 125 in SEQ ID NO:27, CDRL1 consisting of the amino acid sequence shown in amino acid positions 44 to 54 in SEQ ID NO:27, and CDRL2 consisting of the amino acid sequence shown in amino acid positions 70 to 76 shown in SEQ ID NO: CDRL3 consisting of the amino acid sequence shown in amino acid positions 109 to 117 in SEQ ID NO. 27, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:29, CDRH1 consisting of the amino acid sequence shown in amino acid positions 45 to 54 in SEQ ID NO:29 and a CDRH2 consisting of the amino acid sequence shown in amino acid positions 69 to 77 in SEQ ID NO:29, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 117 to 128 as set forth in SEQ ID NO:31, CDRL1 consisting of the amino acid sequence shown in amino acid positions 44 to 54 in SEQ ID NO:31 and CDRL2 consisting of the amino acid sequence shown in amino acid positions 70 to 76 as set forth in SEQ ID NO:31 from the amino acid sequence shown in amino acid positions 109 to 117.
(8) The antibody according to any one of the above (1) to (7), which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:2, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:3 from amino acid position 1 to 112,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:4, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:5 from amino acid positions 1 to 111,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:25, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:27 of the amino acid sequence at amino acid positions 21 to 129, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:29, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:31 from amino acid position 21 to 129.
(9) The antibody according to any one of (1) to (8) above, wherein the constant region is a human-derived constant region.
(10) The antibody according to any one of the above (1) to (9), which has:
(a) Consisting of SEQ ID NO:2 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:3 in a sequence of amino acids shown in SEQ ID NO,
(b) Consisting of SEQ ID NO:4 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:5 in a sequence of amino acids shown in SEQ ID NO,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:25, and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:27 of the amino acid sequence shown in amino acid positions 21 to 234, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:29, and a heavy chain consisting of the amino acid sequence shown in amino acid positions 20 to 469 in SEQ ID NO:31 from amino acid position 21 to 234.
(11) The antibody according to any one of the above (1) to (10), which is humanized.
(12) The antibody according to the above (11), which has:
a heavy chain variable region consisting of an amino acid sequence selected from the group consisting of:
(a) In SEQ ID NO:33 at amino acid positions 20 to 136,
(b) In SEQ ID NO:35 from amino acid position 20 to 136,
(c) In SEQ ID NO:41 from amino acid position 20 to 139,
(d) An amino acid sequence having at least 95% or more homology to the framework region sequence of the sequences of (a) to (c) except for each CDR sequence, and
(e) An amino acid sequence comprising deletion, substitution or addition of one or several amino acids in the framework region sequence other than each CDR sequence in the sequence of (a) to (c), and
a light chain variable region consisting of an amino acid sequence selected from the group consisting of:
(f) In SEQ ID NO:37 from amino acid position 21 to amino acid position 129,
(g) In SEQ ID NO:39 from amino acid position 21 to 129,
(h) In SEQ ID NO:43 from amino acid position 21 to 129,
(i) An amino acid sequence having at least 95% or more homology to the framework region sequence excluding each CDR sequence in the sequences of (f) to (h), and
(j) An amino acid sequence comprising a deletion, substitution or addition of one or several amino acids in the framework region sequences of the sequences of (f) to (h) except for each CDR sequence.
(13) The antibody according to the above (11) or (12), which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:33, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:37 from the amino acid sequence at amino acid positions 21 to 129,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:35, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:39 of the amino acid sequence at amino acid positions 21 to 129, or
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:41, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:43 from amino acid position 21 to 129.
(14) The antibody according to any one of the above (11) to (13), which has:
(a) A heavy chain selected from: has the sequence shown in SEQ ID NO:33, having the amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:35, and a light chain having an amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:41 of the amino acid sequence at amino acid positions 20 to 469, and
(b) A light chain selected from: has the sequence shown in SEQ ID NO:37, having an amino acid sequence at amino acid positions 21 to 234 as set forth in SEQ ID NO:39, and a light chain having an amino acid sequence at amino acid positions 21 to 234 as set forth in SEQ ID NO:43 from amino acid position 21 to amino acid position 234.
(15) The antibody according to any one of the above (11) to (14), which has:
(a) Has the sequence shown in SEQ ID NO:33, and the heavy chain of the amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:37 from amino acid position 21 to amino acid position 234,
(b) Has the sequence shown in SEQ ID NO:35, and the heavy chain of the amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:39 of the amino acid sequence at amino acid positions 21 to 234, or
(c) Has the sequence set forth in SEQ ID NO:41, and the heavy chain of the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:43 from amino acid position 21 to 234.
(16) A polynucleotide encoding an antibody according to any one of (1) to (15) above.
(17) The polynucleotide according to (16) above, which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:6 consisting of the nucleotide sequence shown in SEQ ID NO:6, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:6 and a polynucleotide of CDRH3 consisting of the nucleotide sequence shown in SEQ ID NO:7 consisting of the nucleotide sequence shown in SEQ ID NO:7 and a polynucleotide of CDRL2 consisting of the nucleotide sequence shown in SEQ ID NO:7 from nucleotide position 271 to 303,
(b) Encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:8 consisting of the nucleotide sequence shown in SEQ ID NO:8, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:8 and a polynucleotide of CDRH3 consisting of the nucleotide sequence shown in SEQ ID NO:9 consisting of the nucleotide sequence shown in SEQ ID NO:9 and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:9 consisting of the nucleotide sequence shown in nucleotide positions 271 to 300,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:24 consisting of the nucleotide sequence shown in SEQ ID NO:24 and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:24 and a polynucleotide of CDRH3 consisting of the nucleotide sequence shown in SEQ ID NO:26 consisting of the nucleotide sequence shown in SEQ ID NO:26, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:26 by a nucleotide sequence at nucleotide positions 325 to 351 as set forth in SEQ ID NO, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:28 consisting of the nucleotide sequence shown in SEQ ID NO:28, and a polynucleotide of CDRH2 consisting of the nucleotide sequence shown in SEQ ID NO:28, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:30 consisting of the nucleotide sequence shown in SEQ ID NO:30, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:30 from nucleotide position 325 to 351 as set forth in seq id no.
(18) The polynucleotide according to (16) or (17) above, which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:6, and a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:7 from nucleotide position 1 to 336,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:8, and a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:9 from nucleotide position 1 to 333,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:24, and a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:26 from nucleotide position 61 to 387, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:28, and a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:30 from nucleotide position 61 to 387.
(19) The polynucleotide according to any one of (16) to (18) above, which has:
(a) Consisting of SEQ ID NO:6, and a heavy chain consisting of the nucleotide sequence set forth in SEQ ID NO:7,
(b) Consisting of SEQ ID NO:8, and a heavy chain consisting of the nucleotide sequence set forth in SEQ ID NO:9, or a light chain polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO,
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:24, and a polynucleotide of a heavy chain consisting of the nucleotide sequence set forth in SEQ ID NO:26 from nucleotide position 61 to 702, or
(d) Consisting of the amino acid sequence set forth in SEQ ID NO:28, and a polynucleotide of the heavy chain consisting of the nucleotide sequence shown in SEQ ID NO:30 from nucleotide position 61 to 702.
(20) The polynucleotide according to (16) or (17) above, which has:
(a) A polynucleotide selected from the group consisting of the heavy chain variable region of: consisting of the amino acid sequence set forth in SEQ ID NO:32 consisting of the nucleotide sequence set forth in nucleotide positions 58 to 408 set forth in SEQ ID NO:34, and a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:40 from nucleotide position 58 to 417, and
(b) A polynucleotide selected from the group consisting of: consisting of the amino acid sequence set forth in SEQ ID NO:36 consisting of the nucleotide sequence at nucleotide positions 61 to 387 set forth in SEQ ID NO:38, and a polynucleotide comprising the light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 set forth in SEQ ID NO:42 from nucleotide position 61 to 387.
(21) The polynucleotide according to (16), (17) or (20) above, which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:32, and a polynucleotide comprising the heavy chain variable region consisting of the nucleotide sequence set forth in nucleotide positions 58 to 408 set forth in SEQ ID NO:36 from nucleotide position 61 to 387,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:34, and a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:38, or the nucleotide sequence at nucleotide positions 61 to 387, or
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:40, and a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:42 from nucleotide position 61 to 387.
(22) The polynucleotide according to (16), (17), (20) or (21) above, which has:
(a) A polynucleotide of a heavy chain selected from: consisting of the amino acid sequence set forth in SEQ ID NO:32 consisting of the nucleotide sequence at nucleotide positions 58 to 1398 set forth in SEQ ID NO:34, and a polynucleotide of a heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1398 set forth in SEQ ID NO:40 from nucleotide position 58 to nucleotide sequence at 1407, and
(b) A polynucleotide of a light chain selected from: consisting of the amino acid sequence set forth in SEQ ID NO:36 consisting of the nucleotide sequence shown in SEQ ID NO:38, and a polynucleotide of a light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 set forth in SEQ ID NO:42 from nucleotide position 61 to 702.
(23) The polynucleotide according to any one of the above (16), (17) and (20) to (22), which has:
(a) Consisting of the amino acid sequence set forth in SEQ ID NO:32, and a polynucleotide of a heavy chain consisting of the nucleotide sequence set forth in SEQ ID NO:36 from nucleotide position 61 to 702,
(b) Consisting of the amino acid sequence set forth in SEQ ID NO:34, and a polynucleotide of a heavy chain consisting of the nucleotide sequence set forth in SEQ ID NO:38 from the nucleotide sequence shown in nucleotide positions 61 to 702, or
(c) Consisting of the amino acid sequence set forth in SEQ ID NO:40 to nucleotide sequence at nucleotide positions 58 to 1407 as set forth in SEQ ID NO:42 from nucleotide position 61 to 702.
(24) An expression vector comprising the polynucleotide according to any one of (16) to (23) above.
(25) A host cell transformed with the expression vector according to (24) above.
(26) A method for producing an antibody of interest or a fragment thereof, which comprises the step of culturing the host cell according to the above (25), and the step of collecting the antibody of interest from the culture obtained by the aforementioned step.
(27) An antibody obtained by the production method according to the above (26).
(28) The antibody according to any one of the above (1) to (15) and (27), which comprises two or more modifications selected from the group consisting of: n-linked glycosylation, O-linked glycosylation, N-terminal processing, C-terminal processing, deamidation, isomerization of aspartic acid, oxidation of methionine, addition of methionine residues to the N-terminus, amidation of proline residues, and heavy chains comprising a deletion of one or two amino acids at the carboxy terminus.
(29) The antibody according to the above (28), wherein one or two amino acids are deleted at the carboxy terminus of the heavy chain thereof.
(30) The antibody according to the above (29), wherein one amino acid is deleted at each carboxy terminus of both heavy chains thereof.
(31) The antibody according to any one of the above (28) to (30), wherein the proline residue at the carboxy terminus of its heavy chain is further amidated.
(32) The antibody according to any one of the above (1) to (15) and (27) to (31), wherein the sugar chain modification is adjusted so as to enhance antibody-dependent cytotoxicity.
(33) A pharmaceutical composition comprising at least one of the antibodies according to the above (1) to (15) and (27) to (32).
(34) The pharmaceutical composition according to the above (33), which is used in tumor treatment.
(35) The pharmaceutical composition according to the above (34), wherein the tumor is cancer.
(36) The pharmaceutical composition according to the above (35), wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer or hematological cancer.
(37) A method for treating a tumor, comprising administering to an individual at least one of the antibodies according to (1) to (15) and (27) to (32) above.
(38) The method of treatment according to (37) above, wherein the tumor is cancer.
(39) The method of treatment according to (38) above, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer or hematological cancer.
Advantageous effects of the invention
According to the present invention, a therapeutic agent for cancer comprising an antibody that binds to GARP and has an antitumor activity caused by ADCC-mediated Treg inhibition can be obtained. In addition, the over-presence and activation of tregs in patients with malaria and HIV infection shows a correlation with the disease state, and the removal of tregs induces remission of the disease state in murine models of the disease. Accordingly, it is expected that effective inhibition of Treg function will also have a therapeutic effect on refractory infectious diseases such as those caused by malaria and HIV.
Drawings
FIG. 1 shows the amino acid sequence of GARP (SEQ ID NO: 1).
FIG. 2 the amino acid sequence of the heavy chain of the 105F antibody is shown in FIG. 2 (SEQ ID NO: 2).
FIG. 3 the amino acid sequence of the 105F antibody light chain is shown in FIG. 3 (SEQ ID NO: 3).
FIG. 4 the amino acid sequence of the heavy chain of the 110F antibody is shown in FIG. 4 (SEQ ID NO: 4).
FIG. 5 the amino acid sequence of the light chain of the 110F antibody is shown in FIG. 5 (SEQ ID NO: 5).
FIG. 6 shows the nucleotide sequence of the heavy chain of the 105F antibody (SEQ ID NO: 6) in FIG. 6.
FIG. 7 the nucleotide sequence of the 105F antibody light chain is shown in FIG. 7 (SEQ ID NO: 7).
FIG. 8 the nucleotide sequence of the heavy chain of the 110F antibody is shown in FIG. 8 (SEQ ID NO: 8).
FIG. 9 the nucleotide sequence of the light chain of the 110F antibody is shown in FIG. 9 (SEQ ID NO: 9).
FIG. 10 shows the binding of antibodies to GARP. According to the ELISA method, the 105F antibody and the 110F antibody showed binding to GARP.
FIG. 11 specific binding of antibodies to GARP is shown in FIG. 11. The 105F antibody did not bind to HEK293T cells into which the empty vector was introduced and showed binding to HEK293T cells in which GARP had been transiently expressed.
FIG. 12 specific binding of antibodies to GARP is shown in FIG. 12. The 105F antibody showed binding activity to L428 cells endogenously expressing GARP.
FIG. 13 specific binding of antibodies to GARP is shown in FIG. 13. The 105F antibody showed binding activity to activated tregs.
FIG. 14 is a graph showing ADCC activity of an antibody. When targeting L428 cells endogenously expressing GARP, an increase in ADCC activity was found in a 105F antibody concentration-dependent manner.
Figure 15 shows the inhibitory activity of antibodies on Treg function. The 105F antibody (50 μ g/mL) inhibited the proliferation-suppressing function of tregs against helper T cells.
Figure 16 shows the inhibitory activity of antibodies on Treg function. The 105F antibody (10 μ g/mL) inhibited the proliferation-suppressing function of tregs against helper T cells. On the other hand, antibodies to MHG-8 and LHG-10 did not show an effect on the proliferation-suppressing function of Tregs against helper T cells.
FIG. 17 the amino acid sequence of the heavy chain of the c151D antibody is shown in FIG. 17 (SEQ ID NO: 25).
FIG. 18 shows the amino acid sequence (SEQ ID NO: 27) of the light chain of the c151D antibody in FIG. 18.
FIG. 19 the amino acid sequence of the heavy chain of the c198D antibody is shown in FIG. 19 (SEQ ID NO: 29).
FIG. 20 the amino acid sequence of the light chain of the c198D antibody is shown in FIG. 20 (SEQ ID NO: 31).
FIG. 21 the amino acid sequence of the H151D-H1 heavy chain is shown in FIG. 21 (SEQ ID NO: 33).
FIG. 22 shows the amino acid sequence of the h151D-L1 light chain (SEQ ID NO: 37).
FIG. 23 shows the amino acid sequence of the H151D-H4 heavy chain (SEQ ID NO: 35).
FIG. 24 shows the amino acid sequence of the h151D-L4 light chain (SEQ ID NO: 39) in FIG. 24.
FIG. 25 the amino acid sequence of the H198D-H3 heavy chain is shown in FIG. 25 (SEQ ID NO: 41).
FIG. 26 the amino acid sequence of h198D-L4 light chain is shown in FIG. 26 (SEQ ID NO: 43).
FIG. 27 shows the nucleotide sequence of the heavy chain of the c151D antibody (SEQ ID NO: 24).
FIG. 28 shows the nucleotide sequence of the light chain of the c151D antibody (SEQ ID NO: 26).
FIG. 29 the nucleotide sequence of the heavy chain of the c198D antibody is shown in FIG. 29 (SEQ ID NO: 28).
FIG. 30 the nucleotide sequence of the light chain of the c198D antibody is shown in FIG. 30 (SEQ ID NO: 30).
FIG. 31 shows the nucleotide sequence of the H151D-H1 antibody heavy chain (SEQ ID NO: 32).
FIG. 32 shows the nucleotide sequence of the h151D-L1 antibody heavy chain (SEQ ID NO: 36).
FIG. 33 shows the nucleotide sequence of the H151D-H4 heavy chain (SEQ ID NO: 34) in FIG. 33.
FIG. 34 shows the nucleotide sequence of the h151D-L4 light chain (SEQ ID NO: 38).
FIG. 35 the nucleotide sequence of the H198D-H3 heavy chain is shown in FIG. 35 (SEQ ID NO: 40).
FIG. 36 shows the nucleotide sequence of h198D-L4 light chain (SEQ ID NO: 42) in FIG. 36.
FIG. 37 the binding activity of each antibody to GARP-expressing cells is shown in FIG. 37. H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed specific binding activity to GARP.
FIG. 38 shows the binding activity of each antibody to GARP-TGF-beta 1 co-expressing cells. The individual antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 bind to both GARP and to GARP mutants which are co-expressed with TGF β 1, and these antibodies show binding activity to different regions in GARP, according to the knowledge of the antibodies MHG8 and LHG 10.
FIG. 39 shows the binding activity of each antibody to L428 cells. The individual antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 show binding activity to endogenously expressed GARP.
Figure 40 shows the binding activity of each antibody to tregs. The individual antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed binding activity to FoxP 3-positive Tregs.
FIG. 41 ADCC activity of each antibody is shown in FIG. 41. The individual antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed ADCC activity.
Fig. 42 shows the inhibitory activity of each antibody on Treg function. The individual antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed inhibitory activity on Treg function.
FIG. 43 shows the suppressive activity of Tregs on the target cell lytic activity of CTLs.
FIG. 44 shows an increase in the antitumor activity of each antibody. The individual antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 inhibit the suppressive function of Tregs on the cytolytic activity of CTLs.
FIG. 45 in vivo antitumor activity of each antibody is shown in FIG. 45. The individual antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed anti-tumor activity in an in vivo model.
Detailed Description
In the present specification, the term "cancer" is used to have the same meaning as that of the term "tumor".
In the present specification, the term "gene" is used to include not only DNA but also mRNA and cDNA thereof and cRNA thereof.
In the present specification, the term "polynucleotide" is used to have the same meaning as that of nucleic acid, and it includes DNA, RNA, probes, oligonucleotides, and primers.
In the present specification, the term "polypeptide" is used such that it is indistinguishable from the term "protein".
In the present specification, the term "cell" includes cells in individual animals and cells in culture.
In this specification, the term "GARP" is used to have the same meaning as that of a GARP protein.
In the present specification, the term "cytotoxicity" is used to mean the pathological changes caused to a cell in any given way. This means not only direct trauma but also all types of structural or functional damage to the cell, such as DNA cleavage, formation of base dimers, chromosome cleavage, damage to the mitogen of the cell, and reduction in the activity of various types of enzymes.
In the present specification, the term "cytotoxic activity" is used to mean an activity that causes the above-mentioned cytotoxicity.
In the present specification, the term "antibody-dependent cellular cytotoxicity" is used to mean "antibody-dependent cellular cytotoxicity (ADCC) activity", and this activity means an effect or activity of damaging a target cell such as a tumor cell via NK cells mediated by an antibody.
In the present specification, the term "epitope" is used to mean a partial peptide or partial three-dimensional structure of GARP to which a specific anti-GARP antibody binds. Such epitopes, which are partial peptides of GARP as described above, can be determined by methods well known to those skilled in the art, such as immunoassays, for example, by the methods described below. First, various partial structures of the antigen are generated. For generating such partial structures, known oligopeptide synthesis techniques may be applied. For example, a series of peptides in which the antigen has been truncated successively from its C-terminus or N-terminus by an appropriate length is produced by genetic recombination techniques well known to those skilled in the art, and thereafter, the reactivity of the antibody to such a polypeptide is investigated, and the recognition site is roughly determined. Thereafter, further shorter peptides were synthesized and then their reactivity with the above peptides was investigated in order to determine the epitope. Further, an epitope which is a partial three-dimensional structure of an antigen bound to a specific antibody can be determined by specifying amino acid residues of the antigen adjacent to the above-mentioned antibody through X-ray structural analysis.
In the present specification, the phrase "antibodies that bind to the same epitope" is used to mean different antibodies that bind to the same epitope. If the second antibody binds to a portion of the peptide or a portion of the three-dimensional structure to which the first antibody binds, it can be determined that the first and second antibodies bind to the same epitope. In addition, by confirming that the second antibody competes with the first antibody for binding of the first antibody to the antigen (i.e., the second antibody interferes with the binding of the first antibody to the antigen), it can be determined that the first and second antibodies bind to the same epitope, even if the specific sequence or structure of the epitope is not yet determined. In addition, when the first antibody and the second antibody bind to the same epitope and the first antibody has a specific effect such as an antitumor activity, the second antibody can be expected to have the same activity as that of the first antibody. Accordingly, if the second anti-GARP antibody binds to a portion of the peptide to which the first anti-GARP antibody binds, it can be determined that the first and second antibodies bind to the same epitope of GARP. In addition, the first and second antibodies can be determined to be antibodies that bind to the same epitope of GARP by confirming that the second anti-GARP antibody competes with the first anti-GARP antibody for binding of the first anti-GARP antibody to GARP.
In the present specification, the term "CDR" is used to mean the complementarity determining region. It is known that the heavy and light chains of antibody molecules each have three CDRs. Such CDRs are also known as hypervariable domains and are located in the variable regions of the heavy and light chains of antibodies. These regions have a particularly highly variable primary structure and are divided into three sites on the primary structure of the polypeptide chains of each of the heavy and light chains. In the present specification, as for the CDRs of an antibody, the CDRs of a heavy chain are referred to as CDRH1, CDRH2, and CDRH3, respectively, from the amino terminal side of the amino acid sequence of the heavy chain, and the CDRs of a light chain are referred to as CDRL1, CDRL2, and CDRL3, respectively, from the amino terminal side of the amino acid sequence of the light chain. These sites are located close to each other in three-dimensional structure and determine the specificity of an antibody for the antigen to which it binds.
In the present invention, the phrase "Hybridization under stringent conditions" is used to mean that Hybridization is carried out at 68 ℃ in a commercially available Hybridization Solution ExpressHyb Hybridization Solution (manufactured by Clontech), or under conditions in which Hybridization is carried out at 68 ℃ in the presence of 0.7-1.0M NaCl using a DNA immobilized filter, and the resultant is then washed with a 0.1-to 2-fold concentration of SSC Solution (wherein 1 XSSC consists of 150mM NaCl and 15mM sodium citrate) at 68 ℃ for identification, or equivalent thereto.
1. GARP
The GARP used in the present invention may be directly purified from GARP-expressing cells of human or non-human mammals (e.g., rat, mouse, etc.) and then may be used, or cell membrane fractions of the aforementioned cells may be prepared and may be used as the GARP. Alternatively, GARP can also be obtained by synthesizing GARP in vitro, or by allowing host cells to produce GARP via genetic manipulation. According to such genetic manipulation, in particular, the GARP protein can be obtained by: GARP cDNA is incorporated into an expression vector capable of expressing GARP cDNA, and GARP is synthesized, or other prokaryotic or eukaryotic host cells are transformed, in a solution containing enzymes, substrates, and energy materials necessary for transcription and translation, to allow for its expression.
The amino acid sequence of human GARP is shown in SEQ ID NO:1 in (c). In addition, SEQ ID NO:1 is shown in figure 1.
In addition, a protein consisting of an amino acid sequence containing substitution, deletion and/or addition of one or several amino acids in the above-mentioned amino acid sequence of GARP and having biological activity equivalent to that of GARP protein is also included in GARP.
The mature human GARP from which the signal sequence has been removed corresponds to the sequence defined by SEQ ID NO:1 from position 20 to 662 of the amino acid sequence set forth in seq id no.
Also included in GARP are proteins consisting of a protein comprising SEQ ID NO:1, or SEQ ID NO:1, and has a biological activity equivalent to that of GARP. Also included in GARP are proteins consisting of an amino acid sequence encoded by a splice variant transcribed from the human GARP locus or comprising substitution, deletion and/or addition of one or several amino acids in the above amino acid sequence and having biological activity equivalent to that of GARP.
2. Production of anti-GARP antibodies
An example of an anti-GARP antibody of the invention can be an anti-GARP human antibody. An anti-GARP human antibody means a human antibody having only the gene sequences of an antibody derived from a human chromosome.
anti-GARP human antibodies can be obtained by methods for producing mice using human antibodies having human chromosomal fragments that contain the heavy and light chain genes of the human antibody (see Tomizuka, K. Et al Nature Genetics (1997) 16, pp. 133-143; kuroiwa, Y. Et al Nucl. Acids Res. (1998) 26, pp. 3447-3448; yoshida, H. Et al Animal Cell Technology: basic and Applied Aspects, vol. 10, pp. 69-73 (Kitagawa, Y., matsuda, T. And Iijima, S. Ed.), kluwer Academic Publishers,1999 Tomizuka, K. Et al Proc. Natl. Acad. Sci. USA (2000) 97, pp. 722-727, etc.).
Such human antibody-producing mice can be specifically produced by using genetically modified animals whose endogenous immunoglobulin heavy and light chain loci have been disrupted, and instead, the human immunoglobulin heavy and light chain loci have then been introduced using Yeast Artificial Chromosome (YAC) vectors and the like, and then producing knockout animals and transgenic animals from such genetically modified animals, which are then mated with each other.
Alternatively, an anti-GARP human antibody can be obtained by: according to the genetic recombination technique, a eukaryotic cell is transformed with a cDNA encoding each of the heavy and light chains of such a human antibody, or preferably with a vector containing the cDNA, and then the transformed cell producing the genetically modified human monoclonal antibody is cultured, so that the antibody can be obtained from the culture supernatant. As the host cell, for example, a eukaryotic cell, and preferably a mammalian cell, such as a CHO cell, a lymphocyte, or a myeloma cell, can be used.
Alternatively, antibodies can also be obtained by methods for obtaining phage display-derived human antibodies that have been selected from a library of human antibodies (see Wormstone, I. M. Et al Investigative science & Visual science (2002) 43 (7), pp. 2301-2308; carmen, S. Et al Briefins in Functional Genomics and Proteomics (2002), 1 (2), pp. 189-203; siriwardena, D. Et al Ophthalgenomics (2002) 109 (3), pp. 427-431, etc.). For example, a phage display method can be applied, which comprises allowing the variable region of a human antibody to be expressed as a single chain antibody (scFv) on the surface of a phage, and then selecting a phage that binds to an antigen (Nature Biotechnology (2005), 23, (9), pages 1105-1116).
By analyzing the phage genes that have been selected for their ability to bind to an antigen, the DNA sequence encoding the variable region of a human antibody that binds to the antigen can be determined. Once the DNA sequence of scFv that binds to the antigen is determined, the DNA sequence of the antibody constant region is allowed to bind thereto to produce an IgG expression vector having the above sequence, and then the produced expression vector is introduced into a suitable host cell and allowed to be expressed therein, thereby obtaining a human antibody (WO 92/01047, WO92/20791, WO93/06213, WO93/11236, WO93/19172, WO95/01438, WO95/15388, annu. Rev. Immunol (1994) 12, pp 433-455, nature Biotechnology (2005) 1116 (9), pp 1105-455).
Furthermore, the antibody against GARP of the present invention can be obtained by: an animal is immunized with GARP or any given polypeptide selected from the amino acid sequence of GARP, and then the antibodies produced in its living body are collected and purified. The biological species of GARP used as an antigen is not limited to humans, and therefore animals may also be immunized with GARP derived from animals other than humans, such as mice or rats. In this case, by examining the cross-reactivity of the obtained antibody binding to the heterologous GARP with human GARP, an antibody applicable to human diseases can be selected.
Furthermore, antibody-producing cells producing Antibodies against GARP are fused with myeloma cells to establish hybridomas, so as to obtain Monoclonal Antibodies, according to known methods (e.g., kohler and Milstein, nature (1975) 256, pp 495-497, kennet, R. Editor, monoclonal Antibodies, pp 365-367, plenum Press, N.Y. (1980)).
It should be noted that GARP used as an antigen can be obtained by allowing a host cell to produce GARP genes according to genetic manipulation.
Specifically, a vector capable of expressing the GARP gene is produced, and then the vector is introduced into a host cell so that the gene is expressed therein, and thereafter the expressed GARP can be purified. The method for obtaining an antibody against GARP will be specifically described below.
(1) Preparation of antigens
Examples of antigens for the production of anti-GARP antibodies may include GARP, polypeptides consisting of at least 6 contiguous partial amino acid sequences thereof, and derivatives prepared by adding any given amino acid sequence or vector to such GARP or polypeptides thereof.
GARP can be purified directly from human tumor tissue or tumor cells and then used. Alternatively, GARP may also be obtained by synthesizing it in vitro or by genetic manipulation allowing the host cell to produce it.
According to such genetic manipulation, specifically, the antigen can be obtained by: GARP cDNA is introduced into an expression vector capable of expressing GARP cDNA, and GARP is synthesized, or other prokaryotic or eukaryotic host cells are transformed, in a solution containing enzymes, substrates, and energy materials necessary for transcription and translation, to allow for its expression.
An antigen as a secreted protein can also be obtained by allowing a fusion protein formed by linking a DNA encoding the extracellular region of GARP as a membrane protein and a DNA encoding the constant region of an antibody to be expressed in a suitable host and/or vector system.
GARP cDNA can be obtained by a so-called PCR method including, for example, performing a polymerase chain reaction (hereinafter referred to as "PCR") using a cDNA library of GARP-expressing cDNA as a template, and also using primers for specifically amplifying the GARP cDNA (see Saiki, r. K., et al Science (1988) 239, p. 487-489).
An example of in vitro synthesis of a polypeptide may be a Rapid Translation System (RTS) manufactured by Roche Diagnostics, but is not limited thereto.
Examples of the prokaryotic cell used as the host cell may include Escherichia coli: (E.coli) (II)Escherichia coli) And Bacillus subtilis (B.) (Bacillus subtilis). To transform a host cell with a gene of interest, the host cell is transformed with a plasmid vector containing a replicon, i.e., an origin of replication and regulatory sequences, derived from a species compatible with the host. As the vector, a vector having a sequence capable of imparting phenotypic selectivity to a cell to be transformed is preferable.
Examples of eukaryotic cells used as host cells may include vertebrate, insect and yeast cells. Examples of vertebrate cells that can be frequently used include COS cells (Gluzman, Y., cell (1981) 23, pages 175-182, ATCC CRL-1650) which are monkey cells, mouse fibroblast NIH3T3 (ATCC No. CRL-1658), and dihydrofolate reductase-deficient Cell lines (Urlaub, G. And Chasin, L.A. Proc. Natl. Acad. Sci. U.S.A. (1980) 77, pages 4126-4220) of Chinese hamster ovary cells (CHO cells, ATCC CCL-61), but are not limited thereto.
The transformant thus obtained may be cultured according to an ordinary method, and the polypeptide of interest may be produced inside or outside the cultured cell.
As a medium used in the culture, various types of commonly used media can be selected as appropriate depending on the type of host cell employed. If the host cell is Escherichia coli, if necessary, for example, an antibiotic such as ampicillin or IPMG may be added to the LB medium, and then the resulting medium may be used.
As a result of the above-mentioned culture, a recombinant protein produced inside or outside the cells of the transformant can be isolated and/or purified by various known separation methods utilizing the physical or chemical properties of the protein.
Specific examples of the method may include treatment using a general protein precipitant, ultrafiltration, various types of liquid chromatography such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography or affinity chromatography, a dialysis method, and a combination thereof.
In addition, by attaching a histidine tag consisting of 6 residues to the recombinant protein to be expressed, the protein can be efficiently purified using a nickel affinity column. In other methods, by linking the Fc region of IgG to the recombinant protein to be expressed, the protein can be efficiently purified using a protein a column.
By combining the above methods with each other, the objective polypeptide can be produced in a large scale with high yield and high purity.
(2) Production of anti-GARP monoclonal antibodies
An example of an antibody that specifically binds to GARP may be a monoclonal antibody that specifically binds to GARP. The method for obtaining such monoclonal antibody is as follows.
The following work steps are generally necessary for the production of monoclonal antibodies.
Specifically, the necessary working steps include:
(a) The purification of biopolymers for use as antigens,
(b) A step of immunizing an animal with the antigen by injection, collecting blood from the animal, examining the antibody titer to determine the period of spleen excision from the animal, and then preparing antibody-producing cells,
(c) Preparation of myeloma cells (hereinafter referred to as "myeloma"),
(d) Cell fusion between the antibody-producing cell and myeloma,
(e) Selecting a group of hybridomas producing the antibody of interest,
(f) The single cell clones were split (clones),
(g) Optionally, culture of a hybridoma for mass production of a monoclonal antibody, or breeding of an animal into which the hybridoma is transplanted, and
(h) Analysis of the physiological activity and binding specificity of the monoclonal antibodies thus produced, or examination of the properties of the antibodies as a labeling reagent.
The method for producing a monoclonal antibody will be described in detail below together with the above steps. However, the method of producing the above antibody is not limited thereto, and for example, antibody-producing cells other than spleen cells and myeloma cells may also be used.
(a) Purification of antigens
As the antigen, GARP prepared by the above-described method or a part thereof can be used.
Alternatively, a membrane fraction prepared from a recombinant cell expressing GARP, or such a recombinant cell expressing GARP itself, or further a partial peptide of the protein of the present invention chemically synthesized according to a method well known to those skilled in the art may also be used as an antigen.
(b) Preparation of antibody-producing cells
Mixing the antigen obtained in step (a) with an auxiliary agent such as Freund's complete adjuvant or incomplete adjuvant, or potassium alum to prepare an immunogen, and thereafter immunizing an experimental animal with the immunogen. As such experimental animals, there is no doubt that animals used in known methods for producing hybridomas can be used. Specific examples of such animals that may be used herein include mice, rats, goats, sheep, cattle and horses. From the viewpoint of availability of myeloma cells to be fused with the excised antibody-producing cells and the like, it is preferable to use mice or rats as the animal to be immunized.
The strain of mouse and rat to be actually used is not particularly limited. In the case of mice, examples of strains that may be used herein include A, AKR, BALB/C, BDP, BA, CE, C3H, 57BL, C57L, DBA, FL, HTH, HT1, LP, NZB, NZW, RF, R III, SJL, SWR, WB, and 129. On the other hand, in the case of rats, examples of strains that may be used herein include Wistar, low, lewis, sprague, dawley, ACI, BN, and Fischer.
These mice and rats are available from experimental animal breeders and distributors, such as CLEA Japan, INC, and CHARLES RIVER LABORATORIES Japan, INC.
Among them, BALB/c strain in the case of mice and Wistar and Low strain in the case of rats are particularly preferable as the animal to be immunized in view of fusion compatibility with myeloma cells described below.
In addition, in view of the homology of human and mouse antigens, it is also preferable to use a mouse whose biological mechanism for removal of autoantibodies has been reduced, i.e., an autoimmune disease mouse.
The age of these mice or rats at the time of immunization is preferably 5 to 12 weeks of age, and more preferably 6 to 8 weeks of age.
For immunizing animals with GARP or a recombinant thereof, known methods can be applied, for example, the methods described in detail in Weir, D.M., handbook of Experimental Immunology, vol.I.II.III, blackwell Scientific Publications, oxford (1987), kabat, E.A. and Mayer, M.M., experimental Immunology, charles C Thomas publishing Springfield, illinois (1964), and the like.
Among these immunization methods, the method preferably applied to the present invention is specifically, for example, the following method.
That is, cells in which a membrane protein fraction used as an antigen or an antigen has been expressed are first administered to an animal intradermally or intraperitoneally.
In order to enhance the immune efficiency, the combined use thereof is preferable. The immune efficiency can be particularly enhanced if intradermal administration is carried out in the first half of the administration regimen and intraperitoneal administration is carried out in the latter half or only in the final administration case.
The schedule of administration of the antigen differs depending on the type of animal to be immunized, individual difference, and the like. In general, 3 to 6 antigen doses and 2 to 6 weeks dosing intervals are preferred, and 3 or 4 antigen doses and 2 to 4 weeks dosing intervals are more preferred.
The applied dose of the antigen varies depending on the type of animal to be immunized, individual difference, and the like. It is generally 0.05 to 5mg, and preferably about 0.1 to 0.5 mg.
The boosting is performed 1 to 6 weeks, preferably 2 to 4 weeks, and more preferably 2 to 3 weeks after the administration of the above antigen.
When boosting, the dosage of the antigen applied varies depending on the type of animal, its size, and the like. For example, in the case of mice, the antigen is generally applied at a dose of 0.05 to 5mg, preferably 0.1 to 0.5mg, and more preferably about 0.1 to 0.2 mg.
Splenocytes or lymphocytes comprising antibody-producing cells are aseptically removed from the immunized animal 1 to 10 days, preferably 2 to 5 days, and more preferably 2 or 3 days after completion of the above boosting. At this point antibody titers were determined. An animal in which the antibody titer has been sufficiently increased is used as a supply source of antibody-producing cells, so that the efficiency of subsequent operations can be enhanced.
Examples of the method for measuring the antibody titer used herein may include, but are not limited to, the RIA method and the ELISA method.
Regarding the measurement of the antibody titer in the present invention, for example, an ELISA method can be performed according to the following procedure.
First, a purified or partially purified antigen is adsorbed on a surface of a solid phase such as a 96-well plate for ELISA, and the other solid surface on which the antigen is not adsorbed is covered with a protein unrelated to the antigen such as bovine serum albumin (hereinafter referred to as "BSA"). The surface is washed and then allowed to contact a sample (e.g., mouse serum) that is used as a serial dilution of the primary antibody, such that the antibodies in the sample are allowed to bind to the antigen.
Thereafter, an enzyme-labeled antibody against the mouse antibody is added as a secondary antibody so that it is allowed to bind to the mouse antibody, followed by washing. After that, a substrate of the enzyme is added thereto, and then a change in absorbance due to color development based on substrate decomposition or the like is measured to calculate an antibody titer.
Antibody-producing cells can be isolated from splenocytes or lymphocytes of an immunized animal according to known methods (e.g., kohler et al, nature (1975) 256, p 495; kohler et al, eur. J. Immunol. (1977) 6, p 511; milstein et al, nature (1977), 266, p 550; walsh, nature, (1977) 266, p 495). For example, in the case of spleen cells, a usual method may be employed which comprises mincing the spleen, then filtering the cells through a stainless steel mesh, and then suspending the filtrate in eagle's Minimum Essential Medium (MEM) to isolate antibody-producing cells.
(c) Preparation of myeloma cells (hereinafter referred to as "myeloma")
Myeloma cells used for cell fusion are not particularly limited, and when appropriate, cells may be selected from known cell lines and then may be used. In view of the convenience in selecting hybridomas from fused cells, it is preferable to use an HGPRT (hypoxanthine-guanine phosphoribosyltransferase) -deficient cell line whose selection procedure has been established.
That is, examples of such HGPRT deficient cell lines include mouse-derived X63-Ag8 (X63), NS1-ANS/1 (NS 1), P3X63-Ag8. U1 (P3U 1), X63-Ag8.653 (X63.653), SP2/0-Ag14 (SP 2/0), MPC11-45.6TG1.7 (45.6 TG), FO, S149/5XXO and BU.1; rat-derived 210. RSY3. Ag. 1.2.3 (Y3); and human-derived U266AR (SKO-007), GM1500.GTG-A12 (GM 1500), UC729-6, LICR-LOW-HMy2 (HMy 2) and 8226AR/NIP4-1 (NP 41). These HGPRT-deficient cell lines are available, for example, from the American Type Culture Collection (ATCC).
These cell lines are subcultured in a suitable medium such as 8-azaguanine medium [ a medium prepared by adding 8-azaguanine to RPMI-1640 medium containing glutamine, 2-mercaptoethanol, gentamicin and fetal calf serum (hereinafter referred to as "FCS") ]]Iscove's modified Darber's medium (hereinafter referred to as "IMDM"), or Darber's modified eagle's medium (hereinafter referred to as "DMEM"). 3 or 4 days before cell fusion, the cells were cultured in a normal medium [ e.g., ASF104 medium (manufactured by Ajinomoto co., inc., 10% FCS.)]Subculturing to ensure that the cell fusion day is not less than 2 × 10 7 And (4) cells.
(d) Cell fusion
Where appropriate, the antibody-producing cells may be fused with myeloma cells according to known methods (Weir, D.M., handbook of Experimental Immunology, vol.I.II.III, blackwell Scientific Publications, oxford (1987), kabat, E.A. and Mayer, M.M., experimental Immunology, charles C Thomas Publisher spring field, illinois (1964), etc.) under conditions in which the survival of the cells is not greatly reduced.
Examples of such methods that can be used herein include chemical methods, which include mixing antibody producing cells with myeloma cells in a high concentration polymer solution such as polyethylene glycol, and physical methods using electrical stimulation. Among these methods, specific examples of the above chemical method are as follows.
That is, when polyethylene glycol is used as the high concentration polymer solution, the antibody-producing cells are mixed with myeloma cells in a polyethylene glycol solution having a molecular weight of 1500 to 6000, preferably 2000 to 4000, at a temperature of 30 ℃ to 40 ℃, preferably 35 ℃ to 38 ℃, for 1 to 10 minutes, preferably 5 to 8 minutes.
(e) Selection of hybridoma groups
The method of selecting a hybridoma obtained by the above-described cell fusion is not particularly limited. Generally, the HAT (hypoxanthine-aminopterin-thymidine) selection method (Kohler et al Nature (1975) 256, p.495; milstein et al Nature (1977) 266, p.550) is applied.
This approach is effective when hybridomas are obtained using myeloma cells of an HGPRT-deficient cell line that cannot survive aminopterin.
Specifically, unfused cells and hybridomas are cultured in HAT medium, so that only hybridomas resistant to aminopterin are allowed to selectively remain and grow.
(f) Division into single cell clones (clones)
As a hybridoma cloning method, for example, known Methods such as the methylcellulose method, the soft agarose method or the limiting dilution method can be applied (see, for example, barbara, B. M. And Stanley, M. S.: selected Methods in Cellular Immunology, W.H. Freeman and Company, san Francisco (1980)). Among these methods, a three-dimensional culture method such as a methylcellulose method is particularly preferable. For example, a hybridoma group formed by cell fusion is suspended in a methylcellulose Medium such as clonocell-HY Selection Medium D (manufactured by StemCell Technologies, # 03804), and then cultured. Thereafter, the formed hybridoma colonies were harvested so that monoclonal hybridomas could be obtained. The harvested hybridoma colonies were each cultured, and the obtained hybridoma culture supernatant in which a stable antibody titer was observed was selected as a GARP monoclonal antibody-producing hybridoma strain.
Examples of the hybridoma strains thus established may include GARP hybridomas 151D and 198D. In the present specification, the antibody produced by GARP hybridomas 151D and 198D is referred to as "151D antibody" or "198D antibody", or it is simply referred to as "151D" or "198D".
The heavy chain variable region of the 151D antibody has the amino acid sequence shown in SEQ ID NO:15, or a pharmaceutically acceptable salt thereof. In addition, the light chain variable region of the 151D antibody has SEQ ID NO: 17. Note that SEQ ID NO:15 is represented by SEQ ID NO:14, or a pharmaceutically acceptable salt thereof. It should also be noted that SEQ ID NO:17 is represented by SEQ ID NO:16, or a pharmaceutically acceptable salt thereof.
198D antibody has the heavy chain variable region of SEQ ID NO: 19. In addition, the light chain variable region of the 198D antibody has the amino acid sequence of SEQ ID NO:21, or a pharmaceutically acceptable salt thereof. Note that SEQ ID NO:19 is represented by SEQ ID NO:18, or a pharmaceutically acceptable salt thereof. It should also be noted that SEQ ID NO:21 is represented by SEQ ID NO:20, or a pharmaceutically acceptable salt thereof.
(g) Preparation of monoclonal antibodies by culture of hybridomas
The thus selected hybridomas are cultured so that monoclonal antibodies can be efficiently obtained. Before performing the culture, it is necessary to screen hybridomas producing the monoclonal antibody of interest.
For such screening, known methods can be employed.
Antibody titers can be measured in the present invention, for example, by the ELISA method described in section (b) above.
The hybridoma obtained by the above method can be stored in liquid nitrogen or in a refrigerated warehouse at a temperature of-80 ℃ or lower in a frozen state.
After cloning was completed, the hybridomas were cultured while replacing the HT medium with the normal medium.
The mass culture is performed by a spinner culture or spinner culture using a large-sized culture flask. The supernatant obtained from this mass culture is purified according to methods well known to those skilled in the art, such as gel filtration, so that monoclonal antibodies that specifically bind to the proteins of the present invention are obtained.
In addition, the hybridoma is injected intraperitoneally into mice of the same strain (e.g., BALB/c described above) or Nu/Nu mice, and the hybridoma is allowed to grow therein so as to obtain ascites containing a large amount of the monoclonal antibody of the present invention.
When the hybridoma is administered intraperitoneally to such a mouse, if a mineral oil such as 2,6,10, 14-tetramethylpentadecane (norphytane) has been previously administered to the mouse (3 to 7 days before the hybridoma administration), a larger amount of ascites can be obtained.
For example, it is assumed that the immunosuppressive agent has been previously administered into the abdominal cavity of a mouse of the same strain as the hybridoma, rendering the T cells inactive. 20 days after injection, 10 6 To 10 7 Individual hybridomas and/or clonal cells were suspended in serum-free medium (0.5 ml) and the suspension was then administered into the peritoneal cavity. Ascites was collected from the mice when the normal abdomen had swollen and the ascites had accumulated. According to this method, a monoclonal antibody having a concentration of about 100 times or more as high as that in the culture solution can be obtained.
Monoclonal antibodies obtained by the above method may be obtained, for example, by Weir, d.m.: purification was performed as described in Handbook of Experimental Immunology, volumes I, II, III, blackwell Scientific Publications, oxford (1978).
The monoclonal antibody thus obtained has high antigen specificity to GARP.
(h) Determination of monoclonal antibodies
The isotype and subtype of the obtained monoclonal antibody can be determined as follows.
First, examples of the assay method may include the odeloni (ouchterlony) method, the ELISA method, and the RIA method.
The odeloni method is simple, but when the concentration of monoclonal antibody is low, a concentration procedure is required.
On the other hand, when the ELISA method or RIA method is used, the culture supernatant is directly reacted with the antigen-adsorbed solid phase, and antibodies corresponding to various immunoglobulin isotypes or subclasses are used as secondary antibodies, so that isotypes and subtypes of monoclonal antibodies can be identified.
As a simpler method, a commercially available identification Kit (e.g., mouse type Kit; manufactured by BioRad) or the like can also be utilized.
Furthermore, the protein can be quantified by Folin Lowry method and a method based on the calculated absorbance at 280 nm [1.4 (OD 280) = 1 mg/ml immunoglobulin ].
Further, also in the case where the steps of (a) to (h) in the above-described (2) are performed again, and the monoclonal antibodies are separately and independently obtained, an antibody having properties equivalent to those of the 105F antibody, the 110F antibody, the 151D-derived antibody (humanized 151D antibody), and the 198D-derived antibody (humanized 198D antibody) can also be obtained. An example of such an antibody may be an antibody that binds to the same epitope to which each of the above-described antibodies binds. The 105F antibody recognizes and binds to the amino acid sequence portions at amino acid positions 366 to 377, 407 to 445, and 456 to 470 in the amino acid sequence of GARP (SEQ ID NO: 1), and the 110F antibody recognizes and binds to the amino acid sequence portions at amino acid positions 54 to 112 and 366 to 392 in the amino acid sequence of GARP (SEQ ID NO: 1); the 151D-derived antibody (humanized 151D antibody) recognizes the amino acid sequence at amino acid positions 352 to 392 of the amino acid sequence of GARP (SEQ ID NO: 1) and binds thereto; and the 198D-derived antibody (humanized 198D antibody) recognizes and binds to the amino acid sequence at amino acid positions 18 to 112 of the amino acid sequence of GARP (SEQ ID NO: 1). Accordingly, specific examples of the above epitope may include the above region in the amino acid sequence of GARP.
If a newly prepared monoclonal antibody binds to a partial peptide or a partial three-dimensional structure to which the above-mentioned 105F antibody or the like binds, it can be determined that the monoclonal antibody binds to the same epitope to which the above-mentioned 105F antibody or the like binds. Furthermore, by confirming that a monoclonal antibody competes with the above-described antibody, e.g., the 105F antibody, in binding of the antibody to GARP (i.e., that the monoclonal antibody interferes with the binding of the above-described antibody, e.g., the 105F antibody, to GARP), it can be determined that the monoclonal antibody binds to the same epitope as the above-described 105F antibody, etc., even if the specific sequence or structure of the epitope is not determined. When it is confirmed that the monoclonal antibody binds to the same epitope as the 105F antibody or the like, it is strongly expected that the monoclonal antibody should have properties equivalent to those of the above-mentioned antibody such as the 105F antibody.
(3) Other antibodies
The antibodies of the present invention also include genetically recombinant antibodies that have been artificially modified for the purpose of reducing heterologous antigenicity to humans, such as chimeric antibodies, humanized antibodies, and human antibodies as described above, as well as monoclonal antibodies to GARP as described above. These antibodies can be produced by known methods.
The obtained antibody can be purified to a homogeneous state. For the isolation and purification of the antibody, an isolation and purification method for a general protein may be used. For example, column chromatography, filtration, ultrafiltration, salting out, dialysis, preparative polyacrylamide gel electrophoresis, isoelectric focusing, etc. are appropriately selected and combined with each other so that Antibodies can be isolated and purified (stratgies for Protein Purification and chromatography: A Laboratory Course Manual, edited by Daniel R. Marshak et al, cold Spring Harbor Laboratory Press (1996); antibodies: A Laboratory Manual, edited by Harlow and David Lane, cold Spring Harbor Laboratory (1988)), but examples of the isolation and Purification methods are not limited to these.
Examples of chromatography may include affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography, reverse phase chromatography and adsorption chromatography.
These chromatographic techniques may be carried out using liquid chromatography such as HPLC or FPLC.
Examples of the column used in affinity chromatography may include a protein a column and a protein G column. Examples of columns involving the use of protein a may include Hyper D, POROS and Sepharose f.f. (Pharmacia).
In addition, the antibody can be purified by utilizing the binding activity of the antibody to the antigen using an antigen-immobilized carrier.
The resulting antibodies were evaluated in terms of their binding activity to an antigen according to the methods described in the examples and the like described below, so that preferred antibodies can be selected.
The stability of the antibody can be used as an indicator for comparison of antibody properties. Differential Scanning Calorimetry (DSC) is a device that is capable of rapidly and accurately measuring the thermal denaturation midpoint (Tm), which is a good indicator of the relative structural stability of proteins. By measuring Tm values using DSC and making comparisons regarding the resulting values, differences in thermal stability can be compared. It is known that the storage stability of an antibody has some correlation with the thermostability of the antibody (Lori Burton, et al Pharmaceutical Development and Technology (2007) 12, pages 265-273), and therefore, a preferred antibody can be selected using thermostability as an indicator. Examples of other indicators for selecting antibodies may include high yield in a suitable host cell and low aggregation in aqueous solution. For example, since an antibody having the highest yield does not always exhibit the highest thermostability, it is necessary to select an antibody most suitable for administration to a human by comprehensively assaying it based on the above-mentioned indicator.
Examples of the anti-GARP human antibody of the present invention may be an anti-GARP human antibody obtained by the above-described phage display method, and preferred examples of the anti-GARP human antibody herein may include a 105F antibody and a 110F antibody, each having the following structure.
The heavy chain of the 105F antibody has the amino acid sequence of SEQ ID NO:2, or a pharmaceutically acceptable salt thereof. SEQ ID NO:2, the amino acid sequence consisting of amino acid residues at positions 1 to 118 is a variable region, and the amino acid sequence consisting of amino acid residues at positions 119 to 448 is a constant region. In SEQ ID NO:2, the variable region has a CDRH1 consisting of an amino acid sequence at amino acid positions 26 to 35, a CDRH2 consisting of an amino acid sequence at amino acid positions 50 to 66, and a CDRH3 consisting of an amino acid sequence at amino acid positions 99 to 107. In addition, SEQ ID NO:2 are shown in figure 2.
The light chain of the 105F antibody has the amino acid sequence of SEQ ID NO:3, or a pharmaceutically acceptable salt thereof. SEQ ID NO:3, the amino acid sequence consisting of the amino acid residues at positions 1 to 112 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 113 to 217 is a constant region. In SEQ ID NO:3, the variable region has a CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36, a CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58, and a CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 101. In addition, SEQ ID NO:3 are shown in figure 3.
The heavy chain of the 110F antibody has the amino acid sequence of SEQ ID NO: 4. SEQ ID NO:4, the amino acid sequence consisting of the amino acid residues at positions 1 to 123 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 124 to 453 is a constant region. In SEQ ID NO:4, the variable region has a CDRH1 consisting of the amino acid sequence at amino acid positions 26 to 35, a CDRH2 consisting of the amino acid sequence at amino acid positions 50 to 66, and a CDRH3 consisting of the amino acid sequence at amino acid positions 99 to 112. In addition, SEQ ID NO: the sequence of 4 is shown in figure 4.
The light chain of the 110F antibody has the amino acid sequence of SEQ ID NO: 5. SEQ ID NO:5, the amino acid sequence consisting of the amino acid residues at positions 1 to 111 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 112 to 216 is a constant region. In SEQ ID NO:5, the variable region has a CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36, a CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58, and a CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 100. In addition, SEQ ID NO: the sequence of 5 is shown in figure 5.
SEQ ID NO:2 is represented by SEQ ID NO: 6. Consisting of SEQ ID NO:6 encodes the heavy chain variable region of the 105F antibody and the nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 354 of the nucleotide sequence set forth in nucleotide positions 355 to 1344 encodes the heavy chain constant region of the 105F antibody. As shown in SEQ ID NO:6, the nucleotide sequence encoding the variable region has a polynucleotide consisting of the nucleotide sequence at nucleotide positions 76 to 105 encoding CDRH1, a polynucleotide consisting of the nucleotide sequence at nucleotide positions 148 to 198 encoding CDRH2, and a polynucleotide consisting of the nucleotide sequence at nucleotide positions 295 to 321 encoding CDRH3. In addition, SEQ ID NO: the sequence of 6 is shown in figure 6.
SEQ ID NO:3 is represented by SEQ ID NO:7, or a pharmaceutically acceptable salt thereof. The polypeptide represented by SEQ ID NO:7 encodes the light chain variable region of the 105F antibody and the nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 336 of the nucleotide sequence set forth in nucleotide positions 337 to 651 encodes the light chain constant region of the 105F antibody. As shown in SEQ ID NO:7, the nucleotide sequence encoding the variable region has a polynucleotide consisting of the nucleotide sequence at nucleotide positions 67 to 108 encoding CDRL1, a polynucleotide consisting of the nucleotide sequence at nucleotide positions 154 to 174 encoding CDRL2, and a polynucleotide consisting of the nucleotide sequence at nucleotide positions 271 to 303 encoding CDRL3. In addition, SEQ ID NO: the sequence of 7 is shown in figure 7.
SEQ ID NO:4 is represented by SEQ ID NO:8, or a pharmaceutically acceptable salt thereof. Consisting of SEQ ID NO: the nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 369 of the nucleotide sequence set forth in 8 encodes the heavy chain variable region of the 110F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 370 to 1359 encodes the heavy chain constant region of the 110F antibody. As shown in SEQ ID NO:8, the nucleotide sequence encoding the variable region has a polynucleotide consisting of the nucleotide sequence at nucleotide positions 76 to 105 encoding CDRH1, a polynucleotide consisting of the nucleotide sequence at nucleotide positions 148 to 198 encoding CDRH2, and a polynucleotide consisting of the nucleotide sequence at nucleotide positions 295 to 336 encoding CDRH3. In addition, SEQ ID NO: the sequence of 8 is shown in figure 8.
SEQ ID NO:5 the amino acid sequence of the 110F antibody light chain is represented by SEQ ID NO:9, or a nucleotide sequence shown in seq id no. Consisting of SEQ ID NO:9 encodes the light chain variable region of the 110F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 334 to 648 encodes the light chain constant region of the 110F antibody. As shown in SEQ ID NO:9, the nucleotide sequence encoding the variable region has a polynucleotide consisting of the nucleotide sequence at nucleotide positions 67 to 108 encoding CDRL1, a polynucleotide consisting of the nucleotide sequence at nucleotide positions 154 to 174 encoding CDRL2, and a polynucleotide consisting of the nucleotide sequence at nucleotide positions 271 to 300 encoding CDRL3. In addition, SEQ ID NO: the sequence of 9 is shown in figure 9.
With respect to the antibody of the present invention, in addition to the above-mentioned anti-GARP human antibody, even in the case where the antibody is separately and independently obtained according to a method other than the above-mentioned method for obtaining an antibody, an antibody having cytotoxicity equivalent to that of the 105F antibody or the 110F antibody can be obtained. An example of such an antibody may be an antibody that binds to the same epitope to which the 105F antibody or the 110F antibody binds.
If a newly generated human antibody binds to a partial peptide or partial three-dimensional structure to which the 105F antibody or 110F antibody binds, it can be determined that the generated antibody binds to the same epitope to which the 105F antibody or 110F antibody binds. In addition, by confirming that the antibody of interest competes with the 105F antibody or 110F antibody for binding to GARP (i.e., the antibody of interest interferes with the binding of the 105F antibody or 110F antibody to GARP), it can be determined that the antibody of interest binds to the same epitope to which the 105F antibody or 110F antibody binds, even though the specific sequence or structure of the epitope has not been determined. If it is confirmed that the antibody concerned binds to the same epitope as the 105F antibody or the 110F antibody binds to, it is strongly expected that the antibody concerned should have cytotoxicity equivalent to that of the 105F antibody or the 110F antibody.
In addition, the antibodies of the present invention include artificially modified genetically recombinant antibodies. These antibodies can be produced using known methods. The antibody is preferably an antibody having at least 6 CDRs identical to the heavy chain and the light chain of the 105F antibody or the 110F antibody, and further having ADCC activity and inhibitory activity for the immune suppression function of tregs. The antibody concerned is not limited to a specific antibody as long as it has the above-mentioned properties. The antibody is more preferably an antibody having the heavy chain variable region and the light chain variable region of the 105F antibody or the 110F antibody.
Furthermore, by combining sequences showing high homology with the heavy chain amino acid sequence and the light chain amino acid sequence of the 105F antibody or the 110F antibody with each other, an antibody having an activity equivalent to the above-described antibody can be selected. Such homology is generally 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more (however, each CDR is the same as each of the above-mentioned antibodies). Furthermore, by incorporating an amino acid sequence comprising substitution, deletion or addition of one or several amino acid residues into the amino acid sequence of the above-mentioned heavy chain or light chain (excluding each CDR site), antibodies having activities equivalent to those of the above-mentioned antibodies, respectively, can also be selected.
Still further, examples of the anti-GARP antibody according to the present invention may include the following chimeric antibodies and humanized antibodies.
Examples of chimeric antibodies may include antibodies in which the variable and constant regions are heterologous to each other, such as those formed by conjugating the variable region of a mouse or rat-derived antibody to a human-derived constant region (see proc. Natl. Acad. Sci. U.s. A.,81, 6851-6855, (1984)).
A chimeric antibody derived from rat anti-human GARP antibody 151D is an antibody consisting of a heavy chain comprising a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO:15, and the light chain variable region consists of the amino acid sequence consisting of the amino acid residues at positions 1 to 117 as set forth in SEQ ID NO:17 from position 1 to 109, and the chimeric antibody may have a constant region derived from any given human.
Furthermore, the chimeric antibody derived from rat anti-human GARP antibody 198D is an antibody consisting of a heavy chain comprising a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO:19 and the light chain variable region consists of the amino acid sequence consisting of the amino acid residues at positions 1 to 120 as set forth in SEQ ID NO:21 from position 1 to 109, and the chimeric antibody may have a constant region derived from any given human.
Examples of such chimeric antibodies may include: an antibody consisting of a heavy chain and a light chain, the heavy chain having a heavy chain consisting of SEQ ID NO:25, and an amino acid sequence consisting of amino acid residues at positions 20 to 466 set forth in SEQ ID NO:27 by amino acid residues at positions 21 to 234; and an antibody consisting of a heavy chain having a heavy chain consisting of SEQ ID NO:29, and the light chain has an amino acid sequence consisting of the amino acid residues at positions 20 to 469 as set forth in SEQ ID NO:31 from position 21 to 234.
Note that, in SEQ ID NO:25, the amino acid sequence consisting of the amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 20 to 136 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 137 to 466 is a constant region.
It should also be noted that in the sequence listing SEQ ID NO:27, the amino acid sequence consisting of the amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 130 to 234 is a constant region.
It should be further noted that in the sequence listing SEQ ID NO:29, the amino acid sequence consisting of the amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 20 to 139 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 140 to 469 is a constant region.
It should be further noted that in the sequence listing SEQ ID NO:31, the amino acid sequence consisting of the amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 130 to 234 is a constant region.
SEQ ID NO:25 by SEQ ID NO:24, or a nucleotide sequence shown in seq id no. Consisting of SEQ ID NO: the nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 of the nucleotide sequence set forth in fig. 24 encodes the heavy chain signal sequence of the c151D antibody, the nucleotide sequence consisting of the nucleotides at nucleotide positions 58 to 408 encodes the heavy chain variable region of the c151D antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 409 to 1398 encodes the heavy chain constant region of the c151D antibody.
Further, SEQ ID NO:27 the amino acid sequence of the c151D antibody light chain represented by SEQ ID NO:26, or a pharmaceutically acceptable salt thereof. The polypeptide represented by SEQ ID NO: the nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 of the nucleotide sequence set forth in fig. 26 encodes the light chain signal sequence of the c151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 thereof encodes the light chain variable region of the c151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 thereof encodes the light chain constant region of the c151D antibody.
Further, SEQ ID NO:29 the amino acid sequence of the c198D antibody heavy chain represented by SEQ ID NO:28, or a pharmaceutically acceptable salt thereof. Consisting of SEQ ID NO: the nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 57 of the nucleotide sequence set forth in 28 encodes the heavy chain signal sequence of the c198D antibody, the nucleotide sequence consisting of the nucleotides at nucleotide positions 58 to 417 encodes the heavy chain variable region of the c198D antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 418 to 1407 encodes the heavy chain constant region of the c198D antibody.
Further, SEQ ID NO:31 the amino acid sequence of the c198D antibody light chain represented by SEQ ID NO:30, or a pharmaceutically acceptable salt thereof. Consisting of SEQ ID NO: the nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 of the nucleotide sequence shown in 30 encodes the light chain signal sequence of the c198D antibody, the nucleotide sequence consisting of the nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the c198D antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the c198D antibody.
Examples of humanized antibodies include humanized antibodies formed by incorporating only Complementarity Determining Regions (CDRs) into a human-derived antibody (see Nature (1986) 321, pages 522 to 525), and humanized antibodies formed by grafting amino acid residues in some frameworks and CDR sequences into a human antibody according to a CDR grafting method (International publication No. WO 90/07861).
However, the humanized antibody derived from the 151D antibody is not limited to a specific humanized antibody as long as it retains all 6 CDR sequences of the 151D antibody and has an anti-tumor activity.
Note that the heavy chain variable region of the 151D antibody has a light chain variable region consisting of SEQ ID NO:15, CDRH1 (GFTFSNYYMA) consisting of an amino acid sequence consisting of the amino acid residues at positions 26 to 35 of SEQ ID NO:15 (sigtggnty), and a CDRH2 (sigtggnty) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 59 in SEQ ID NO:15, and amino acid residues at positions 99 to 106 in position 15 (EDYGGFPH).
In addition, the light chain variable region of the 151D antibody has a light chain variable region consisting of SEQ ID NO:17, CDRL1 (KASQNVGTNVD) consisting of the amino acid sequence consisting of the amino acid residues at positions 24 to 34 of SEQ ID NO:17 (GASNRYT) and a CDRL2 (GASNRYT) consisting of an amino acid sequence consisting of the amino acid residues at positions 50 to 56 in SEQ ID NO:17 (LQYKYNPYT) from the amino acid sequence consisting of the amino acid residues at positions 89 to 97.
In addition, the heavy chain variable region of the 198D antibody has a heavy chain variable region consisting of SEQ ID NO:19 (GFSLTSFHVS), CDRH1 consisting of an amino acid sequence consisting of the amino acid residues at positions 26 to 35 therein, CDRH1 consisting of the amino acid sequence set forth in SEQ ID NO:19, CDRH2 (tissggty) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 58 in SEQ ID NO:19 (isgwghyvmdv) consisting of an amino acid sequence consisting of amino acid residues at positions 98 to 109.
In addition, the light chain variable region of the 198D antibody has a light chain variable region consisting of SEQ ID NO:21 (qastiysgla), CDRL1 (qastiysgla) consisting of the amino acid sequence consisting of the amino acid residues at positions 24 to 34 therein, CDRL1 consisting of the amino acid sequence consisting of the amino acid residues at SEQ ID NO:21 (GAGSLQD) and a CDRL2 (GAGSLQD) consisting of an amino acid sequence consisting of the amino acid residues at positions 50 to 56 in SEQ ID NO: CDRL3 (QQGLKFPLT) consisting of an amino acid sequence consisting of amino acid residues at positions 89 to 97 in position 21.
Specific examples of humanized antibodies for rat antibody 151D can be any given combination of: a heavy chain comprising a heavy chain variable region consisting of any one of: (1) the sequence of SEQ ID NO:33 An amino acid sequence consisting of amino acid residues at positions 20 to 136 shown in (H151D-H1) or 35 (H151D-H4), (2) an amino acid sequence having at least 95% or more homology with a framework region sequence other than each CDR sequence in the sequence of the above (1), and (3) an amino acid sequence comprising deletion, substitution or addition of one or several amino acids in a framework region sequence other than each CDR sequence in the sequence of the above (1); and a light chain comprising a light chain variable region consisting of any one of: (4) a polypeptide consisting of SEQ ID NO:37 An amino acid sequence consisting of amino acid residues at positions 21 to 129 shown in (h 151D-L1) or 39 (h 151D-L1), (5) an amino acid sequence having at least 95% or more homology to a framework region sequence other than each CDR sequence in the sequence of the above-mentioned (4), and (6) an amino acid sequence comprising deletion, substitution or addition of one or several amino acids in a framework region sequence other than each CDR sequence in the sequence of the above-mentioned (4).
On the other hand, specific examples of humanized antibodies for rat antibody 198D may be any given combination of the following: a heavy chain comprising a heavy chain variable region consisting of any one of: (1) a polypeptide represented by SEQ ID NO:41 (H198D-H3), (2) an amino acid sequence having at least 95% or more homology to the framework region sequence other than each CDR sequence in the sequence of the above (1), and (3) an amino acid sequence comprising deletion, substitution or addition of one or several amino acids in the framework region sequence other than each CDR sequence in the sequence of the above (1); and a light chain comprising a light chain variable region consisting of any one of: (4) the sequence of SEQ ID NO:43 (h 198D-L4), (5) an amino acid sequence having at least 95% or more homology to the framework region sequence other than each CDR sequence in the sequence of the above-mentioned (4), and (6) an amino acid sequence comprising deletion, substitution or addition of one or several amino acids in the framework region sequence other than each CDR sequence in the sequence of the above-mentioned (4).
Examples of preferred combinations of heavy and light chains of humanized 151D antibodies may include: an antibody consisting of a heavy chain having a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO:33, and the light chain variable region consists of the amino acid sequence consisting of the amino acid residues at positions 20 to 136 as set forth in SEQ ID NO:37 from the amino acid residue composition at position 21 to 129; and an antibody consisting of a heavy chain having a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO:35 and the light chain variable region consists of the amino acid sequence consisting of the amino acid residues at positions 20 to 136 as set forth in SEQ ID NO:39 from position 21 to 129.
More preferable examples of the combination thereof may include: consisting of a polypeptide having the sequence of SEQ ID NO:33 and a light chain having the amino acid sequence set forth in SEQ ID NO:37 (H151D-H1L 1); and a polypeptide consisting of a polypeptide having SEQ ID NO:35 and a light chain having the amino acid sequence shown in SEQ ID NO:39 (H151D-H4L 4).
An example of a preferred combination of heavy and light chains of the humanized 198D antibody may be an antibody consisting of a heavy chain having a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO:41 and the light chain variable region consists of the amino acid sequence consisting of the amino acid residues at positions 20 to 139 as set forth in SEQ ID NO:43 from position 21 to 129.
An example of a more preferred combination thereof may be a combination of a polypeptide having SEQ ID NO:41 and a light chain having the amino acid sequence set forth in SEQ ID NO:43 (H198D-H3L 4).
By combining sequences showing high homology with the above-mentioned heavy chain amino acid sequence and light chain amino acid sequence, antibodies having cytotoxicity equivalent to each of the above-mentioned antibodies can be selected. Such homology is generally 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more. Furthermore, by combining amino acid sequences comprising substitution, deletion, or addition of one or several amino acid residues with respect to the amino acid sequences of the heavy chain or the light chain with each other, antibodies having cytotoxicity equivalent to each of the above-mentioned antibodies can also be selected.
It should be noted that the term "several" as used in this specification means 1 to 10,1 to 9, 1 to 8, 1 to 7, 1 to 6,1 to 5, 1 to 4, 1 to 3, or 1 or 2.
The amino acid substitutions in the present specification are preferably conservative amino acid substitutions. Conservative amino acid substitutions are those that occur in the amino acid group associated with certain amino acid side chains. Preferred amino acid groups are as follows: acidic group = aspartic acid and glutamic acid; basic groups = lysine, arginine, and histidine; nonpolar groups = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; and uncharged polar groups = glycine, asparagine, glutamine, cysteine, serine, threonine, and tyrosine. Other preferred amino acid groups are as follows: aliphatic hydroxyl = serine and threonine; amide-containing groups = asparagine and glutamine; aliphatic = alanine, valine, leucine, and isoleucine; and aromatic groups = phenylalanine, tryptophan, and tyrosine. Such amino acid substitution is preferably performed within a range in which the properties of the substance having the original amino acid sequence are not impaired.
Homology between the two types of amino acid sequences can be determined using default parameters of the Blast algorithm version 2.2.2 (Altschul, stephen F., thomas L. Madden, alejandro A. Schaffer, jinghui Zhuang, zheng Zhuang, webb Miller and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs," Nucleic Acids Res.25. Blast algorithm can also be used by accessing www.ncbi.nlm.nih.gov/Blast via the internet. It should be noted that the homology between the nucleotide sequence of an antibody of the present invention and the nucleotide sequence of another antibody can also be determined using the Blast algorithm.
SEQ ID NO:33 or 35, the amino acid sequence consisting of the amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 20 to 136 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 137 to 466 is a constant region.
Further, in SEQ ID NO:37 or 39, wherein the amino acid sequence consisting of the amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 130 to 234 is a constant region.
Further, in SEQ ID NO:41, the amino acid sequence consisting of the amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 20 to 139 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 140 to 469 is a constant region.
Further, in SEQ ID NO:43, the amino acid sequence consisting of the amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of the amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of the amino acid residues at positions 130 to 234 is a constant region.
SEQ ID NO:33 or 35 is represented by SEQ ID NO:32 or 34, or a pharmaceutically acceptable salt thereof. In addition, SEQ ID NO:33 is shown in fig. 21, SEQ ID NO:35 is shown in fig. 23, SEQ ID NO:32 is shown in figure 31, and SEQ ID NO:34 are shown in figure 33.
A nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 in each nucleotide sequence encodes a heavy chain signal sequence of the humanized 151D antibody, a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408 therein encodes a heavy chain variable region of the humanized 151D antibody, and a nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398 therein encodes a heavy chain constant region of the humanized 151D antibody.
SEQ ID NO:41 is represented by SEQ ID NO:40, or a pharmaceutically acceptable salt thereof. In addition, SEQ ID NO:41 is shown in fig. 25, and SEQ ID NO: the sequence of 40 is shown in figure 35.
The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 57 in the above nucleotide sequence encodes the heavy chain signal sequence of the humanized 198D antibody, the nucleotide sequence consisting of the nucleotides at nucleotide positions 58 to 417 therein encodes the heavy chain variable region of the humanized 198D antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 418 to 1407 therein encodes the heavy chain constant region of the humanized 198D antibody.
SEQ ID NO:37 or 39 is represented by SEQ ID NO:36 or 38, or a pharmaceutically acceptable salt thereof. In addition, SEQ ID NO:37 is shown in fig. 22, SEQ ID NO:39 is shown in figure 24, SEQ ID NO:36 is shown in figure 32, and SEQ ID NO:38 are shown in figure 34.
The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 in each nucleotide sequence encodes the light chain signal sequence of the humanized 151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the humanized 151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the humanized 151D antibody.
SEQ ID NO:43 is represented by SEQ ID NO:42, or a nucleotide sequence shown in seq id no. In addition, SEQ ID NO:43 is shown in fig. 26, and SEQ ID NO:42 are shown in figure 36.
The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 60 in the above nucleotide sequence encodes the light chain signal sequence of the humanized 198D antibody, the nucleotide sequence consisting of the nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the humanized 198D antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the humanized 198D antibody.
The homology between these nucleotide sequences and those of other antibodies can also be determined using the Blast algorithm.
A further example of an antibody of the invention may be a human antibody that binds to the same epitope as the humanized 151D antibody or the humanized 198D antibody also binds thereto. An anti-GARP human antibody means a human antibody having only the gene sequence of a human chromosome-derived antibody. anti-GARP human antibodies can be obtained by the methods described above.
If a newly generated human antibody binds to a partial peptide or partial three-dimensional structure to which the humanized 151D antibody or the humanized 198D antibody binds, it can be determined that the human antibody binds to the same epitope as the humanized 151D antibody or the humanized 198D antibody. In addition, by confirming that the human antibody competes with the humanized 151D antibody or the humanized 198D antibody for binding to GARP (i.e., that the human antibody interferes with the binding of the humanized 151D antibody or the humanized 198D antibody to GARP), the epitope to which the human antibody binds the humanized 151D antibody or the humanized 198D antibody can be determined, even though the specific sequence or structure of the epitope is not determined. If the human antibody involved is confirmed to bind to the same epitope as the humanized 151D antibody or the humanized 198D antibody, it is strongly expected that the human antibody should have cytotoxicity equivalent to that of the humanized 151D antibody or the humanized 198D antibody.
The chimeric antibody, humanized antibody or human antibody obtained by the above method is evaluated by the method described later in examples and the like in terms of binding activity to an antigen, and thus a preferable antibody can be selected.
The invention also includes modifications of the antibodies. The term "modified" is used herein to mean chemically or biologically modified antibodies of the invention. Examples of such chemical modifications include the binding of chemical moieties to the amino acid backbone, and the chemical modification of N-linked or O-linked carbohydrate chains. Examples of such biological modifications include antibodies that have undergone post-translational modifications (e.g., N-linked or O-linked sugar chain modification, N-terminal or C-terminal processing, deamidation, isomerization of aspartic acid, and oxidation of methionine), and antibodies to which a methionine residue has been added to the N-terminus as a result of having been allowed to be expressed using a prokaryotic host cell. In addition, such modifications also include labeled antibodies that enable detection or isolation of the antibodies or antigens of the invention, such as, for example, enzyme-labeled antibodies, fluorescent-labeled antibodies, and affinity-labeled antibodies. Such modifications of the antibodies of the invention can be used to improve the stability and retention of the original antibodies of the invention in blood, reduction of antigenicity, detection or isolation of such antibodies or antigens, and the like.
Furthermore, by adjusting the sugar chain modification (glycosylation, defucosylation, etc.) bound to the antibody of the present invention, antibody-dependent cytotoxicity can be enhanced. As techniques for modulating sugar chain modification of an antibody, those described in WO99/54342, WO2000/61739, WO2002/31140 and the like are known, but the techniques are not limited to these. The antibody of the present invention also includes an antibody in which the above-described modification of the sugar chain has been regulated.
After the antibody genes have been isolated, the genes are introduced into a suitable host to produce antibodies using a suitable combination of host and expression vector. A specific example of the antibody gene may be a combination of a gene encoding a heavy chain sequence of the antibody described in the specification and a gene encoding a light chain sequence of the antibody described therein. After transformation of the host cell, the heavy chain sequence gene and the light chain sequence gene may be inserted into a single expression vector, or the genes may instead each be inserted into different expression vectors.
When a eukaryotic cell is used as the host, an animal cell, a plant cell, or a eukaryotic microorganism can be used. Examples of animal cells include mammalian cells, such as COS cells which are monkey cells (Gluzman, Y., cell (1981) 23, pages 175-182, ATCC CRL-1650), mouse fibroblast NIH3T3 (ATCC number CRL-1658), and dihydrofolate reductase-deficient Cell lines of Chinese hamster ovary cells (CHO cells, ATCC CCL-61) (Urlaub, G. And Chasin, L.A. Proc. Natl. Acad. Sci. U.S.A. (1980) 77, pages 4126-4220).
When prokaryotic cells are used as hosts, for example, escherichia coli or Bacillus subtilis can be used.
The gene of the antibody of interest is introduced into these cells for transformation, and then the transformed cells are cultured in vitro to obtain the antibody. In the above culture, there are cases where the yield is different depending on the sequence of the antibody, and therefore, it is possible to select an antibody that is easily produced as a medicament from among antibodies having equivalent binding activity using the yield as an indicator. Accordingly, the antibody of the present invention also includes an antibody obtained by the above-described method for producing an antibody, characterized in that it comprises a step of culturing the transformed host cell and a step of collecting the antibody of interest from the culture obtained in the above-described step.
It is known that a lysine residue at the carboxy-terminal end of the heavy chain of an antibody produced in cultured mammalian cells is deleted (Journal of Chromatography a, 705. However, such deletions and modifications of these heavy chain sequences have no effect on the antigen binding activity and effector function (complement activation, antibody-dependent cellular cytotoxicity, etc.) of the antibody. Accordingly, the present invention also includes an antibody that has undergone the above-described modification, and specific examples of the antibody include a deletion mutant comprising a deletion of 1 or 2 amino acids at the carboxy terminus of the heavy chain, and a deletion mutant formed by amidating the above-described deletion mutant (e.g., a heavy chain in which the proline residue at the carboxy-terminal site is amidated). However, deletion mutants related to deletion at the carboxy terminus of the heavy chain of the antibody according to the present invention are not limited to the above deletion mutants as long as they retain antigen binding activity and effector function. The two heavy chains constituting the antibody according to the present invention may be any one selected from the heavy chains of a full-length antibody and the above-described deletion mutants, or a combination of any two selected from the above-described groups. The ratio of individual deletion mutants may be influenced by the type of mammalian cell cultured and the culture conditions under which the antibody according to the invention is produced. The main component of the antibody according to the present invention may be an antibody in which one amino acid residue is deleted at each carboxy terminus of two heavy chains.
Examples of isotypes of the antibody of the present invention may include IgG (IgG 1, igG2, igG3, and IgG 4). Among them, igG1 and IgG2 are preferable.
Examples of the general functions of an antibody may include antigen binding activity, activity of neutralizing antigen activity, activity of enhancing antigen activity, ADCC activity, antibody-dependent cellular phagocytosis (ADCP) activity, and complement-dependent cytotoxicity (CDC) activity. The function of the antibody according to the invention is a binding activity to GARP, preferably ADCC activity, and more preferably cytotoxicity (anti-tumor activity) due to ADCC mediated inhibition of Treg function. Furthermore, the antibody of the present invention may have ADCP activity and/or CDC activity, as well as ADCC activity. In particular, as for agents comprising existing anti-tumor antibodies, it has been reported that agents act directly on tumor cells to block growth signals, they act directly on tumor cells to induce cell death signals, they suppress angiogenesis, they cause ADCC activity via NK cells, and they induce CDC activity via complement to suppress growth of tumor cells (J Clin Oncol 28. However, as for the ADCP activity of the anti-GARP antibody according to the invention of the present application, at least the present inventors are not aware that the ADCP activity has been reported as an activity of an agent comprising an existing anti-GARP anti-tumor antibody.
The antibodies of the invention may be antibodies that have been multimerized to enhance affinity for an antigen. The antibody to be multimerized may be a single type of antibody, or multiple antibodies recognizing multiple epitopes of a single antigen. Examples of methods of multimerizing antibodies may include the binding of an IgG CH3 domain to two scFv (single chain antibodies), the binding of an antibody to streptavidin, and the introduction of a helix-turn-helix motif.
The antibody of the present invention may also be a polyclonal antibody, which is a mixture of multiple types of anti-GARP antibodies having different amino acid sequences. An example of a polyclonal antibody may be a mixture of multiple types of antibodies with different CDRs. As such a polyclonal antibody, an antibody obtained by culturing a mixture of cells producing different antibodies and then purifying the obtained culture can be used (see WO 2004/061104).
As the modification of the antibody, an antibody conjugated with various types of molecules such as polyethylene glycol (PEG) can be used.
The antibody of the present invention may further be a conjugate (immunoconjugate) formed from such an antibody and another drug. Such an antibody may be, for example, an antibody that binds to a radioactive substance or a compound having a pharmacological action (Nature Biotechnology (2005) 23, pages 1137 to 1146). Examples of such antibodies may include indium (I), (II), (III), (IV) and (IV) 111 In) Carluomamab Pendultide (Indium (R) ((R)) 111 In) Capromab pendetide), technetium (C) 99m Tc-mercaptomomab (Technetium: (Technetium:) 99m Tc) Nofetumomab merpentan (R)) indium (A), (B) 111 In) ibritumomab (Indium (II) 111 In) Ibritumomab), yttrium (Y), (Y) and (Y) 90 Y) ibritumomab tiuxetan (Yttrium: (Y) 90 Y) Ibritumomab) and iodine (I: (I) ((II) 131 I) Tositumomab (Iodine: (I)) 131 I) Tositumomab）。
3. Agents containing anti-GARP antibodies
Since the antibody obtained by the method described in section "2. Production of anti-GARP antibody" above shows cytotoxicity to tregs, it can be used as a pharmaceutical agent, and particularly as a therapeutic agent for cancer and infectious diseases (particularly malaria and HIV infection).
Cytotoxicity caused by antibodies in vitro can be measured based on the activity of suppressing the proliferative response of cells.
For example, cancer cell lines that overexpress GARP are cultured, and antibodies with different concentrations are added to the culture system. Thereafter, the inhibitory activity of the antibody on foci (focus) formation, colony formation and sphere growth can be measured.
The in vivo therapeutic effect of an antibody on cancer in a test animal can be measured, for example, by: the antibody was administered to nude mice into which a GARP-overexpressing tumor cell line had been transplanted, and then changes in cancer cells were measured.
Examples of cancer types may include lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, and hematologic cancer. However, the cancer type is not limited to the above examples as long as the cancer cell as a therapeutic target expresses GARP.
As a substance used in a pharmaceutical agent acceptable for the pharmaceutical composition of the present invention, a substance that is non-toxic to a subject to which the pharmaceutical composition is to be administered is preferable depending on the applied dose or applied concentration.
The pharmaceutical compositions of the present invention may contain pharmaceutical substances for altering or maintaining pH, osmotic pressure, viscosity, clarity, color, isotonicity, sterility, stability, solubility, sustained release rate, absorption and permeability. Examples of the drug substance may include, but are not limited to, the following: amino acids such as glycine, alanine, glutamine, asparagine, arginine or lysine; an antibacterial agent; antioxidants such as ascorbic acid, sodium sulfate or sodium bisulfite; buffers such as phosphate, citrate or borate buffers, sodium bicarbonate or Tris-HCl solutions; fillers such as mannitol or glycine; chelating agents such as ethylenediaminetetraacetic acid (EDTA); complexing agents such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin; bulking agents such as glucose, mannose or dextrin; other carbohydrates such as mono-or disaccharides; a colorant; a flavoring agent; a diluent; an emulsifier; hydrophilic polymers such as polyvinylpyrrolidone; a low molecular weight polypeptide; a salt-forming counterion; preservatives such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine (chlorexidine), sorbic acid or hydrogen peroxide; solvents such as glycerol, propylene glycol or polyethylene glycol; sugar alcohols such as mannitol or sorbitol; polysorbates such as suspending agents, sorbitan esters, polysorbate 20 or polysorbate 80; surfactants such as Triton, tromethamine, lecithin or cholesterol; stability enhancers such as sucrose or sorbitol; a suspending agent; elasticity enhancers such as sodium chloride, potassium chloride, mannitol or sorbitol; a transport agent; an excipient; and/or a pharmaceutical adjuvant. Such a drug substance is preferably added to the anti-GARP antibody in an amount of 0.001 to 100 times, particularly 0.1 to 10 times as high as the weight of the anti-GARP antibody. The preferred composition of the pharmaceutical composition in the preparation may be appropriately determined by those skilled in the art depending on the target disease, the administration route of application, and the like.
The excipient or carrier in the pharmaceutical composition may be liquid or solid. Suitable excipients or carriers may be water for injection, physiological saline, artificial cerebrospinal fluid or other substances commonly used for parenteral administration. Neutral saline or saline containing serum albumin may also be used as a carrier. The pharmaceutical composition may comprise a Tris buffer having a pH of 7.0-8.5, an acetate buffer having a pH of 4.0-5.5, or a citrate buffer having a pH of 3.0-6.2. In addition, these buffers may also contain sorbitol or other compounds.
Examples of the pharmaceutical composition of the present invention may include a pharmaceutical composition comprising an anti-GARP antibody, and a pharmaceutical composition comprising an anti-GARP antibody and at least one cancer therapeutic agent. The pharmaceutical compositions of the present invention are prepared as medicaments of selected composition and requisite purity in lyophilized product or liquid form. Such pharmaceutical compositions comprising an anti-GARP antibody, as well as pharmaceutical compositions comprising an anti-GARP antibody and at least one cancer therapeutic agent, can also be molded into a lyophilized product comprising a suitable excipient, such as sucrose.
The cancer therapeutic agent contained together with the anti-GARP antibody in the above pharmaceutical composition may be administered to the individual together with the anti-GARP antibody simultaneously, separately or sequentially. Otherwise, the cancer therapeutic agent and the anti-GARP antibody can each be administered to the subject at different administration intervals. Examples of such cancer therapeutics may include abraxane, carboplatin, cisplatin, gemcitabine, irinotecan (CPT-11), paclitaxel, pemetrexed, sorafenib, vinblastine, the drugs described in International publication No. WO2003/038043, LH-RH analogs (leuprolide, goserelin, etc.), estramustine phosphate, estrogen antagonists (tamoxifen, raloxifene, etc.), and aromatase inhibitors (anastrozole, letrozole, exemestane, etc.). However, examples of the cancer therapeutic agent are not limited to the above-mentioned drugs as long as the agent has an antitumor activity.
The subject as a target for administration is not particularly limited. It is preferably a mammal, and more preferably a human.
The pharmaceutical compositions of the present invention may be prepared for parenteral administration, or for gastrointestinal absorption involving oral administration. The composition and concentration of the formulation may be determined according to the method of administration. With respect to the affinity of the anti-GARP antibody for GARP, i.e., the dissociation constant (Kd value) of the anti-GARP antibody for GARP, contained in the pharmaceutical composition of the present invention, the pharmaceutical composition can exhibit pharmaceutical effects as the affinity increases (i.e., the Kd value is low), even though the dose thereof applied to human decreases. Based on these results, the dosage of the pharmaceutical composition of the present invention to be used in humans can also be determined. When a human-type anti-GARP antibody is administered to a human, the antibody may be administered once at a dose of about 0.001 to 100 mg/kg or several times at intervals of 1 to 180 days. Examples of the form of the pharmaceutical composition of the present invention may include injections including instillation, suppositories, nasal agents, sublingual agents and transdermal absorbents.
Hereinafter, the present invention will be specifically described in the following examples. However, these examples are not intended to limit the scope of the present invention.
Examples
In the following examples, unless otherwise indicated, individual manipulations with respect to genetic manipulation were performed according to the methods described in "Molecular Cloning" (Sambrook, j., fritsch, e.f., and manitis, t., published by Cold Spring Harbor Laboratory Press in 1989) or other methods described in the Laboratory manuals used by those skilled in the art, or when commercially available reagents or kits were used, the examples were performed according to the instructions contained in commercially available products.
Hereinafter, the present invention will be specifically described in the following examples. However, these examples are not intended to limit the scope of the present invention.
Example 1: obtaining antibodies
1) -1 isolation of anti-GARP Fab by panning in phage display
An n-CoDeR Fab phage library (BioInvent) was used to isolate Fab binding to GARP. GARP (R & D Systems) was biotinylated using EZ-Link NHS-Chromogenic-Biotin reagent (Thermo Scientific). For liquid phase panning, biotinylated GARP was immobilized on Dynabeads Streptavidin M-280 (Life Technologies) and phage was added. Unbound phage were removed by a washing operation using a magnet (DynaMag-2, life Technologies). Thereafter, GARP-bound phage were collected by treating them with trypsin (Sigma-Aldrich) and then amplified using E.coli. A total of three panning operations were performed and the DNA fragment encoding the Fab was cut from the polyclonal phagemid using restriction enzymes and then loaded onto the expression vector for e. Thereafter, E.coli TOP10F' (Life Technologies) was transformed with the expression vector and the Fab was then allowed to be expressed in the presence of IPTG (Sigma-Aldrich). The obtained fabs were subjected to screening by ELISA.
1) -2 screening of GARP-binding Fab by ELISA
The used PBS (0.01M phosphorus containing 0.138M sodium chloride and 0.0027M potassium chloride)Acid salt buffered saline (pH 7.4); sigma-Aldrich) to 2 μ g/mL, was added to each well of a 384-well Maxi-sorp plate (black, nunc), which was then incubated overnight at 4 ℃ for coating the plates. Alternatively, 50 μ L NeutrAvidin (Life Technologies) diluted to 1 μ g/mL with PBS was added to this 384-well Maxi-sorp plate for coating the plate (by incubation at 4 ℃ overnight). Thereafter, the plate was washed three times with ELISA buffer (PBS (Sigma-Aldrich) supplemented with 0.05% Tween-20 (Bio-RAD)), and then biotinylated GARP (1 pmol/50. Mu.L PBS/well) was added thereto, followed by incubation at room temperature for 1 hour with mixing. The plate was washed three times with ELISA buffer, then blocked with Blocker Casein (Thermo Scientific) and further washed three times with ELISA buffer. Thereafter, culture supernatant containing Fab produced by e.coli was added, and the plate was incubated at room temperature for 1 hour with mixing. Plates were washed three times with ELISA buffer and 50. Mu.L of 2500-fold diluted Horse Radish Peroxidase (HRP) -labeled anti-human F (ab') 2 Antibodies (R & D Systems). The plates were further incubated with mixing at room temperature for 1 hour. The reaction mixture was washed three times with ELISA buffer and SuperSignal Pico ELISA chemiluminescent substrate (Thermo Scientific) was added to the wells. Ten minutes later, chemiluminescence was measured using a plate reader (Envision 2104 Multilabel reader, perkin Elmer), and the GARP-bound fabs were isolated.
1) -3 determination of the nucleotide sequence of ELISA-positive clones
The heavy and light chain variable regions of ELISA positive clones (105F and 110F) were analyzed by dye termination method (BigDye (registered trademark) Terminator v3.1, life Technologies). The sequences of the main primers used in sequencing are as follows.
Primer A:5 'GAA ACA GCT ATG AAA TAC CTA TTG C-3' (SEQ ID NO: 10)
And (3) primer B:5 'GCC TGA GCA GTG GAA GTC 3' (SEQ ID NO: 11)
And (3) primer C:5 'TAG GTA TTT CAT TAT GAC TGT CTC-3' (SEQ ID NO: 12)
Primer D:5 'CCC AGT CAC GAC GTT GTA AAA CG-3' (SEQ ID NO: 13).
As a result of the above analysis, the nucleotide sequences of the variable regions of the 105F antibody and 110F antibody genes were determined.
The nucleotide sequence of the heavy chain variable region of the 105F antibody is represented by SEQ ID NO:6 and the nucleotide sequence of the light chain variable region of the 105F antibody is a sequence consisting of the nucleotides at nucleotide positions 1 to 354 of the nucleotide sequence shown in the sequence listing: 7 from nucleotide position 1 to 336 of the nucleotide sequence set forth in seq id No. 7.
The nucleotide sequence of the heavy chain variable region of the 110F antibody is represented by SEQ ID NO:8, and the nucleotide sequence of the light chain variable region of the 110F antibody is a sequence consisting of the nucleotides at nucleotide positions 1 to 369 of the nucleotide sequence set forth in SEQ ID NO:9 from nucleotide position 1 to 333 of the nucleotide sequence set forth in seq id no.
1) -4: preparation of full-Length IgG and expression and purification of IgG
Full-length IgG of ELISA-positive clones including 105F and 110F was prepared by the following method.
The nucleotide sequence encoding Fab was determined and thereafter the nucleotide sequences corresponding to the variable regions of the heavy and light chains of each of the antibodies specified in 1) -3 above were specified.
The nucleotide sequence of the variable region of the heavy chain described above was ligated to a nucleic acid sequence encoding human IgG according to a conventional method 1 The nucleotide sequence of the constant region of the heavy chain (CH 1 + Fc region: amino acid sequence at amino acid positions 119 to 448 in the amino acid sequence shown in SEQ ID NO:2 in the sequence Listing), and the nucleotide sequence of the variable region of the light chain described above was also ligated to a nucleic acid sequence encoding human IgG 1 A nucleotide sequence of a constant region of a light chain (CL: an amino acid sequence at amino acid positions 113 to 217 in an amino acid sequence shown in SEQ ID NO:3 in the sequence Listing). Thereafter, the resultant ligate was inserted into an expression vector for animal cells, such as pcDNA3.3 (Invitrogen), to construct an IgG expression vector for animal cells.
The nucleotide sequence of the constructed IgG expression vector was analyzed again, so that it was confirmed that the nucleotide sequence of the full-length heavy chain of the 105F antibody was SEQ ID NO:6, and the nucleotide sequence of the full-length light chain of the 105F antibody is SEQ ID NO: 7.
It was also confirmed that the nucleotide sequence of the full-length heavy chain of the 110F antibody is SEQ ID NO:8, and the nucleotide sequence of the full-length light chain of the 110F antibody is SEQ ID NO:9, or a nucleotide sequence set forth in seq id no.
Further, based on the above nucleotide sequences, the amino acid sequences of the full-length heavy chain and the full-length light chain of the 105F antibody encoded by the nucleotide sequences, and the amino acid sequences of the full-length heavy chain and the full-length light chain of the 110F antibody encoded by the nucleotide sequences were determined.
The amino acid sequence of the heavy chain of the 105F antibody is SEQ ID NO:2, and the amino acid sequence of the light chain thereof is SEQ ID NO:3, or a pharmaceutically acceptable salt thereof.
The amino acid sequence of the heavy chain of the 110F antibody is SEQ ID NO:4, and the amino acid sequence of the light chain thereof is SEQ ID NO: 5.
IgG of 105F antibody or 110F antibody was transiently expressed by inserting the above-mentioned IgG expression vector for animal cells into FreeStyle 293F cells (Life Technologies), and then the resulting IgG was purified using a protein A affinity column (HiTrap Mab Select SuRe, GE Healthcare) as necessary. Thereafter, the buffer in which IgG was dissolved was replaced with PBS using Vivaspin20 (7 k mwco, ge Healthcare), and then the resultant was subjected to the following steps "1) -5".
1) -5 confirmation of binding of purified IgG to GARP according to ELISA
mu.L of human GARP (R & D Systems, cat. No.: 6055-LR) diluted to 1. Mu.g/mL with PBS was added to each well of a 96-well Maxi-sorp plate (black, nunc), and the plate was then incubated overnight at 4 ℃ for coating of the plate.
Plates were washed three times with ELISA buffer and then blocked with Blocker Casein for 1 hour at room temperature. The plate was washed three times with ELISA buffer, and 100. Mu.L of 50 nM 105F antibody, 50 nM 110F antibody, 50 nM human IgG (Jackson Immuno Research), 50 nM mouse anti-GARP antibody (Plato-1, ENZO Life Science), or 50 nM mouse IgG (Jackson Immuno Research) was added to the wells and the plate was incubated for 1 hour at room temperature with mixing.
Plates were washed three times with ELISA buffer. After this, 100. Mu.L of HRP-labeled anti-human Fc antibody (R & D Systems) which had been diluted 5000-fold with PBS was added to the wells treated with 105F antibody, 110F antibody or human IgG. On the other hand, 100. Mu.L of HRP-labeled anti-mouse Fc antibody (R & D Systems) which had been diluted 5000-fold with PBS was added to the wells treated with mouse anti-GARP antibody and mouse IgG. The plates were incubated at room temperature for 1 hour with mixing.
The plate was washed five times with ELISA buffer and then 0.1 mL SuperSignal Pico ELISA chemiluminescent substrate was added to the wells. After ten minutes, chemiluminescence was measured using a plate reader (Envision 2104 Multilabel reader, perkin Elmer).
The results demonstrate that the 105F and 110F antibodies bind to GARP as do commercially available anti-GARP antibodies (fig. 10).
Example 2: binding to cells expressing antigenic genes
For the GARP expression vector, cDNA clone of human GARP (Origene) was purchased and then cloned into pcdna3.1 (+) vector (Invitrogen) according to a common method. Thereafter, the nucleotide sequence thereof was confirmed.
The GARP expression vector and pcDNA3.1 vector used as a control were each transfected into HEK-293T cells (ATCC: CRL-11268) using Lipofectamine 2000 (Invitrogen). The resulting cells were cultured in DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS, hyclone) at 37 ℃ in 5% CO 2 Cultured overnight in the medium. Thereafter, cells were harvested from the plates by TrypLE Express (Invitrogen) treatment, and the cells were washed twice with MACS buffer (PBS containing 0.5% BSA and 2 mM EDTA; miltenyi Biotec) and then suspendedIn the same solution as described above. The 105F antibody and the control human IgG (ENZO Life Science) were each added to the cell suspension, and the cells were incubated at 4 ℃ for 15 minutes. Cells were washed twice with MACS buffer. Fluorescein Isothiocyanate (FITC) -labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) was added and suspended, and the cells were further incubated at 4 ℃ for 15 minutes. The cells were washed twice with MACS buffer, then fixed with 1% PFA (prepared from paraformaldehyde 32% solution (ELECTRON MICROSCOPY SCIENCES)), and measured by using a flow cytometer (FACS Canto II; becton Dickinson). Data were analyzed using Flowjo (TreeStar). Dead cells were removed from the assay by gating out cells stained with Horizon FVS450 (Becton Dickinson). Thereafter, histograms of FITC fluorescence intensity of live cells were generated.
For HEK-293T cells transfected with control vector alone, the histogram for fluorescence intensity of 105F antibody was similar to that for control IgG. On the other hand, for the GARP-expressing HEK-293T cells, the histogram for the 105F antibody was confirmed to shift to the strong fluorescence intensity side compared to the histogram for the control IgG (fig. 11). Based on the above results, it was found that the 105F antibody specifically binds to GARP expressed by HEK-293T cells.
Example 3: binding to endogenous GARP expressing cells
3) -1 flow cytometry analysis Using L428 cells
The Alexa Fluor 647 monoclonal antibody labeling kit (Invitrogen) was used to prepare the fluorescently labeled form of the 105F antibody. L428 cells (from DSMZ) were washed twice with MACS buffer and suspended in the same solution. Labeled 105F antibody was added to the cell suspension and the cells were incubated at 4 ℃ for 30 minutes. Cells were washed twice with MACS buffer, then fixed with 1% PFA and measured by using a flow cytometer (FACS Canto II, becton Dickinson). Data were analyzed using FlowJo (TreeStar). Dead cells were removed by gating out cells stained with Horizon FVS 450. Thereafter, histograms of FITC fluorescence intensity of live cells were generated. The histogram of L428 cells to which the 105F antibody has been added is shifted to the side of strong fluorescence intensity, compared with the histogram of fluorescence intensity with respect to L428 cells alone. Thus, it was confirmed that the 105F antibody binds to GARP endogenously expressed by the cells (fig. 12).
3) -2 flow cytometry analysis using human tregs
Peripheral Blood Mononuclear Cells (PBMC) from healthy subjects were isolated using Ficoll-Paque PLUS (GE Healthcare), and the isolated cells were then plated at 2X 10 6 Individual cells/mL were seeded in RPMI1640 medium (Invitrogen) (hereinafter referred to as "RP-F10 medium") supplemented with 10% FBS in low adhesion 24-well plates (Costar). anti-CD 3 antibody (BD Pharmingen) and anti-CD 28 antibody (BD Pharmingen) were added to the wells, and the cells were cultured for 20 hours. Thereafter, the cells were suspended in FACS buffer (HBSS (Invitrogen) supplemented with 10 mM HEPES (Invitrogen), 2 mM EDTA (Invitrogen), and 2% FBS), and the labeled 105F antibody prepared in the above 3) -1 and Alexa Fluor 647-labeled anti-GARP antibody (G14D 9, eBioscience) were added to the suspension. Cells were incubated on ice for 30 minutes. Cells were washed with FACS buffer and an immobilization/osmosis working solution (eBioscience) was added. Cells were further incubated on ice for 30 minutes and washed with permeabilization buffer (eBioscience). After this, 2% rat serum (eBioscience) was added to the cells. Cells were incubated at room temperature for 15 minutes and PE-labeled anti-Foxp 3 antibody (eBioscience) was added followed by a further incubation at room temperature for 30 minutes. Cells were washed and fixed at 4 ℃ for 15 minutes or more with a tissue fixative prepared by double dilution of 4% paraformaldehyde phosphate buffer (Wako Pure Chemical Industries, ltd.) with D-PBS (Invitrogen). After the cells were washed with FACS buffer, the cells were measured by using a flow cytometer (FACS Canto II; becton Dickinson) and analyzed using FlowJo (Tree Star). As a result, the 105F antibody bound FoxP 3-positive tregs as the commercially available anti-GARP antibody (fig. 13).
Example 4: properties of anti-GARP antibodies
4) -1 ADCC Activity
4) Preparation of (E) -1-1 Effector cells
PBMCs from healthy volunteers were isolated according to 3) -2 above. NK cells were purified from PBMCs using an NK cell isolation kit (Miltenyi Biotec). The NK cells obtained were incubated overnight in RP-F10 medium (Invitrogen) supplemented with 100 IU/mL rhIL-2 (Novartis). Thereafter, the number of living cells was counted by trypan blue exclusion test, and then the cells were treated at 2 × 10 5 Cell density of individual cells/mL was resuspended in RP-F10 medium. The obtained cells were used as effector cells.
4) Preparation of (E) -1-2 target cells
In RPMI1640 medium (Invitrogen) supplemented with 10% FBS, 30. Mu.L (1110 kBq) of chromium-51 (b: (R) (R)) 51 Cr) and 0.6X 10 6 L428 cells as described in examples 3) -1 were mixed and the cells were incubated at 37 ℃ in 5% CO 2 And incubated for 2 hours so that the cells are radiolabeled. The labeled cells were washed three times with RPMI1640 medium (Invitrogen) supplemented with 10% FBS, and then the cells were washed at 4 × 10 4 Individual cells/mL were resuspended in the same medium. The obtained cells were used as target cells.
4）-1-3 51 Cr Release assay
105F antibody, which had been diluted with RP-F10 medium such that the final concentration was 1, 10, 100, or 1000 ng/mL, was dispensed into a 96-well U-bottom microplate (Costar) in an amount of 50. Mu.L/well, and target cells were added to the wells (50. Mu.L/well). The plates were incubated at 4 ℃ for 30 minutes. Subsequently, effector cells were added to the wells (100. Mu.L/well) and the plates were incubated at 37 ℃ in 5% CO 2 Incubated for 4 hours. Thereafter, 50. Mu.L/well of the supernatant was collected and applied to LumaPlate (Perkinelmer), and the released gamma-ray dose was measured by using a gamma counter. The cell lysis rate due to ADCC activity was calculated according to the following formula.
Cell lysis ratio (%) = (A-B)/(C-B). Times.100
A: counting of sample wells
B: mean of the counts of spontaneous release (wells without antibody and effector cells) (n = 3). After addition of antibody and addition of effector cells, 50. Mu.L and 100. Mu.L of RP-F10 medium were added, respectively. The same operations as those for the sample well were performed except for the above.
C: mean of the counts of the maximal release (wells in which the target cells were lysed by surfactant) (n = 3). After addition of the antibody, 50. Mu.L of RP-F10 medium was added. After addition of effector cells, 100. Mu.L of RP-F10 medium supplemented with 2% (v/v) Triton-X100 (Sigma) was added. The same operations as those for the sample well were performed except for the above.
The results are shown in fig. 14. The 105F antibody showed cytolytic activity on L428 cells in an antibody concentration-dependent manner. On the other hand, the control human IgG did not show such cytolytic activity. Thus, the 105F antibody has ADCC activity against L428 cells expressing endogenous GARP. It should be noted that human IgG1 anti-GARP antibodies (MHG 8 and LHG 10) produced based on the sequence information described in patent document 1 did not show ADCC activity.
4) -2 inhibitory Activity on Treg function
4) -2-1 Treg, teff (effector T cells: CD4 positive CD25 negative helper T cells) and preparation of helper cells
CD4 positive T cells were isolated from PBMCs prepared in the same manner as in 4) -1-1 above using the CD 4T cell ISOLATION Kit (Miltenyi Biotec), and FITC-labeled anti-CD 4 antibody (Miltenyi Biotec) and APC-labeled anti-CD 25 antibody (Miltenyi Biotec) were added to the CD4 positive T cells. The cells were incubated at 4 ℃ for 30 minutes. After cell washing, cells were suspended in MACS buffer and CD 4-positive CD 25-negative cells (Teff) and CD 4-positive CD 25-strong-positive cells (Treg) were isolated using FACS Aria IIu (Becton Dickinson).
On the other hand, CD 3-positive cells were removed from PBMCs using CD3 Microbeads (Miltenyi Biotec), and the cells were irradiated at a dose of 1C/kg (absorbed dose: 38.76 Gy/kg (3876 Rad/kg)) using an X-ray irradiator (Hitachi Medical Corporation) to prepare helper cells.
4) -2-2 Co-culture method and assay for inhibitory Activity on Treg function
As the medium, RPMI1640 medium (Invitrogen) supplemented with penicillin and streptomycin (Invitrogen), 1 xmem NEAA (Invitrogen), 1 × sodium pyruvate (Invitrogen), 5mM Hepes, and 5% human male AB serum (Sigma) was used. Teff (2000 cells/well) and helper cells (20000 cells/well) were mixed and added to each well of a 96-well U-shaped bottom microplate and tregs were further added and seeded into the wells at 500 cells/well. In addition, control wells without tregs were also prepared. anti-CD 3 antibody, anti-CD 28 antibody and 105F antibody were added to the wells at final concentrations of 50 or 10. Mu.g/mL, and the plates were allowed to stand at 37 ℃ in 5% CO 2 The mixture was incubated for 5 days. Thereafter, prepared is [ 2], [ 2] at 18.5 kBq/mL 3 H]Thymidine (Perkinelmer) and added to each well at 20. Mu.L/well. The cells were further incubated for 18 hours. Cells were harvested in a Filtermat A (Perkinelmer) by using a cell harvester (Mach II, tomtech), and the incorporation into the cells is measured using a scintillation counter (Microbeta, perkinElmer) 3 H]-radioactivity of thymidine. The measured data are expressed as corrected numbers per minute (CCPM).
Human IgG1 anti-GARP antibodies (MHG 8 and LHG 10) produced based on the sequence information described in patent document 1 were also subjected to the experimental system herein.
4) Calculation of-2-3 inhibitory Activity
The average of three wells under individual co-culture conditions was calculated. The proliferation value decreased in co-cultured Teff and Treg when compared to Teff alone was defined as "the suppression rate of Teff proliferation by Treg" (= 1- [ CCPM of co-culture/CCPM of Teff alone ]).
The inhibitory activity of each antibody on Treg function was determined by subtracting the suppression rate of Teff proliferation by tregs in the presence of the antibody from that in the absence of the antibody (= [ suppression rate without addition of antibody ] - [ suppression rate with addition of each antibody ]). It should be noted that this inhibitory activity of the samples was calculated each time in each experiment.
The results of the inhibitory activity of the 105F antibody on Treg function at 50. Mu.g/mL (inhibition rate: 72.6%) are shown in FIG. 15, and the results of the 105F antibody and MHG-8 and LHG-10 antibodies (each 10. Mu.g/mL) are shown in FIG. 16. MHG-8 and LHG-10 antibodies had no suppressive activity on Treg function (suppression rate: 0.8% and 0.0%, respectively), while 105F antibody significantly suppressed Treg function (suppression rate: 65.8%). When roughly calculated by using the value (CD 4 + CD25- (Teff): treg = 4) in fig. 5A of non-patent document 10, the inhibition rate caused by transduction of siRNA against GARP into Treg is about 15%.
Example 5: production of rat antibodies
5) Preparation of-1 GARP expression vector
The expression vector described in example 2 was used as a GARP expression vector, and the EndoFree Plasmid Giga Kit (QIAGEN) was used for mass production.
5) -2 immunization of rats
For immunization, WKY/Izm female rats (Japan SLC, inc.) were used. First, the lower limb of each rat was pretreated with hyaluronidase (SIGMA-ALDRICH), and the GARP expression vector was injected intramuscularly into the same site. Subsequently, using ECM830 (BTX), in vivo electroporation was performed on the same site using a double needle electrode. The same in vivo electroporation was repeated every two weeks, and lymph nodes or spleens were collected from rats and used in the production of hybridomas.
5) -3 production of hybridomas
Lymph nodes or splenocytes were fused with the mouse myeloma SP2/0-ag14 Cell (ATCC, accession number CRL-1581) according to electro-Cell Fusion using LF301 Cell Fusion Unit (BEX), and then the cells were diluted with Clonacell-HY Selection Medium D (StemCell Technologies) and incubated. Hybridoma colonies that appeared in the culture were picked and selected as monoclonal hybridomas. Each hybridoma colony was cultured and the culture supernatant from each hybridoma was used to screen for hybridomas producing anti-GARP antibodies.
5) -4 antibody screening according to the cell-ELISA method
5) -4-1 preparation of antigen Gene-expressing cells for use in cell-ELISA
In DMEM medium (Invitro) supplemented with 10% FBSgen) at 7.5X 10 5 cells/mL 293 α cells (stably expressing cell line derived from HEK-293 cells expressing integrin α v and integrin β 3 (ATCC: CRL-1573)) were prepared. GARP expression vector or pcDNA3.1 (+) vector used as a negative control was transfected into cells according to the transduction procedure using Lipofectamine 2000 (Life Technologies), and the cells were dispensed in 96-Half area well plates (Corning) in an amount of 50. Mu.l each. Thereafter, cells were cultured in DMEM medium supplemented with 10% FBS at 37 ℃ in% CO 2 And culturing for 24 to 27 hours. The obtained transfected cells were used in a cell-ELISA in an adherent state.
5) -4-2 cell-ELISA
The culture supernatant of 293 α cells transfected with the expression vector prepared in example 5) -4-1 was removed, and the culture supernatant from the hybridoma was added to 293 α cells transfected with the GARP expression vector or pcdna3.1 (+) vector. The cells were incubated at 4 ℃ for 1 hour. Cells in wells were washed once with PBS (+) supplemented with 5% FBS, and thereafter, anti-rat IgG-peroxidase antibody produced in rabbits (SIGMA) that had been diluted 500-fold with PBS (+) supplemented with 5% FBS was added to the wells. Cells were incubated at 4 ℃ for 1 hour. Cells in wells were washed three times with PBS (+) supplemented with 5% FBS, and OPD staining solution (which had been prepared by mixing o-phenylenediamine dihydrochloride (Wako Pure Chemical Industries, ltd.) and H 2 O 2 Dissolved in OPD solution (0.05M trisodium citrate, 0.1M disodium hydrogen phosphate 12-water; pH 4.5) to make the material 0.4 mg/ml and 0.6% (v/v), respectively, to prepare) was added to the wells in an amount of 50. Mu.l/well. The chromogenic reaction is performed while the plate is incubated for a period of time with mixing. Thereafter, 1M HCl (50. Mu.l/well) was added to the plate to terminate the color reaction, and the absorbance at 490 nm was measured using a plate reader (ENVISION: perkinelmer). To select hybridomas producing antibodies that specifically bind to human GARP expressed on the surface of the cell membrane, hybridomas producing culture supernatants that showed higher expression levels of pcdna3.1 (in 293 α cells transfected with GARP expression vector) than in control pcdna3.1 were selected as positive cells producing anti-human GARP antibodiesHigher absorbance of that in + vector transfected cells.
5) -5 antibody screening according to flow cytometry method
5) -5-1 preparation of antigen Gene expressing cells for use in flow cytometry analysis
HEK-293T cells (obtained from ATCC) at 5X 10 4 Individual cell/cm 2 Inoculating to 225-cm 2 Flasks (Sumitomo Bakelite CO., ltd.) and then cells in DMEM medium supplemented with 10% FBS at 5% CO 2 Incubated at 37 ℃ overnight. On the next day, HEK-293T cells were transfected with either a GARP expression vector or a pcDNA3.1 (+) vector used as a negative control using Lipofectamine 2000, and the cells were transfected at 5% CO 2 Further incubated at 37 ℃ overnight. On the next day, transfected HEK-293T cells were treated with TrypLE Express (Life Technologies), washed with DMEM medium supplemented with 10% FBS, and resuspended in PBS supplemented with 5% FBS. The cell suspension obtained was used in flow cytometry analysis.
5) -5-2 flow cytometry analysis
The binding specificity of the antibodies produced from the hybridomas, which had been determined to be positive by cell-ELISA in examples 5) -4-2, was further confirmed by flow cytometry analysis for human GARP.
The suspension of transiently expressing HEK-293T cells prepared in examples 5) -5-1 was centrifuged, and then the supernatant was removed. Thereafter, the culture supernatant from each hybridoma was added to the cells and suspended. Cells were incubated at 4 ℃ for 1 hour. Cells were washed 2 times with PBS supplemented with 5% FBS, and FITC-conjugated anti-rat IgG (SIGMA), which had been diluted 500-fold with PBS supplemented with 5% FBS, was added to the cells and suspended. Cells were incubated at 4 ℃ for 1 hour. Cells were washed twice with PBS supplemented with 5% FBS and then resuspended in PBS supplemented with 5% FBS and 2. Mu.g/ml 7-amino-actinomycin D (Molecular Probes). The cells were measured using a flow cytometer (FC 500: manufactured by Beckman Coulter). Data were analyzed using Flowjo (TreeStar). A histogram of FITC fluorescence intensity of live cells was generated after dead cells were removed from the assay by gating out 7-amino actinomycin D-positive cells. Hybridomas (113 clones) producing human GARP-binding antibodies were selected based on the results in which the histogram for the antibodies was shifted to the side of strong fluorescence intensity in HEK-293T cells transfected with GARP expression vector, compared to cells transfected with control pcdna3.1 vector.
5) Preparation of-6 monoclonal antibody
5) Culture of-6-1 hybridomas 151D and 198D
From the rat anti-human GARP antibody-producing hybridomas obtained in 5) -5-2 above, hybridomas 151D and 198D which have been suggested to strongly bind to human GARP were selected.
Rat anti-GARP monoclonal antibodies were purified from hybridoma culture supernatants.
First, the Hybridoma-producing volume of rat anti-GARP monoclonal antibody was sufficiently increased with ClonaCell-HY Selection Medium E, and then the Medium was changed to 20% Ultra Low IgG FBS (Life Technologies) into which Hybridoma SFM (Life Technologies) had been added. Thereafter, the hybridomas (8 to 9X 10) 7 Cells) were seeded at 1272-cm 2 In a culture flask (Corning), followed by culture for 7 days. The culture supernatant was harvested by centrifugation and sterilized by passing through a 0.8- μm filter and through a 0.45- μm filter (Corning).
5) Purification of (E) -6-2 monoclonal antibody
The antibody was purified from the culture supernatant of the hybridoma prepared in example 5) -6-1 according to protein G affinity chromatography. The antibody was adsorbed onto a protein G column (GE Healthcare Bioscience), and then the column was washed with PBS, and then the antibody was eluted with 0.1M glycine/HCl aqueous solution (pH 2.7). To the eluent, 1M Tris-HCl (pH 9.0) was added, so that the pH was adjusted to pH 7.0 to 7.5. Thereafter, the solution was dialyzed (Thermo Scientific, slide-A-Lyzer analysis Cassette) so that the buffer was replaced with PBS. The antibody was concentrated using a Centrifugal UF Filter Device VIVASPIN20 (molecular weight cut-off: UF30K, sartorius) so that the concentration of the antibody was adjusted to 0.7 mg/mL or more. Finally, the antibody was filtered through a Minisart-Plus filter (Sartorius) to obtain a purified sample.
Example 6: cloning of rat antibodies and Generation of human chimeric antibodies
6) Cloning and sequencing of cDNA for-1 rat antibody 151D
6) -1-1 preparation of Total RNA from 151D producing hybridomas
To amplify cDNA containing the 151D variable region, total RNA was prepared from 151D-producing hybridomas using TRIzol reagent (Ambion).
6) -1-2 amplification of cDNA comprising 151D heavy chain variable region according to 5' -RACE PCR and sequencing thereof
The cDNA containing the heavy chain variable region was amplified using about 1. Mu.g of the total RNA prepared in example 6) -1-1 and the SMARTER RACE cDNA Amplification Kit (Clontech).
As primers for amplifying cDNA of the variable region of the 151D heavy chain gene according to PCR, UPM (Universal primer A mix: included in the SMARTER RACE cDNA Amplification Kit) and primers designed from the known constant region sequences of rat heavy chains were used.
cDNA containing the heavy chain variable region amplified by 5' -RACE PCR was cloned into a plasmid, and thereafter, the nucleotide sequence of the cDNA of the heavy chain variable region was subjected to sequence analysis.
The determined nucleotide sequence of the cDNA encoding the 151D heavy chain variable region is shown in SEQ ID NO:14, and the amino acid sequence thereof is shown in SEQ ID NO:15, in (b).
6) -1-3 amplification of cDNA comprising 151D light chain variable region according to 5' -RACE PCR and sequencing thereof
Amplification and sequencing were performed by the same method as that used in example 6) -1-2. However, as primers for amplifying cDNA of the variable region of the 151D light chain gene according to PCR, UPM (Universal primer A mixture: contained in SMARTER RACE cDNA Amplification Kit) and primers designed from known constant region sequences of rat light chains were used.
The determined nucleotide sequence of the cDNA encoding the 151D light chain variable region is shown in SEQ ID NO:16 and the amino acid sequence thereof is shown in SEQ ID NO:17 (c).
6) Cloning and sequencing of cDNA for-2 rat antibody 198D
The sequence was determined by the same method as that applied in example 6) -1.
The determined nucleotide sequence of the cDNA encoding the 198D heavy chain variable region is shown in SEQ ID NO:18, and the amino acid sequence thereof is shown in SEQ ID NO:19 (c). The determined nucleotide sequence of the cDNA encoding the 198D light chain variable region is shown in SEQ ID NO:20 and the amino acid sequence thereof is shown in SEQ ID NO:21, respectively.
6) -3 Generation of expression vector for human chimeric antibody
6) Construction of (E) -3-1 human chimeric light chain expression vector pCMA-LK
Using the In-Fusion Advantage PCR cloning kit (CLONTECH), the approximately 5.4-kb fragment which had been obtained by digesting the plasmid pcDNA3.3-TOPO/LacZ (Invitrogen) with the restriction enzymes XbaI and PmeI was ligated with a DNA fragment comprising the nucleotide sequence of SEQ ID NO:22 and a DNA sequence encoding a human kappa chain constant region to produce pcdna3.3/LK.
The neomycin expression unit was removed from pcDNA3.3/LK to construct pCMA-LK.
6) Construction of-3-2 human chimeric IgG 1-type heavy chain expression vector pCMA-G1
Using the In-Fusion Advantage PCR cloning kit (CLONTECH), a DNA fragment which had been obtained by digesting pCMA-LK with XbaI and PmeI to remove the light chain signal sequence and the human kappa chain constant region therefrom was ligated with a DNA fragment comprising SEQ ID NO:23 and the DNA sequence encoding amino acids in the human IgG1 constant region to construct pCMA-G1.
6) Construction of-3-3 human chimeric 151D heavy chain expression vector
PCR was performed using the cDNA encoding the heavy chain variable region of rat antibody 151D obtained In example 6) -1 as a template, using primers designed for In-fusion cloning, so as to amplify a DNA fragment containing the cDNA encoding the heavy chain variable region. The amplified DNA fragment was inserted into the site of pCMA-G1 which had been cut with the restriction enzyme BIpI using In-Fusion HD PCR cloning kit (Clontech) to construct a human chimeric 151D heavy chain expression vector.
The nucleotide sequence of the human chimeric 151D heavy chain and the amino acid sequence of the heavy chain are shown in SEQ ID NO:24 and SEQ ID NO:25 (f).
6) Construction of-3-4 human chimeric 151D light chain expression vector
PCR was performed using the cDNA encoding the variable region of the 151D light chain variable region obtained In example 6) -1 as a template, using primers designed for In-fusion cloning, so as to amplify a DNA fragment containing the cDNA encoding the light chain variable region. The amplified DNA fragment was inserted into the site of pCMA-LK which had been cut with the restriction enzyme BsiWI using In-Fusion HD PCR cloning kit (Clontech) to construct a human chimeric 151D light chain expression vector.
The nucleotide sequence of the human chimeric 151D light chain and the amino acid sequence of the light chain are shown in SEQ ID NO:26 and SEQ ID NO:27 in the reaction vessel.
6) Construction of-3-5 human chimeric 198D heavy chain expression vector
A human chimeric 198D heavy chain expression vector was constructed by the same method as that applied in examples 6) -3-3 using the cDNA encoding the heavy chain variable region of rat antibody 198D obtained in examples 6) -2 as a template.
The nucleotide sequence of the human chimeric 198D heavy chain and the amino acid sequence of the heavy chain are shown in SEQ ID NO:28 and SEQ ID NO:29 (f).
6) Construction of-3-6 human chimeric 198D light chain expression vector
A human chimeric 198D light chain expression vector was constructed by the same method as that applied in examples 6) -3-4 using the cDNA encoding the 198D light chain variable region obtained in example 6) -2 as a template.
The nucleotide sequence of the human chimeric 198D light chain and the amino acid sequence of the light chain are shown in SEQ ID NO:30 and SEQ ID NO:31, in (b).
6) -4 production of human chimeric antibody
6) -4-1 Generation of human chimeric antibodies
FreeStyle 293F cells (Invitrogen) were cultured and passaged according to the manual. 1X 10 to be in logarithmic growth phase 8 FreeStyle 293F cells (Invitrogen) were seeded in 250-mL Fernbach Erlenmeyer flasks (CORNING) at 2.0X 10 6 cells/mL were diluted with FreeStyle 293 expression medium (Invitrogen).
Meanwhile, 20. Mu.g of the heavy chain expression vector, 30. Mu.g of the light chain expression vector and 150. Mu.g of polyethyleneimine (Polyscience # 24765) were added to 5 mL of Opti-Pro SFM medium (Invitrogen), and the resulting mixture was gently stirred. After 5 minutes of incubation, the mixture was added to FreeStyle 293F cells.
Cells were incubated in an incubator (37 ℃,8% CO) 2 ) Was incubated with shaking at 125 rpm for 4 hours, and thereafter, 50 mL of EX-CELL VPRO medium (SAFC Biosciences), 0.36 mL of GlutaMAX I (GIBCO), and 2.5 mL of Yeast Ultrafiltrate (GIBCO) were added to the culture. Cells were incubated in an incubator (37 ℃,8% CO) 2 ) With shaking at 125 rpm for a further 7 days. Culture supernatants were harvested and filtered with a 250-mL Filter System (CORNING, # 431096).
The human chimeric 151D antibody obtained by the combination of the human chimeric 151D heavy chain expression vector and the human chimeric 151D light chain expression vector was named "c151D", and the human chimeric 198D antibody obtained by the combination of the human chimeric 198D heavy chain expression vector and the human chimeric 198D light chain expression vector was named "c198D".
6) Purification of (E) -4-2 chimeric antibody
The culture supernatant obtained in example 6) -4-1 was purified by one-step method of rProtein A affinity chromatography. The culture supernatant was applied to a column (manufactured by GE Healthcare Bioscience) which had been filled with MabSelectSuRe equilibrated with PBS, and then the column was washed with PBS in an amount of 2 times or more the column volume. Subsequently, elution was performed using 2M arginine hydrochloride solution (pH 4.0), so that antibody-containing fractions were collected. This fraction was subjected to Centrifugal UF Filter Device VIVASPIN20 (molecular weight cut-off: UF30K, sartorius) so that the buffer was replaced with PBS and the antibody was concentrated to adjust the antibody concentration to 1 mg/mL or more. Finally, the antibody was filtered through a Minisart-Plus filter (Sartorius) to obtain a purified sample.
6) -5 evaluation of binding Activity of human chimeric antibody to human GARP
The dissociation constant between c151D or c198D produced in examples 6) -4 and human GARP was evaluated by using Biacore T200 (GE Healthcare Bioscience) according to a capture method comprising capturing an antibody as a ligand with immobilized protein a, and then using an antigen (recombinant human GARP: r & D Systems) as analyte analysis dissociation constant. HBS-EP + (manufactured by GE Healthcare Bioscience) was used as a running buffer, and a protein a sensor chip (manufactured by GE Healthcare Bioscience) was used as a sensor chip.
Human chimeric antibody (1. Mu.g/mL) was added to the chip at a rate of 10. Mu.L/min for 20 seconds, followed by addition of a dilution series of solutions of the antigen (8 to 128 nM) at a flow rate of 30. Mu.L/min for 120 seconds. Subsequently, dissociation was monitored for 480 seconds. As a regeneration solution, glycine 1.5 (manufactured by GE Healthcare Bioscience) was added at a flow rate of 20. Mu.l/min for 30 seconds.
The model was fitted using 1.
The results are shown in table 1.
TABLE 1 dissociation constants between c151D or c198D and human GARP
[ Table 1]
Name(s) KD（nM）
1 c151D 0.47
2 c198D 0.17
EXAMPLE 7 production of humanized antibody
7) Molecular modeling of-1 c151D antibody variable regions
Molecular modeling of the variable region of the c151D antibody was performed according to a method generally known as homology modeling (Methods in Enzymology,203, 121-153, (1991)).
The primary sequence of the variable region of the human immunoglobulin (three-dimensional structure deduced from the X-ray crystal structure is available) registered in the protein database (nuc. Acid res.28, 235-242 (2000)) was compared with the variable region of the c151D antibody.
The three-dimensional structure of the variable region was generated by combining the coordinates of the heavy and light chains of the c151D antibody and a model having a high sequence homology with the interface with each other, so as to obtain a "framework model".
After this, a representative conformation of each CDR was incorporated into the framework model.
Finally, in order to eliminate atom contact that is disadvantageous in terms of energy, an energy minimization calculation is performed. The above procedure was performed using Discovery Studio (Dassault systems).
7) -2 design of amino acid sequence of humanized 151D antibody
Humanized 151D antibodies were constructed according to a method generally known as CDR grafting (proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). Acceptor antibodies are selected based on amino acid homology in the framework regions.
The sequence of the framework region of the c151D antibody was compared to the framework regions of the human subgroup consensus sequence determined by KABAT et al (Sequences of Proteins of Immunological Interest, 5 th edition Public Health Service National Institutes of Health, bethesda, md. (1991)). As a result, the consensus sequences of human γ chain subgroup 3 and human κ chain subgroups 1 and 4 have high sequence homology, and on this basis, they were selected as receptors.
With respect to the consensus sequence of human gamma chain subgroup 3 and the consensus sequences of human kappa chain subgroup 1 and human kappa chain subgroup 4, the amino acid residues in the framework regions were aligned with the amino acid residues of the c151D antibody, such that positions were identified in which different amino acids were used. The positions of these residues were analyzed using the three-dimensional model of the c151D antibody constructed in 7) -1 above, and the donor residues to be transplanted onto the recipient were selected based on the criteria given by Queen et al (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)).
Several donor residues thus selected were introduced into the recipient antibody in order to construct the sequence of humanized h151D in the manner described in the examples below.
7) Design of 3 humanized 151D heavy chain H151D-H
7) -3-1 h151D-H1 heavy chain
By SEQ ID NO: in the c151D heavy chain shown in fig. 25, the arginine residue at amino acid position 35 is substituted with a glycine residue, the lysine residue at amino acid position 37 is substituted with a leucine residue, the lysine residue at amino acid position 38 is substituted with an arginine residue, the serine residue at amino acid position 42 is substituted with an alanine residue, the threonine residue at amino acid position 61 is substituted with a glycine residue, the glutamine residue at amino acid position 62 is substituted with a lysine residue, the alanine residue at amino acid position 68 is substituted with a serine residue, the arginine residue at amino acid position 80 is substituted with an alanine residue, the alanine residue at amino acid position 94 is substituted with a serine residue, the serine residue at amino acid position 96 is substituted with an asparagine residue, the aspartic acid residue at amino acid position 103 is substituted with an asparagine residue, the serine residue at amino acid position 107 is substituted with an alanine residue, the threonine residue at amino acid position 112 is substituted with a threonine residue, the valine residue at amino acid position 130 is substituted with a leucine residue at amino acid position 151H, and the heavy chain is designed to be a heavy chain of "1H".
In the nucleotide sequence encoding the H151D-H1 type heavy chain (SEQ ID NO: 32), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 1398, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398. The variable region has the sequence shown in SEQ ID NO:32, a nucleotide sequence consisting of the nucleotides at nucleotide positions 133 to 162 encoding CDRH1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 205 to 234 encoding CDRH2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 352 to 375 encoding CDRH3.
In addition, in the amino acid sequence of the H151D-H1 type heavy chain (SEQ ID NO: 33), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 466, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 136, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 137 to 466. The above variable region has a sequence represented by SEQ ID NO:33, CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 therein, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 therein, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 therein.
Furthermore, SEQ ID NO: the sequences shown in fig. 32 and 33 are also shown in fig. 31 and 21, respectively.
7) -3-2 h151D_H4 type heavy chain
By SEQ ID NO: the human 151D heavy chain shown in 25 in which the arginine residue at amino acid position 35 was substituted with a glycine residue, the lysine residue at amino acid position 37 was substituted with a leucine residue, the lysine residue at amino acid position 38 was substituted with an arginine residue, the serine residue at amino acid position 42 was substituted with an alanine residue, the threonine residue at amino acid position 61 was substituted with a glycine residue, the glutamine residue at amino acid position 62 was substituted with a lysine residue, the alanine residue at amino acid position 94 was substituted with a serine residue, the aspartic acid residue at amino acid position 103 was substituted with an asparagine residue, the serine residue at amino acid position 107 was substituted with an alanine residue, the threonine residue at amino acid position 112 was substituted with a valine residue, the valine residue at amino acid position 130 was substituted with a threonine residue, and the methionine residue at amino acid position 131 was substituted with a leucine residue was named "H151D _ H4 type heavy chain".
In the nucleotide sequence encoding the H151D-H4 type heavy chain (SEQ ID NO: 34), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 1398, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398. The variable region has the sequence shown in SEQ ID NO:34, a nucleotide sequence consisting of the nucleotides at nucleotide positions 133 to 162 encoding CDRH1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 205 to 234 encoding CDRH2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 352 to 375 encoding CDRH3.
In addition, in the amino acid sequence of the H151D-H4 type heavy chain (SEQ ID NO: 35), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 466, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 136, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 137 to 466. The above variable region has a sequence represented by SEQ ID NO:35, CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 therein, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 therein, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 therein.
Furthermore, SEQ ID NO: the sequences shown in 34 and 35 are also shown in fig. 33 and 23, respectively.
7) Design of-4 humanized 151D light chain h151D _ L
7) -4-1 h151D-L1 type light chain
By SEQ ID NO: substitution of the threonine residue at amino acid position 29 with an aspartic acid residue, substitution of the methionine residue at amino acid position 31 with a leucine residue, substitution of the phenylalanine residue at amino acid position 32 with an alanine residue, substitution of the isoleucine residue at amino acid position 33 with a valine residue, substitution of the valine residue at amino acid position 35 with a leucine residue, substitution of the aspartic acid residue at amino acid position 37 with a glutamic acid residue, substitution of the valine residue at amino acid position 39 with an alanine residue, substitution of the methionine residue at amino acid position 41 with an isoleucine residue, substitution of the threonine residue at amino acid position 60 with a proline residue, substitution of the threonine residue at amino acid position 83 with a serine residue, substitution of the asparagine residue at amino acid position 97 with a serine residue, substitution of the methionine residue at amino acid position 98 with a leucine residue, substitution of the leucine residue at amino acid position 103 with a valine residue, substitution of the threonine residue at amino acid position 120 with a glutamine residue, substitution of the leucine residue at amino acid position 127 with an alanine residue at amino acid position 151 with a leucine residue, substitution of the leucine residue at amino acid position 151 with an alanine residue, and an alanine residue at position 126 "L".
In the nucleotide sequence encoding the h151D-L1 type light chain (SEQ ID NO: 36), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The above variable region has the sequence shown in SEQ ID NO:36, a nucleotide sequence consisting of the nucleotides at nucleotide positions 130 to 162 encoding CDRH1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 208 to 228 encoding CDRH2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 325 to 351 encoding CDRH3.
In addition, in the amino acid sequence (SEQ ID NO: 37) of the h151D _ L1 type light chain, the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234. The above variable region has a sequence represented by SEQ ID NO: CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 in 37, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 therein, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 therein.
Furthermore, SEQ ID NO: the sequences shown in fig. 36 and 37 are also shown in fig. 32 and 22, respectively.
7) -4-2 h151D-L4 type light chain:
by SEQ ID NO: substitution of the threonine residue at amino acid position 29 with a serine residue, substitution of the methionine residue at amino acid position 31 with a leucine residue, substitution of the phenylalanine residue at amino acid position 32 with a serine residue, substitution of the isoleucine residue at amino acid position 33 with an alanine residue, substitution of the methionine residue at amino acid position 41 with an isoleucine residue, substitution of the threonine residue at amino acid position 60 with a proline residue, substitution of the glutamine residue at amino acid position 62 with a lysine residue, substitution of the threonine residue at amino acid position 83 with a serine residue, substitution of the asparagine residue at amino acid position 97 with a serine residue, substitution of the methionine residue at amino acid position 98 with a leucine residue, substitution of the alanine residue at amino acid position 100 with a proline residue, substitution of the leucine residue at amino acid position 103 with a phenylalanine residue, substitution of the valine residue at amino acid position 105 with a glutamine residue at amino acid position 120, substitution of the valine residue at amino acid position 124 with a valine residue at amino acid position 151-127 h, and substitution of the leucine residue with a leucine residue at amino acid position 124 with a leucine residue at position 151-126 h of the light chain, and design substitution of the leucine residue with a leucine residue at amino acid position 151-position 126 h.
In the nucleotide sequence encoding the h151D-L4 type light chain (SEQ ID NO: 38), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The variable region has the sequence shown in SEQ ID NO:38, a nucleotide sequence consisting of the nucleotides at nucleotide positions 130 to 162 encoding CDRL1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 208 to 228 encoding CDRL2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 325 to 351 encoding CDRL3.
In addition, in the amino acid sequence (SEQ ID NO: 39) of the h151D _ L4 type light chain, the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234. The above variable region has a sequence represented by SEQ ID NO:39, CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 therein, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 therein, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 therein.
Furthermore, SEQ ID NO: the sequences shown in FIGS. 38 and 39 are also shown in FIGS. 34 and 24, respectively.
7) Molecular modeling of-5 c198D variant regions
Molecular modeling of the variable region of the c198D antibody was performed according to a method generally referred to as homology modeling (Methods in Enzymology,203, 121-153, (1991)). The primary sequence of the variable region of the human immunoglobulin (three-dimensional structure deduced from the X-ray crystal structure is available) registered in the protein database (nuc. Acid res.28, 235-242 (2000)) was compared with the variable region of the c198D antibody.
The three-dimensional structure of the variable region was generated by combining the coordinates of the heavy and light chains of the c198D antibody and a model having a high degree of sequence homology to its interface with each other, so as to obtain a "framework model".
After this, a representative conformation of each CDR was incorporated into the framework model.
Finally, in order to eliminate atom contact that is disadvantageous in terms of energy, an energy minimization calculation is performed. The above procedure was performed using Discovery Studio (Dassault systems).
7) -6 amino acid sequence design of humanized 198D
The humanized 198D antibody was constructed according to a method commonly referred to as CDR grafting (proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). Acceptor antibodies were selected based on amino acid homology in the framework regions.
The sequence of the framework region of the c198D antibody was compared to the framework regions of the human subgroup consensus sequence determined by KABAT et al (Sequences of Proteins of Immunological Interest, 5 th edition Public Health Service National Institutes of Health, bethesda, md. (1991)). As a result, the consensus sequences of human γ chain subgroup 2 and human κ chain subgroup 1 have high sequence homology, and on this basis, they were selected as receptors. In addition, several residues from the consensus sequence of human gamma chain subgroup 3 were introduced into the receptor for the heavy chain.
With respect to the human γ chain subgroup 2 consensus sequence comprising a portion of the human γ chain subgroup 3 consensus sequence and the human κ chain subgroup 1 consensus sequence, the amino acid residues in the framework regions were aligned with the amino acid residues of the c198D antibody, such that positions were identified where different amino acids were used. The positions of these residues were analyzed using the three-dimensional model of the c198D antibody constructed in 7) -5 above, and the donor residues to be transplanted onto the recipient were selected based on the criteria given by Queen et al (proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)).
Several donor residues thus selected were introduced into the recipient antibody in order to construct the sequence of humanized h198D in the manner described in the examples below.
7) Design of-7 humanized 198D heavy chain H198D-H
7) -7-1 h198D-H3 heavy chain
By SEQ ID NO:29, the c198D heavy chain has a glutamic acid residue substituted for the glutamine residue at amino acid position 20, a valine residue substituted for the arginine residue at amino acid position 24, a glycine residue substituted for the proline residue at amino acid position 28, a lysine residue substituted for the glutamine residue at amino acid position 32, a glycine residue substituted for the glutamic acid residue at amino acid position 61, a proline residue substituted for the serine residue at amino acid position 80, a serine residue substituted for the alanine residue at amino acid position 81, a valine residue substituted for the leucine residue at amino acid position 86, a threonine residue substituted for the serine residue at amino acid position 87, an asparagine residue substituted for the serine residue at amino acid position 95, a substitution of the phenylalanine residue at amino acid position 98 with a serine residue, a substitution of the methionine residue at amino acid position 101 with a leucine residue, a substitution of the threonine residue at amino acid position 103 with a serine residue, a substitution of the leucine residue at amino acid position 104 with a valine residue, a substitution of the glutamine residue at amino acid position 105 with a threonine residue, a substitution of the threonine residue at amino acid position 106 with an alanine residue, a substitution of the glutamic acid residue at amino acid position 107 with an alanine residue, a substitution of the methionine residue at amino acid position 111 with a valine residue, a substitution of the phenylalanine residue at amino acid position 113 with a tyrosine residue, a substitution of the alanine residue at amino acid position 133, and the humanized 198D heavy chain designed with a leucine residue substituted for the serine residue at amino acid position 134 was designated as "H198D _ H3 type heavy chain".
In the nucleotide sequence encoding the H198D-H3 type heavy chain (SEQ ID NO: 40), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of the nucleotides at nucleotide positions 58 to 1407, the variable region is encoded by a nucleotide sequence consisting of the nucleotides at nucleotide positions 58 to 417, and the constant region is encoded by a nucleotide sequence consisting of the nucleotides at nucleotide positions 418 to 1407. The above variable region has the sequence shown in SEQ ID NO:40, a nucleotide sequence consisting of the nucleotides at nucleotide positions 130 to 162 encoding CDRH1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 205 to 231 encoding CDRH2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 349 to 384 encoding CDRH3.
In addition, in the amino acid sequence of the H198D-H3 type heavy chain (SEQ ID NO: 41), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 469, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 139, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 140 to 469.
Furthermore, SEQ ID NO: the sequences shown in fig. 40 and 41 are also shown in fig. 35 and 25, respectively.
7) Design of-8 humanized 198D light chain h198D-L
7) -8-1 h198D-L4 type light chain
By SEQ ID NO: the c198D light chain shown in 31 has the alanine residue at amino acid position 29 substituted with a serine residue, the glycine residue at amino acid position 33 substituted with an alanine residue, the leucine residue at amino acid position 35 substituted with a valine residue, the glutamic acid residue at amino acid position 37 substituted with an aspartic acid residue, the threonine residue at amino acid position 38 substituted with an arginine residue, the glutamine residue at amino acid position 42 substituted with a threonine residue, the glutamine residue at amino acid position 65 substituted with a lysine residue, the glycine residue at amino acid position 85 substituted with a serine residue, the serine residue at amino acid position 92 substituted with a threonine residue, the lysine residue at amino acid position 94 substituted with a threonine residue, the methionine residue at amino acid position 98 substituted with a leucine residue, the threonine residue at amino acid position 100 substituted with a proline residue, the glutamic acid residue at amino acid position 103 substituted with a phenylalanine residue, the glycine residue at amino acid position 104 substituted with a serine residue, the leucine residue at amino acid position 198 substituted with a valine residue at amino acid position 198, the valine residue at amino acid position 124 substituted with a threonine residue at amino acid position 129, the valine residue at amino acid position 198, and the threonine residue at amino acid position 129 substituted with a threonine residue at amino acid position 129.
In the nucleotide sequence encoding the h198D-L4 type light chain (SEQ ID NO: 42), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The variable region has the sequence shown in SEQ ID NO:42, a nucleotide sequence consisting of the nucleotides at nucleotide positions 130 to 162 encoding CDRL1, a nucleotide sequence consisting of the nucleotides at nucleotide positions 208 to 228 encoding CDRL2, and a nucleotide sequence consisting of the nucleotides at nucleotide positions 325 to 351 encoding CDRL3.
In addition, in the amino acid sequence (SEQ ID NO: 43) of the h198D _ L4 type light chain, the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234.
Furthermore, SEQ ID NO:42 and 43 are also shown in figures 36 and 26, respectively.
7) -9 construction of expression vector for humanized antibody
7) -9-1 construction of expression vector for humanized anti-human GARP antibody H151D-H1L1
A DNA fragment comprising a sequence encoding a H151D-H1 type heavy chain consisting of the sequence shown in SEQ ID NO:32 from nucleotide position 58 to nucleotide position 1398 of the nucleotide sequence of the H151D-H1 type heavy chain. Using the synthesized DNA fragment, an expression vector for heavy chain of H151D-H1 type was constructed according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The constructed expression vector was named "GSV-H151D-H1".
Subsequently, a DNA fragment comprising a sequence encoding a h151D-L1 type light chain consisting of the sequence shown by SEQ ID NO:36 from nucleotide position 61 to 702 of the nucleotide sequence of the h151D-L1 type light chain.
Using the synthesized DNA fragment, an expression vector for the h151D-L1 type light chain was constructed according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The constructed expression vector was named "GSV-h151D-L1".
Subsequently, MACA-1511a expression vectors were constructed from the thus-constructed expression vectors "GSV-H151D-H1" and "GSV-H151D-L1" according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The expression vector obtained was designated "DGV-H151D-H1L1-GS".
7) -9-2 construction of expression vector for humanized anti-human GARP antibody H151D-H4L4
As in the case of examples 7) -9-1, a DNA fragment comprising a sequence encoding the H151D-H4 type heavy chain consisting of SEQ ID NO:34, and the H151D-L4 type light chain consists of nucleotides at nucleotide positions 58 to 1398 of the nucleotide sequence of the H151D-H4 type heavy chain set forth in SEQ ID NO:38 from nucleotide position 61 to 702 of the nucleotide sequence of the h151D-L4 type light chain.
Using the synthesized DNA fragments, MACA-1514a expression vectors were constructed according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The expression vector obtained was named "DGV-H151D-H4L4-GS".
7) -9-3 construction of expression vector for humanized anti-human GARP antibody H198D-H3L4
As in the case of examples 7) -9-1, a DNA fragment comprising a sequence encoding the H198D-H3 type heavy chain consisting of SEQ ID NO:40 and the nucleotide at nucleotide positions 58 to 1407 of the nucleotide sequence of the H198D-H3-type heavy chain which consists of the sequence of SEQ ID NO: nucleotide composition at nucleotide positions 61 to 702 of the nucleotide sequence of the h198D-L4 type light chain shown in 42.
Using the synthesized DNA fragments, MACA-1983a expression vectors were constructed according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The obtained expression vector was named "DGV-H198D-H3L4-GS".
7) Preparation of-10 humanized anti-human GARP antibodies
7) -10-1 production of humanized anti-human GARP antibody-producing cells
7) Production of 10-1-1 cells producing humanized anti-human GARP antibody H151D-H1L1
Potelligent CHOK1SV cells (BioWa and Lonza) were transfected with humanized anti-human GARP antibody H151D-H1L1 expression vector DGV-H151D-H1L1-GS, which had been constructed in examples 7) -9-1 according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza, in order to construct cell lines producing humanized anti-human GARP antibody H151D-H1L 1. The resulting producer cell line was designated "MAC1-1".
7) Production of 10-1-2 cells producing humanized anti-human GARP antibody H151D-H4L4
As in the case of examples 7) -10-1-1, potelligent CHOK1SV cells (BioWa and Lonza) were transfected with the humanized anti-human GARP antibody H151D-H4L4-GS expression vector DGV-H151D-H4L4-GS, which had been constructed in examples 7) -9-2, in order to construct a cell line producing the humanized anti-human GARP antibody H151D-H4L 4. The resulting producer cell line was designated "MAC2-1".
7) Production of 10-1-3 cells producing humanized anti-human GARP antibody H198D-H3L4
As in the case of examples 7) -10-1-1, potelligent CHOK1SV cells (BioWa and Lonza) were transfected with humanized anti-human GARP antibody H198D-H3L4-GS expression vector DGV-H198D-H3L4-GS, which had been constructed in examples 7) -9-3, in order to construct a cell line producing humanized anti-human GARP antibody H198D-H3L4. The cell line obtained was designated "MAC3-1".
7) -10-2 culture of humanized anti-human GARP antibody-producing cells
7) -10-2-1 culture of cells producing humanized anti-human GARP antibody H151D-H1L1
The humanized anti-human GARP antibody H151D-H1L 1-producing cell line "MAC1-1" produced in example 7) -10-1-1 was cultured using a culture apparatus Wave reactor (GE Healthcare Japan). The production cell line "MAC1-1" was thawed in Dsp04B (JX Energy) medium and then in Dsp04B (JX Energy) medium in an incubator (37 ℃,5% CO) 2 ) The culture was carried out at 120 rpm. The culture solution obtained was diluted with C36 (JX Energy) medium and then cultured in an incubator (37 ℃,5% CO) 2 ) The amplification culture was carried out at 120 rpm.
The obtained culture solution was cultured in C36 medium at 30X 10 4 cells/mL were diluted and then transferred to WAVE CELLBAG (GE Healthcare Bioscience), then at 37 ℃ in 5% CO 2 In, at 0.3L/min air supply rate, in 18-24 rpm speed, at 6-8 degrees of angle to perform culture for 13 days.
FM4Ae2 medium (made by oneself) was added to the culture in an amount of 6% of the initial culture volume/day from day 3 after the start of the culture. The culture solution obtained was roughly filtered through a depth filter Millistak MC0HC054H1 (Merck Millipore) and then filtered through a 0.22-. Mu.m filter (Sartorius) attached to Flexboy Bags. This filtrate was designated "MACA-1511a culture supernatant".
7) -10-2-2 culture of cells producing humanized anti-human GARP antibody H151D-H4L4
The humanized anti-human GARP antibody H151D-H4L 4-producing cell line "MAC2-1" produced in examples 7) -10-1-2 was cultured and expanded in the same manner as that applied in examples 7) -10-2-1, and thereafter, the cells were subjected to fed-batch culture using a Wave reactor (GE Healthcare Japan) as a culture apparatus. The obtained culture was cultured in C36 medium at 30X 10 4 The cells/mL were diluted and then transferred to WAVE CELLBAG (GE Healthcare Bioscience), followed by performing the culture for 13 days. The culture solution obtained was filtered and the filtrate obtained was named "MACA-1514a culture supernatant".
7) -10-2-3 culture of cells producing humanized anti-human GARP antibody H198D-H3L4
The humanized anti-human GARP antibody H198D-H3L 4-producing cell line "MAC3-1" produced in examples 7) -10-1-3 was cultured and expanded in the same manner as that applied in examples 7) -10-2-1, and thereafter, the cells were subjected to fed-batch culture using a Wave reactor (GE Healthcare Japan) as a culture apparatus. The obtained culture was cultured in C36 medium at 30X 10 4 The cells/mL were diluted and then transferred to WAVE CELLBAG (GE Healthcare Bioscience), followed by performing the culture for 13 days. The obtained culture solution was filtered, and the obtained filtrate was named "MACA-1983a culture supernatant".
7) Purification of-10-3 humanized anti-human GARP antibodies
7) Purification of 10-3-1 humanized anti-human GARP antibody H151D-H1L1
"MACA-1511a culture supernatant" obtained in examples 7) -10-2-1 was purified by three-step methods, i.e., rProtein A affinity chromatography, anion exchange chromatography and cation exchange chromatography.
First, the culture supernatant was applied to rProtein a affinity chromatography resin that had been equilibrated with PBS. After the entire culture solution had entered the column, the column was washed with PBS, arginine-containing buffer, and PBS. Subsequently, the remaining material in the column was eluted with acetate buffer, and then the absorption peak at 280 nm was collected. The collected solution was neutralized with Tris buffer and then roughly filtered through a glass fiber filter AP20 (Merck Millipore). The solution was filtered through Stericup-GV (Merck Millipore) which was a 0.22- μm filter, and the resulting filtrate was defined as rProtein A purification library.
Subsequently, the rProtein a purification library was applied to an anion exchange chromatography resin that had been equilibrated with PBS. PBS is supplied after the application solution as a whole has entered the column. Flow-through fractions and the absorption peak at 280 nm when PBS was supplied were collected. The pH of the collected solution was adjusted with acetic acid, and then the solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore). The solution was filtered through Stericup-GV (Merck Millipore) which was a 0.22- μm filter, and the resulting filtrate was defined as the AEX purification library.
Subsequently, the AEX purification library was applied to a cation exchange chromatography resin that had been equilibrated with acetate buffer. After the use solution as a whole has entered the column, the column is washed with acetate buffer. Thereafter, elution was performed using an acetate buffer containing a high concentration of NaCl, and an absorption peak at 280 nm was collected. The collected solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore) and then filtered through Stericup-GV (Merck Millipore) which was a 0.22- μm filter. The resulting filtrate was defined as CEX purification library.
The CEX purified pool was concentrated to an antibody concentration of 25 mg/mL using a Pellicon 3 Cassette 30 kDa (Merck Millipore), and the buffer was then replaced with histidine buffer (25 mM histidine, 5% sorbitol, pH 6.0). Finally, the solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore), and then filtered through Stericup-GV (Merck Millipore) which was a 0.22- μm filter, so as to obtain a purified sample. This purified sample was designated "H151D-H1L1".
7) Purification of 10-3-2 humanized anti-human GARP antibody H151D-H4L4
The "MACA-1514a culture supernatant" obtained in example 7) -10-2-2 was purified by three-step methods, i.e., rProtein A affinity chromatography, anion exchange chromatography and cation exchange chromatography, in the same manner as that applied in example 7) -10-3-1. The purified sample was named "H151D-H4L4".
7) Purification of the 10-3-3 humanized anti-human GARP antibody H198D-H3L4
The "MACA-1983a culture supernatant" obtained in examples 7) -10-2-3 was purified by three-step methods, i.e., rProtein A affinity chromatography, anion exchange chromatography and cation exchange chromatography, in the same manner as that applied in examples 7) -10-3-1. The purified sample was named "H198D-H3L4".
7) Evaluation of binding Activity of humanized anti-human GARP antibody on human GARP
Dissociation constants between each of the humanized anti-human GARP antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 produced in examples 7) -10 and GARP were evaluated by using Biacore T200 (GE Healthcare Bioscience) according to a capture method comprising capturing an antibody as a ligand by immobilized protein a and then analyzing the dissociation constant using an antigen as an analyte. HBS-EP + (manufactured by GE Healthcare Bioscience) was used as a running buffer, and a protein a sensor chip (manufactured by GE Healthcare Bioscience) was used as a sensor chip.
Human chimeric antibody (1. Mu.g/mL) was added to the chip at a rate of 10. Mu.L/min for 20 seconds, and a dilution series of the antigen (8 to 128 nM) was added at a flow rate of 30. Mu.L/min for 120 seconds. Subsequently, dissociation was monitored for 480 seconds. As a regeneration solution, glycine 1.5 (manufactured by GE Healthcare Bioscience) was added at a flow rate of 20. Mu.l/min for 30 seconds.
The model was fitted using 1.
The results are shown in table 2.
TABLE 2 dissociation constants of humanized anti-human GARP antibodies
[ Table 2]
Name (R) KD（nM）
1 h151D-H1L1 1.8
2 h151D-H4L4 1.2
3 h198D-H3L4 0.088
Example 8: binding to cells expressing antigenic genes
8) -1 binding to GARP
HEK-293T cell suspensions into which human GARP expression vectors or control vectors had been transfected were prepared according to the method described in example 2. H151D-H1L1, H151D-H4L4, H198D-H3L4 and control human IgG (human IgG: eureka Therapeutics) were added to the cell suspension and the cells were incubated at 4 ℃ for 15 minutes.
The cells were washed twice with FACS buffer (PBS supplemented with 3% FBS (Invitrogen)), and thereafter, R-Phycoerythrin (PE) -labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4 ℃ for 15 minutes. Flow cytometry analysis was performed as described in example 2 and a histogram of PE fluorescence intensity was generated (fig. 37).
The histograms of the fluorescence intensities of H151D-H1L1, H151D-H4L4 and H198D-H3L4 in HEK-293T cells transfected with the control vector are similar to those of control IgG (in this figure, the cells are referred to as "mock vector-transfected HEK-293T").
On the other hand, it was confirmed that the histograms regarding the fluorescence intensities of H151D-H1L1, H151D-H4L4 and H198D _ H3L4 shifted to the side of strong fluorescence intensity in the HEK-293T cells expressing GARP (which are referred to as "hGARP-transfected HEK-293T" in this figure) compared with the histogram regarding the control human IgG.
From the above results, it was found that H151D-H1L1, H151D-H4L4 and H198D-H3L4 specifically bind to GARP.
8) -2 binding to GARP-TGF beta 1
8) Construction of expression vector for (E) -2-1 human GARP mutant
Human GARP expression vector (Origene) was used as a template, and YSG at amino acid positions 137-139 of human GARP amino acid sequence (SEQ ID NO: 1) was converted to HGN using primer F (cacggcaacctgctggagcggctgctgggggaggag) (SEQ ID NO: 44), primer R (caggctgttcccagacaggtccagtgcaggccag) (SEQ ID NO: 45) and KOD-Plus-Mutagenesis Kit (Toyobo) to construct human GARP mutant expression vector. Then, the nucleotide sequence of the vector was confirmed.
8) Co-expression of-2-2 GARP-TGF beta 1
HEK-293T cells were transfected with human TGF β 1 expression vector (nano Biological) and human GARP expression vector or human GARP mutant expression vector using Lipofectamine 2000 (Invitrogen).
Cells were cultured in DMEM medium (Invitrogen) supplemented with 10% FBS in 5% CO 2 Was cultured overnight at 37 ℃ and then cells were harvested from the plates by treating them with TrypLE Express (Invitrogen). Harvested cellsWashed twice with FACS buffer and resuspended in the same solution.
The antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 in the present invention, known antibodies (human IgG1 anti-GARP antibodies MHG8 and LHG10 produced based on the sequence information described in patent document 1) and control human IgG (Eureka Therapeutics) were added to the cell suspension, and the cells were incubated at 4 ℃ for 15 minutes.
The cells were washed twice with FACS buffer, PE-labeled anti-IgG antibodies (Jackson ImmunoResearch Laboratories) and horizons FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4 ℃ for 15 minutes. Flow cytometry analysis was performed as described in example 2 and histograms of PE fluorescence intensity were generated (fig. 38).
Compared to the histogram for control IgG (fig. 38), it was confirmed that the histograms for all antibodies shifted to the side of strong fluorescence intensity in HEK-293T cells co-transfected with TGF β 1 and GARP.
On the other hand, in HEK-293T cells co-transfected with TGF β 1 and the GARP mutant, the histograms for MHG8 and LHG10 did not shift and were similar to the histograms for control IgG, while the histograms for antibodies 105F, H151D-H1L1, H151D-H4L4, and H198D-H3L4 shifted to the strong fluorescence intensity side in the cells. Therefore, as described in [ non-patent document 12], it was demonstrated that antibodies MHG8 and LHG10 do not bind to GARP mutants.
From the above results, it was demonstrated that antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 bind to both GARP and GARP mutants on cells co-expressing TGF β 1, and that the regions to which these antibodies bind were found to be different from those to which MHG8 and LHG10 antibodies bind.
Example 9: binding to endogenous GARP expressing cells
9) -1 flow cytometry analysis using L428 cells
L428 cells were washed twice with FACS buffer and suspended in the same solution. Thereafter, H151D-H1L1, H151D-H4L4, H198D _ H3L4 and control human IgG (human IgG: eureka Therapeutics) were added to the suspension, and the cells were incubated at 4 ℃ for 15 minutes. The cells were washed twice with FACS buffer, and PE-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) was added and suspended. Cells were incubated at 4 ℃ for 15 minutes. Flow cytometry analysis was performed as described in example 3, and histograms of PE fluorescence intensity were generated.
As a result, the histograms for the antibodies H151D-H1L1, H151D-H4L4 and H198D _ H3L4 shifted to the side of strong fluorescence intensity in L428 cells compared with the histogram for the control IgG. Thus, it was confirmed that H151D-H1L1, H151D-H4L4 and H198D-H3L4 bound endogenously expressed GARP (FIG. 39).
9) -2 flow cytometry analysis using human Treg
Frozen human PBMCs (cytotechnologic) were thawed according to protocol and used at 2 × 10 using RPMI1640 medium supplemented with 10% FBS (Invitrogen) 6 cells/mL were seeded in 24-well plates (umito Bakelite co., ltd.).
Dynabeads Human T-Activator CD3/CD28 (Life technologies) were added to the plates and the cells were cultured for 48 hours. Thereafter, the cells were suspended in FACS buffer and the antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 and control human IgG (human IgG: eureka Therapeutics) were added. An APC-labeled anti-CD 4 antibody (Becton Dickinson) was also added to the suspension. Cells were incubated at 4 ℃ for 10 minutes.
The cells were washed with FACS buffer, and thereafter, FITC-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4 ℃ for 15 minutes.
Cells were washed again with FACS Buffer and resuspended in solution using FoxP3 stabilizing Buffer Set (Miltenyi Biotec). After this, PE-labeled anti-Foxp 3 antibody (Miltenyi Biotec) was added to the cells and the cells were incubated at 4 ℃ for 30 minutes.
After cell washing, cells were measured using a flow cytometer (FACS Canto II; becton Dickinson). After dead cells were removed from the assay by gating out cells stained with Horizon FVS450, CD4 positive cells were analyzed using FlowJo (Tree Star).
The results demonstrated that antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 bind to FoxP 3-positive Tregs (FIG. 40).
Example 10: properties of anti-GARP antibodies
10-1 ADCC Activity
According to the method described in example 4, antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4, human IgG1 anti-GARP antibodies MHG8 and LHG10 produced based on the sequence information described in patent document 1 and control human IgG (Sigma) were analyzed for their ADCC activities.
Antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed cytolytic activity on L428 cells in an antibody concentration-dependent manner (FIG. 41A).
In contrast, as described in example 4, MHG8 and LHG10 did not show cytolytic activity in the same way as control human IgG (fig. 41B).
From the above results, it was confirmed that the antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 have ADCC activity.
10-2 inhibitory Activity on Treg function
The antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 were analyzed for their inhibitory activity on Treg function according to the method described in example 4. The inhibitory activity of H151D-H1L1, H151D-H4L4 and H198D-H3L4 on Treg function at a final concentration of 1. Mu.g/mL is shown in FIG. 42 (inhibition of H151D-H1L 1: 81.5%; inhibition of H151D-H4L 4: 80.4%; and inhibition of H198D-H3L4: 70.8%).
The antibodies H151D-H1L1, H151D-H4L4 and H198D-H3L4 were shown to have inhibitory activity on Treg function.
10-3 antitumor Activity (in vitro)
10 Preparation of 3-1 Cytotoxic T Lymphocytes (CTL)
CTL cells bearing NY-ESO-1 specific T cell receptor (MU 28 CD8B35 clone #7: obtained from Mie University) were cultured at 3X 10 according to the protocol from Mie University 5 The cells are 25 cm 2 In flasks (Sumitomo Bakelite Co., ltd.) in the presence of anti-CD 3 antibody (OKT 3: imgenex), IL-2 (Novartis) and feeder cellsIncubations were performed for 7 days in RPMI1640 medium (Invitrogen) supplemented with 10% human male AB serum (Sigma) below.
Regarding feeder cells, frozen human PBMCs (Cellular Technology) were thawed and CD8 positive cells were removed from PBMCs using CD8 MicroBeads (Miltenyi Biotech) to obtain CD8 depleted PBMCs (7.5 × 10) 6 Cell/25 cm 2 Flasks), and the cells were X-ray irradiated. In addition, 103-LCL cells (from Riken BioResource Center) (1.5X 10) 6 Cell/25 cm 2 Culture flask) was also irradiated with X-rays by using an X-ray irradiator (Hitachi Medical Corporation). These cells were used as feeder cells.
At the beginning of the culture (1.5X 10) 5 Cell/25 cm 2 Culture flasks) were added with tregs obtained by the method described in example 4) -2-1 in order to evaluate the inhibitory effect of tregs on CTL cell activity. Further, at the start of the culture, treg ((7.5X 10) obtained by the above method was added (10. Mu.g/ml) 4 Cell/25 cm 2 Culture flasks), and antibodies 105F, H151D-H1L1, H151D-H4L4, H198D-H3L4, and human IgG1 (Enzo) to evaluate the anti-tumor activity of each antibody.
After completion of the incubation, CD8 was used + The T Cell Isolation Kit (Miltenyi Biotech) purified and isolated CD8 positive cells to prepare CTL cells. Thereafter, the prepared CTL cells were used in the evaluation of activity.
10 Preparation of-3-2 target cells
Human melanoma cell lines, SK-MEL-52 cells expressing NY-ESO-1 (obtained from Mie University: proc Natl Acad Sci U S A. 1980 Jul 77 (7): 4260-4), were cultured using RPMI1640 medium (Invitrogen) supplemented with 10% FBS. For cells 51 Labeling of Cr was performed as described in example 4) -1-2, and cells were adjusted to 2X 10 4 Individual cells/mL. The obtained cells were defined as target cells.
10）-3-3 51 Cr Release assay
Target cells were dispensed in 96-well U-bottom microplates (Costar) (50 μ L/well).
Subsequently, CTL cells were added to the plate (100 μ L/well) such that the number of CTL cells was 16, 8, 4, or 2 times the number of target cells (CTL cells: target cells = 1, 8, 1, 4, 1 or 2 2 Incubated at 37 ℃ for 4 hours. After this, the cells were processed according to the method as described in examples 4) -1-3. It should be noted that the inhibitory activity of the samples was calculated every time in each experiment. In addition, it was confirmed that CTL cells did not exhibit cytolytic activity against cells not expressing NY-ESO-1.
The measurement results are shown in fig. 43 and 44.
The cytolytic activity of CTL against SK-MEL-52 was suppressed by Treg (FIG. 43).
On the other hand, in the CTL cells to which the antibodies 105F, H151D-H1L1, H151D-H4L4 or H198D-H3L4 had been added, the cell lysis rate of the CTL cells against SK-MEL-52 cells increased as the number of CTL cells increased, and at any target-effector ratio, the cell lysis rate was also significantly higher than that of the control CTL cells to which control IgG had been added (fig. 44).
Thus, it was demonstrated that the antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 inhibited the suppressive activity of Tregs against CTL cells and enhanced the antitumor activity.
10 -4 antitumor Activity (in vivo)
The antitumor effect of chimeric antibodies known to have ADCC activity can be found in NOD/Shi-scid, IL-2R null Evaluation was performed in (NOG) mice in which L428 cells had been transplanted and human PBMCs (J Immunol. 2009 Oct 1 183 (7): 4782-91).
Has been scaled by 1 × 10 7 L428 cells (DSMZ) suspended In a mixed solution (1. The date of L428 cell transplantation was defined as day 0. On day 6, mice were grouped based on tumor volume values (n = 6 in each group), and administration groups were set as follows.
PBS control 1: administered on days 6,10,14, 18, 22 and 26, and in addition, human PBMCs (batch No.: 20140707) were administered on days 6, 14 and 22
105F antibody: administered at a dose of 5 mg/kg on days 6,10,14, 18, 22 and 26, and additionally, human PBMC (batch No.: 20140707) were administered on days 6, 14 and 22
PBS control 2: administered on days 6,10,14, 18, 22 and, in addition, human PBMC (batch No.: 20150924) on days 6, 14 and 22
H151D-H1L1 antibody: at days 6,10,14, 18 and 22 at a dose of 1 mg/kg and, in addition, human PBMCs (batch No.: 20150924) at days 6, 14 and 22
H151D-H4L4 antibody: at days 0, 6,10,14, 18 and 22 at a dose of 1 mg/kg and, in addition, human PBMCs (batch No.: 20150924) at days 6, 14 and 22
H198D-H3L4 antibody: on days 0, 6,10,14, 18 and 22 at a dose of 1 mg/kg and, in addition, human PBMC (batch No.: 20150924) on days 6, 14 and 22.
Each antibody was diluted with PBS (Invitrogen) and administered to mice via tail vein (10 mL/kg).
With respect to human PBMC, frozen human PBMC (Cellular Technology) were thawed according to protocol and at 1X 10 7 Individual cells/mL preparation. The prepared cells (0.2 mL) were administered to mice via the tail vein.
The long diameter (mm) and the short diameter (mm) of the tumor were measured over time using electronic digital calipers (Mitutoyo), and then the volume of the tumor was calculated according to the following expression.
Tumor volume (mm 3) = 1/2 × [ long diameter of tumor ] × [ short diameter of tumor ]
Mean ± change in Standard Error (SE) of tumor volume in each group is shown in fig. 45.
Antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed anti-tumor activity against L428 cells compared to the control group to which PBMC alone was administered. Thus, significant differences were observed for the control group (105F. Also shown in the figure are the results (P values) of the significance difference test at the last measurement day of each group (105F: day 31; and H151D-H1L1, H151D-H4L4 and H198D-H3L4: day 25).
Thus, antibodies 105F, H151D-H1L1, H151D-H4L4 and H198D-H3L4 showed anti-tumor activity in an in vivo model.
Example 11: epitope analysis of anti-GARP antibodies
The epitopes of anti-human GARP antibodies (105F, 110F, H151D-H1L1 and H198D-H3L 4) were analyzed by hydrogen-deuterium exchange mass spectrometry.
7 mg/mL anti-human GARP antibody was mixed with 3 mg/mL human GARP (R & D Systems) or with equal volumes of blank buffer. To the obtained solution was added 9 equivalents of light or heavy water. After 30 seconds, 480 seconds or 6000 seconds of water addition, or after the elapse of one night, equal amounts of 100 mM phosphoric acid, 4M Gdn-HCl and 150mM TCEP (pH 2.5) were added to the sample, and the resulting mixture was subjected to deuterium substitution. Such deuterium substituted sample was injected into the HPLC under cooling and then fed to an immobilized pepsin column with 0.1% TFA solution.
The peptide fragments obtained by digestion of human GARP in the pepsin column were retained in the C18 capture column, then eluted by a linear gradient of water and acetonitrile to which 0.1% formic acid and 0.025% TFA had been added, and then separated in the C18 analytical column. Subjecting the isolated peptide fragments to mass spectrometry using a time-of-flight mass spectrometer.
Deuterium substitution rates were calculated based on the mass of each peptide. Peptide fragments in which a significant reduction in deuterium substitution rate was observed due to the addition of anti-human GARP antibodies were identified as epitope fragments.
In the case of 105F, in SEQ ID NO: suppression of deuterium substitution rates was found in the amino acid residues at positions 366-377, 407-445 and 456-470 of human GARP shown in 1, and therefore, they were identified as epitopes.
In the case of 110F, in SEQ ID NO:1, the suppression of deuterium substitution rates was found in the amino acid residues at positions 54-112 and 366-392 of human GARP, and therefore, they were identified as epitopes.
In the case of H151D-H1L1, the amino acid sequence shown in SEQ ID NO: suppression of deuterium substitution rates was found in the amino acid residues at positions 352-392 of human GARP shown in 1, and therefore, they were identified as epitopes.
In the case of H198D-H3L4, the amino acid sequence shown in SEQ ID NO:1, and thus, they were identified as epitopes.
Industrial applicability
The anti-GARP antibody of the present invention has an anti-tumor activity mediated by ADCC activity through an inhibitory activity on Treg function, and thus, a pharmaceutical composition comprising the anti-GARP antibody may be used as an anti-cancer agent.
Furthermore, the excessive presence of tregs and their activation in patients with malaria and HIV infection shows a correlation with disease status, and the removal of tregs induces remission of each disease in murine models for the disease. Accordingly, it is expected that effective inhibition of Treg function will also have a therapeutic effect on refractory infections such as malaria and HIV.
Sequence Listing free text
SEQ ID NO: amino acid sequence of 1-GARP
SEQ ID NO: amino acid sequence of heavy chain of 2-105F antibody
SEQ ID NO: amino acid sequence of 3-105F antibody light chain
SEQ ID NO: amino acid sequence of heavy chain of 4-110F antibody
SEQ ID NO: amino acid sequence of 5-110F antibody light chain
SEQ ID NO: nucleotide sequence of heavy chain of 6-105F antibody
SEQ ID NO: nucleotide sequence of 7-105F antibody light chain
The amino acid sequence of SEQ ID NO: nucleotide sequence of 8-110F antibody heavy chain
SEQ ID NO: nucleotide sequence of 9-110F antibody light chain
SEQ ID NO: 10-primer A
SEQ ID NO: 11-primer B
SEQ ID NO: 12-primer C
SEQ ID NO: 13-primer D
SEQ ID NO: 14-nucleotide sequence of cDNA encoding 151D heavy chain variable region
The amino acid sequence of SEQ ID NO:15-151D heavy chain variable region amino acid sequence
The amino acid sequence of SEQ ID NO: 16-nucleotide sequence of cDNA encoding 151D light chain variable region
SEQ ID NO: amino acid sequence of 17-151D light chain variable region
SEQ ID NO: 18-nucleotide sequence of cDNA encoding 198D heavy chain variable region
SEQ ID NO:19-198D heavy chain variable region amino acid sequence
SEQ ID NO: 20-nucleotide sequence of cDNA encoding the 198D light chain variable region
SEQ ID NO:21-198D light chain variable region amino acid sequence
SEQ ID NO: 22-nucleotide sequence of a DNA fragment comprising the human light chain signal sequence and a sequence encoding amino acids in the human kappa chain constant region
SEQ ID NO: 23-nucleotide sequence of a DNA fragment comprising the human heavy chain signal sequence and a sequence encoding amino acids in the constant region of human IgG1
SEQ ID NO: nucleotide sequence of 24-human chimeric antibody c151D heavy chain
SEQ ID NO: amino acid sequence of heavy chain of 25-human chimeric antibody c151D
SEQ ID NO: nucleotide sequence of 26-human chimeric antibody c151D light chain
The amino acid sequence of SEQ ID NO: amino acid sequence of c151D light chain of 27-human chimeric antibody
SEQ ID NO: nucleotide sequence of heavy chain of 28-human chimeric antibody c198D
SEQ ID NO: amino acid sequence of heavy chain of 29-human chimeric antibody c198D
SEQ ID NO: nucleotide sequence of 30-human chimeric antibody c198D light chain
The amino acid sequence of SEQ ID NO: amino acid sequence of light chain of 31-human chimeric antibody c198D
SEQ ID NO: nucleotide sequence of 32-humanized antibody H151D-H1
SEQ ID NO: amino acid sequence of 33-humanized antibody H151D-H1
SEQ ID NO: 34-nucleotide sequence of humanized antibody H151D-H4
The amino acid sequence of SEQ ID NO: amino acid sequence of 35-humanized antibody H151D-H4
The amino acid sequence of SEQ ID NO: 36-nucleotide sequence of humanized antibody h151D-L1
SEQ ID NO: 37-amino acid sequence of humanized antibody h151D-L1
The amino acid sequence of SEQ ID NO: 38-nucleotide sequence of humanized antibody h151D-L4
SEQ ID NO: 39-amino acid sequence of humanized antibody h151D-L4
The amino acid sequence of SEQ ID NO: nucleotide sequence of 40-humanized antibody H198D-H3
SEQ ID NO: amino acid sequence of 41-humanized antibody H198D-H3
SEQ ID NO: nucleotide sequence of 42-humanized antibody h198D-L4
SEQ ID NO: amino acid sequence of 43-humanized antibody h198D-L4
SEQ ID NO: 44-primer F
SEQ ID NO: 45-primer R.

Claims (26)

1. An immunoconjugate comprising an antibody and another drug, wherein the antibody binds to the drug and the antibody has the following properties:
(1) Specifically binds to glycoprotein a repeat leader sequence (GARP);
(2) Has inhibitory activity on the immunosuppressive function of regulatory T cells;
(3) Has antibody-dependent cellular cytotoxicity (ADCC) activity; and
(4) Has antitumor activity in vivo.
2. The immunoconjugate according to claim 1, wherein the GARP is a polypeptide consisting of SEQ ID NO:1, or a pharmaceutically acceptable salt thereof.
3. The immunoconjugate according to claim 1, wherein said antibody binds:
(1) SEQ ID NO:1 at amino acid positions 366 to 377, 407 to 445 and 456 to 470,
(2) The amino acid sequence of SEQ ID NO:1 at amino acid positions 54-112 and 366-392,
(3) SEQ ID NO:1 from amino acid position 352 to amino acid sequence portion shown in 1, or
(4) SEQ ID NO:1 from amino acid position 18 to 112.
4. The immunoconjugate according to claim 1, wherein said antibody has competitive inhibitory activity against the binding to GARP of an antibody having the following heavy and light chains:
(1) Consisting of SEQ ID NO:2 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:3, or a light chain consisting of the amino acid sequence shown in figure 3,
(2) Consisting of SEQ ID NO:4 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO:5, and a light chain consisting of the amino acid sequence shown in the sequence table,
(3) Consisting of SEQ ID NO:25 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:27, or of the amino acid sequence shown in seq id No. 27
(4) Consisting of SEQ ID NO:29 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:31, or a light chain consisting of the amino acid sequence shown in seq id no.
5. The immunoconjugate according to any one of claims 1 to 4, wherein the tumor is a cancer.
6. The immunoconjugate according to claim 5, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, or hematological cancer.
7. The immunoconjugate according to claim 1, wherein said antibody has:
(1) Consisting of the amino acid sequence set forth in SEQ ID NO:2, CDRH1 consisting of the amino acid sequence shown in amino acid positions 26 to 35 in SEQ ID NO:2 and a CDRH2 consisting of the amino acid sequence shown in SEQ ID NO:2, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 99 to 107 in SEQ ID NO:3, CDRL1 consisting of the amino acid sequence shown in amino acid positions 23 to 36 as set forth in SEQ ID NO:3 and CDRL2 consisting of the amino acid sequence shown in amino acid positions 52 to 58 in SEQ ID NO:3 from amino acid position 91 to 101 as shown in 3,
(2) Consisting of the amino acid sequence set forth in SEQ ID NO:4, CDRH1 consisting of the amino acid sequence shown in amino acid positions 26 to 35 in SEQ ID NO:4 and a CDRH2 consisting of the amino acid sequence shown in amino acid positions 50 to 66, and a CDRH sequence consisting of the amino acid sequence shown in SEQ ID NO:4, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 99 to 112 in SEQ ID NO:5, CDRL1 consisting of the amino acid sequence shown in amino acid positions 23 to 36 as set forth in SEQ ID NO:5, and CDRL2 consisting of the amino acid sequence shown in amino acid positions 52 to 58 in SEQ ID NO:5 from amino acid position 91 to 100 as shown in,
(3) Consisting of the amino acid sequence set forth in SEQ ID NO:25, CDRH1 consisting of the amino acid sequence shown in amino acid positions 45 to 54 in SEQ ID NO:25 and CDRH2 consisting of the amino acid sequence shown in amino acid positions 69 to 78 in SEQ ID NO:25, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 118 to 125 in SEQ ID NO:27, CDRL1 consisting of the amino acid sequence shown in amino acid positions 44 to 54 in SEQ ID NO:27, and CDRL2 consisting of the amino acid sequence shown in amino acid positions 70 to 76 shown in SEQ ID NO: CDRL3 consisting of the amino acid sequence shown in amino acid positions 109 to 117 in SEQ ID NO, or
(4) Consisting of the amino acid sequence set forth in SEQ ID NO:29, CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 as shown in SEQ ID NO:29 and a CDRH2 consisting of the amino acid sequence shown in amino acid positions 69 to 77 as set forth in SEQ ID NO:29, and a CDRH3 consisting of the amino acid sequence shown in amino acid positions 117 to 128 as set forth in SEQ ID NO:31, CDRL1 consisting of the amino acid sequence shown in amino acid positions 44 to 54 in SEQ ID NO:31 and CDRL2 consisting of the amino acid sequence shown in amino acid positions 70 to 76 as set forth in SEQ ID NO:31 from the amino acid sequence shown in amino acid positions 109 to 117.
8. The immunoconjugate according to claim 1, wherein said antibody has:
(1) Consisting of the amino acid sequence set forth in SEQ ID NO:2, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:3 from amino acid position 1 to 112,
(2) Consisting of the amino acid sequence set forth in SEQ ID NO:4, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:5 from amino acid positions 1 to 111,
(3) Consisting of the amino acid sequence set forth in SEQ ID NO:25, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:27 of the amino acid sequence at amino acid positions 21 to 129, or
(4) Consisting of the amino acid sequence set forth in SEQ ID NO:29, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:31 from amino acid position 21 to 129.
9. The immunoconjugate according to claim 1, wherein the constant region of said antibody is a human-derived constant region.
10. The immunoconjugate according to claim 1, wherein said antibody has:
(1) Consisting of SEQ ID NO:2, and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:3, or a light chain consisting of the amino acid sequence shown in figure 3,
(2) Consisting of SEQ ID NO:4, and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO:5, or a light chain consisting of the amino acid sequence shown in figure 5,
(3) Consisting of the amino acid sequence set forth in SEQ ID NO:25, and a heavy chain consisting of the amino acid sequence shown in amino acid positions 20 to 466, and the light chain variable region of SEQ ID NO:27 of the amino acid sequence shown in amino acid positions 21 to 234, or
(4) Consisting of the amino acid sequence set forth in SEQ ID NO:29, and a heavy chain consisting of the amino acid sequence shown in amino acid positions 20 to 469 in SEQ ID NO:31 from amino acid position 21 to 234.
11. The immunoconjugate according to claim 1, wherein said antibody is humanized.
12. The immunoconjugate according to claim 11, wherein said antibody has:
a heavy chain variable region consisting of an amino acid sequence selected from the group consisting of:
(a) In SEQ ID NO:33 at amino acid positions 20 to 136,
(b) In SEQ ID NO:35 from amino acid position 20 to 136,
(c) In SEQ ID NO:41 from amino acid position 20 to 139,
(d) An amino acid sequence having at least 95% or more homology to the framework region sequence of the sequences of (a) to (c) except for each CDR sequence, and
(e) An amino acid sequence comprising deletion, substitution or addition of one or several amino acids in the framework region sequence other than each CDR sequence in the sequences of (a) to (c), and
a light chain variable region consisting of an amino acid sequence selected from the group consisting of:
(f) In SEQ ID NO:37 from amino acid position 21 to amino acid position 129,
(g) In SEQ ID NO:39 from amino acid position 21 to 129,
(h) In SEQ ID NO:43 from amino acid position 21 to 129,
(i) An amino acid sequence having at least 95% or more homology to the framework region sequence excluding each CDR sequence in the sequences of (f) to (h), and
(j) An amino acid sequence comprising a deletion, substitution or addition of one or several amino acids in the framework region sequences of the sequences of (f) to (h) except for each CDR sequence.
13. The immunoconjugate according to claim 11, wherein said antibody has:
(1) Consisting of the amino acid sequence set forth in SEQ ID NO:33, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:37 from amino acid sequence at amino acid positions 21 to 129,
(2) Consisting of the amino acid sequence set forth in SEQ ID NO:35, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:39 of the amino acid sequence at amino acid positions 21 to 129, or
(3) Consisting of the amino acid sequence set forth in SEQ ID NO:41, and a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:43 from amino acid position 21 to 129.
14. The immunoconjugate according to claim 11, wherein said antibody has:
(1) A heavy chain selected from the group consisting of: has the sequence set forth in SEQ ID NO:33, having the amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:35, and a light chain having an amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:41 of the amino acid sequence at amino acid positions 20 to 469, and
(2) A light chain selected from: has the sequence shown in SEQ ID NO:37, having an amino acid sequence at amino acid positions 21 to 234 as set forth in SEQ ID NO:39, and a light chain having an amino acid sequence at amino acid positions 21 to 234 as set forth in SEQ ID NO:43 from amino acid position 21 to 234.
15. The immunoconjugate according to claim 11, wherein said antibody has:
(1) Has the sequence shown in SEQ ID NO:33, and a light chain having an amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:37 from amino acid position 21 to amino acid position 234,
(2) Has the sequence shown in SEQ ID NO:35, and a light chain having an amino acid sequence at amino acid positions 20 to 466 set forth in SEQ ID NO:39 of the amino acid sequence at amino acid positions 21 to 234, or
(3) Has the sequence shown in SEQ ID NO:41, and a heavy chain having an amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:43 from amino acid position 21 to 234.
16. The immunoconjugate according to any one of claims 1 to 4 and 7 to 15, wherein said antibody comprises one, two or more modifications selected from: n-linked glycosylation, O-linked glycosylation, N-terminal processing, C-terminal processing, deamidation, isomerization of aspartic acid, oxidation of methionine, addition of methionine residues to the N-terminus, amidation of proline residues, and heavy chains comprising a deletion of one or two amino acids at the carboxy terminus.
17. The immunoconjugate according to claim 16, wherein one or two amino acids are deleted at the carboxy-terminus of its heavy chain.
18. The immunoconjugate according to claim 17, wherein one amino acid is deleted at each carboxy-terminus of its two heavy chains.
19. The immunoconjugate according to claim 16, wherein the proline residue at the carboxy-terminal end of its heavy chain is further amidated.
20. The immunoconjugate according to any one of claims 1 to 4 and 7 to 15, wherein the sugar chain modification is modulated so as to enhance antibody-dependent cellular cytotoxicity.
21. The immunoconjugate according to any one of claims 1 to 4 and 7 to 15, wherein said drug is a radioactive substance or a compound having a pharmacological effect.
22. The immunoconjugate according to claim 21, wherein the radioactive material is indium (a: (b)) 111 In), technetium ( 99m Tc), yttrium ( 90 Y) or iodine ( 131 I）。
23. A pharmaceutical composition comprising at least one of the immunoconjugates according to any one of claims 1 to 22.
24. Use of a pharmaceutical composition according to claim 23 for the preparation of a medicament for the treatment of tumors.
25. The use according to claim 24, wherein the tumour is a cancer.
26. The use according to claim 25, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer or hematological cancer.
CN202211442176.3A 2015-09-24 2016-09-23 anti-GARP antibodies Pending CN115869398A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2015187488 2015-09-24
JP2015-187488 2015-09-24
PCT/JP2016/078067 WO2017051888A1 (en) 2015-09-24 2016-09-23 Anti-garp antibody
CN201680056149.9A CN108026521B (en) 2015-09-24 2016-09-23 anti-GARP antibodies

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201680056149.9A Division CN108026521B (en) 2015-09-24 2016-09-23 anti-GARP antibodies

Publications (1)

Publication Number Publication Date
CN115869398A true CN115869398A (en) 2023-03-31

Family

ID=58386752

Family Applications (3)

Application Number Title Priority Date Filing Date
CN202211442176.3A Pending CN115869398A (en) 2015-09-24 2016-09-23 anti-GARP antibodies
CN201911407390.3A Pending CN110922481A (en) 2015-09-24 2016-09-23 anti-GARP antibodies
CN201680056149.9A Active CN108026521B (en) 2015-09-24 2016-09-23 anti-GARP antibodies

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN201911407390.3A Pending CN110922481A (en) 2015-09-24 2016-09-23 anti-GARP antibodies
CN201680056149.9A Active CN108026521B (en) 2015-09-24 2016-09-23 anti-GARP antibodies

Country Status (21)

Country Link
US (3) US11046780B2 (en)
EP (3) EP3354729B1 (en)
JP (4) JP6878283B2 (en)
KR (1) KR20180053316A (en)
CN (3) CN115869398A (en)
AU (3) AU2016325858B2 (en)
BR (1) BR112018005777A2 (en)
CA (1) CA2999819A1 (en)
CO (1) CO2018003542A2 (en)
DK (1) DK3354729T3 (en)
FI (1) FI3354729T3 (en)
HK (1) HK1254310A1 (en)
IL (3) IL258322B2 (en)
LT (1) LT3354729T (en)
MX (2) MX2018003594A (en)
MY (1) MY194586A (en)
PH (1) PH12018500642A1 (en)
RU (2) RU2769379C2 (en)
SG (2) SG11201802352VA (en)
TW (1) TWI751979B (en)
WO (1) WO2017051888A1 (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113583128A (en) 2013-08-01 2021-11-02 鲁汶大学 anti-GARP protein and application thereof
AU2016325858B2 (en) * 2015-09-24 2022-05-26 Daiichi Sankyo Company, Limited Anti-GARP antibody
EP3436480A4 (en) * 2016-03-30 2019-11-27 Musc Foundation for Research Development Methods for treatment and diagnosis of cancer by targeting glycoprotein a repetitions predominant (garp) and for providing effective immunotherapy alone or in combination
US11623958B2 (en) 2016-05-20 2023-04-11 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
GB201707561D0 (en) 2017-05-11 2017-06-28 Argenx Bvba GARP-TGF-beta antibodies
US10543271B2 (en) 2017-05-12 2020-01-28 Harpoon Therapeutics, Inc. Mesothelin binding proteins
JP7425049B2 (en) 2018-09-25 2024-01-30 ハープーン セラピューティクス，インク． DLL3 binding protein and method of use
WO2021024020A1 (en) 2019-08-06 2021-02-11 Astellas Pharma Inc. Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer
JPWO2021079958A1 (en) 2019-10-25 2021-04-29
WO2021231732A1 (en) 2020-05-15 2021-11-18 Bristol-Myers Squibb Company Antibodies to garp
JP2023532768A (en) 2020-07-07 2023-07-31 バイオエヌテック エスエー RNA for treatment of HPV-positive cancer
CA3198003A1 (en) * 2020-12-02 2022-06-09 Jiin-Tarng WANG Anti-garp/tgf? antibodies and methods of use
WO2022135666A1 (en) 2020-12-21 2022-06-30 BioNTech SE Treatment schedule for cytokine proteins
TW202245808A (en) 2020-12-21 2022-12-01 德商拜恩迪克公司 Therapeutic rna for treating cancer
WO2022135667A1 (en) 2020-12-21 2022-06-30 BioNTech SE Therapeutic rna for treating cancer
WO2022153195A1 (en) 2021-01-13 2022-07-21 Memorial Sloan Kettering Cancer Center Anti-dll3 antibody-drug conjugate
EP4277664A1 (en) 2021-01-13 2023-11-22 Memorial Sloan Kettering Cancer Center Antibody-pyrrolobenzodiazepine derivative conjugate
IL309831A (en) 2021-07-13 2024-02-01 BioNTech SE Multispecific binding agents against cd40 and cd137 in combination therapy for cancer
TW202333802A (en) 2021-10-11 2023-09-01 德商拜恩迪克公司 Therapeutic rna for lung cancer
WO2024018046A1 (en) 2022-07-22 2024-01-25 Institut National de la Santé et de la Recherche Médicale Garp as a biomarker and biotarget in t-cell malignancies

Family Cites Families (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL162181A (en) 1988-12-28 2006-04-10 Pdl Biopharma Inc A method of producing humanized immunoglubulin, and polynucleotides encoding the same
GB9015198D0 (en) 1990-07-10 1990-08-29 Brien Caroline J O Binding substance
ATE185601T1 (en) 1990-07-10 1999-10-15 Cambridge Antibody Tech METHOD FOR PRODUCING SPECIFIC BONDING PAIRS
DK0605522T3 (en) 1991-09-23 2000-01-17 Medical Res Council Process for producing humanized antibodies
ATE463573T1 (en) 1991-12-02 2010-04-15 Medimmune Ltd PRODUCTION OF AUTOANTIBODIES ON PHAGE SURFACES BASED ON ANTIBODIES SEGMENT LIBRARIES
CA2131151A1 (en) 1992-03-24 1994-09-30 Kevin S. Johnson Methods for producing members of specific binding pairs
GB9313509D0 (en) 1993-06-30 1993-08-11 Medical Res Council Chemisynthetic libraries
WO1995015388A1 (en) 1993-12-03 1995-06-08 Medical Research Council Recombinant binding proteins and peptides
EP2261229A3 (en) 1998-04-20 2011-03-23 GlycArt Biotechnology AG Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity
EP2270148A3 (en) 1999-04-09 2011-06-08 Kyowa Hakko Kirin Co., Ltd. Method for controlling the activity of immunologically functional molecule
ES2639222T5 (en) 2000-10-06 2023-11-24 Kyowa Kirin Co Ltd Cells that produce antibody compositions
MXPA04004184A (en) 2001-11-01 2005-01-25 Uab Research Foundation Combinations of antibodies selective for a tumor necrosis factor-related apoptosis-inducing ligand receptor and other therapeutic agents.
EP1762617A1 (en) 2003-01-07 2007-03-14 Symphogen A/S Method for manufacturing recombinant polyclonal proteins
WO2006089678A2 (en) 2005-02-22 2006-08-31 Bioinvent International Ab Antibodies and peptides binding to hiv tat, and uses thereof
US8815526B2 (en) 2005-03-31 2014-08-26 Case Western Reserve University Methods and reagents for identifying/isolating T regulatory (Treg) cells and for treating individuals
EP2001509A1 (en) 2006-04-03 2008-12-17 Medizinische Hochschule Hannover Pharmaceuticals for influencing the reaction of the human immune system
AU2007338670A1 (en) 2006-12-22 2008-07-03 Merck Sharp & Dohme Corp. Antibodies to CD200R
AU2009203699A1 (en) 2008-01-11 2009-07-16 Morphosys Ag Display vectors and methods and uses thereof
AU2009221915A1 (en) 2008-03-03 2009-09-11 Dyax Corp. Metalloproteinase 12 binding proteins
US20100260668A1 (en) 2008-04-29 2010-10-14 Abbott Laboratories Dual Variable Domain Immunoglobulins and Uses Thereof
JP5593488B2 (en) 2008-11-17 2014-09-24 独立行政法人国立がん研究センター A novel cancer targeting treatment with a complex of a substance capable of binding specifically to a constituent of cancer stroma and an antitumor compound
TWI480050B (en) 2009-02-10 2015-04-11 Daiichi Sankyo Co Ltd Anti-mst1r antibodies and uses thereof
US8841424B2 (en) 2009-05-11 2014-09-23 U3 Pharma Gmbh Humanized AXL antibodies
RS54846B1 (en) 2010-10-29 2016-10-31 Daiichi Sankyo Co Ltd Novel anti-dr5 antibody
US8440797B2 (en) 2010-12-06 2013-05-14 Dainippon Sumitomo Pharma Co., Ltd. Human monoclonal antibody
WO2012147713A1 (en) * 2011-04-25 2012-11-01 第一三共株式会社 Anti-b7-h3 antibody
TWI679212B (en) 2011-11-15 2019-12-11 美商安進股份有限公司 Binding molecules for e3 of bcma and cd3
KR20140138215A (en) 2012-03-30 2014-12-03 다이이찌 산쿄 가부시키가이샤 Novel anti-siglec15 antibody
JP6188681B2 (en) 2012-04-09 2017-08-30 第一三共株式会社 Anti-FGFR2 antibody
JP2014141434A (en) 2013-01-24 2014-08-07 Daiichi Sankyo Co Ltd Anti-robo4-antibody
ES2782248T3 (en) * 2012-10-19 2020-09-11 Daiichi Sankyo Co Ltd Antibody-drug conjugate produced by binding through a linker having a hydrophilic structure
WO2014074532A2 (en) * 2012-11-06 2014-05-15 Scholar Rock Inc. Compositions and methods for modulating cell signaling
CN113583128A (en) * 2013-08-01 2021-11-02 鲁汶大学 anti-GARP protein and application thereof
WO2016125017A1 (en) 2015-02-03 2016-08-11 Universite Catholique De Louvain Anti-garp protein and uses thereof
AU2016325858B2 (en) * 2015-09-24 2022-05-26 Daiichi Sankyo Company, Limited Anti-GARP antibody
EP3436480A4 (en) * 2016-03-30 2019-11-27 Musc Foundation for Research Development Methods for treatment and diagnosis of cancer by targeting glycoprotein a repetitions predominant (garp) and for providing effective immunotherapy alone or in combination

Also Published As

Publication number Publication date
JP6868739B2 (en) 2021-05-12
CN108026521B (en) 2022-12-06
RU2018114904A3 (en) 2020-03-03
EP3660051A1 (en) 2020-06-03
FI3354729T3 (en) 2024-04-23
TW201718643A (en) 2017-06-01
IL288784A (en) 2022-02-01
IL258322B1 (en) 2023-06-01
IL288784B1 (en) 2023-06-01
JP6878283B2 (en) 2021-05-26
EP3354729A1 (en) 2018-08-01
WO2017051888A1 (en) 2017-03-30
IL302932A (en) 2023-07-01
SG10201912570UA (en) 2020-02-27
CA2999819A1 (en) 2017-03-30
JPWO2017051888A1 (en) 2018-07-12
PH12018500642A1 (en) 2018-09-24
BR112018005777A2 (en) 2018-10-09
RU2769379C2 (en) 2022-03-30
US20220010026A1 (en) 2022-01-13
IL288784B2 (en) 2023-10-01
HK1254310A1 (en) 2019-07-19
US11046780B2 (en) 2021-06-29
AU2016325858A1 (en) 2018-04-19
EP4349997A2 (en) 2024-04-10
KR20180053316A (en) 2018-05-21
MY194586A (en) 2022-12-05
IL258322B2 (en) 2023-10-01
AU2020200866A1 (en) 2020-02-27
RU2018114904A (en) 2019-10-24
AU2020200866B2 (en) 2022-06-16
US20180327511A1 (en) 2018-11-15
CO2018003542A2 (en) 2018-07-10
LT3354729T (en) 2024-04-25
SG11201802352VA (en) 2018-04-27
EP3354729B1 (en) 2024-02-14
RU2022108079A (en) 2022-04-08
AU2016325858B2 (en) 2022-05-26
MX2023003470A (en) 2023-04-19
CN108026521A (en) 2018-05-11
JP2020202875A (en) 2020-12-24
CN110922481A (en) 2020-03-27
DK3354729T3 (en) 2024-04-22
TWI751979B (en) 2022-01-11
AU2022231706A1 (en) 2022-10-06
EP3354729A4 (en) 2019-06-12
JP7137657B2 (en) 2022-09-14
JP2021106617A (en) 2021-07-29
JP2022169801A (en) 2022-11-09
MX2018003594A (en) 2018-06-15
US20180258184A1 (en) 2018-09-13
TW202227501A (en) 2022-07-16
IL258322A (en) 2018-05-31
US10550198B2 (en) 2020-02-04

Similar Documents

Publication Publication Date Title
US20220010026A1 (en) Anti-garp antibody
JP7259104B2 (en) Anti-TROP2 antibody-drug conjugates
JP6224759B2 (en) Anti-B7-H3 antibody
JP6124377B2 (en) New anti-DR5 antibody
CN113583128A (en) anti-GARP protein and application thereof
US11459387B2 (en) Anti-CD147 antibody
CN113164780A (en) anti-LAP antibody variants and uses thereof
TWI836305B (en) Anti-garp antibody and producing method and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination