JP2014141434A - Anti-robo4-antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an antibody having antiangiogenic activity, more specifically, an antibody against ROBO4, and a pharmaceutical composition containing the antibody.SOLUTION: This invention provides a novel anti-ROBO4 monoclonal antibody, or a functional fragment thereof. The anti-ROBO4 monoclonal antibody activates downstream signals of ROBO4, has inhibitory activity against cell migration induced in ROBO4-expressing vascular endothelial cells by means of VEGF or bFGF, and shows antiangiogenic action in vivo models.

Description

  The present invention relates to an antibody having angiogenesis inhibitory activity, more specifically to an antibody against ROBO4 and a pharmaceutical composition containing the antibody.

  Roundabout homolog 4 (ROBO4) is a protein having a single transmembrane structure with a molecular weight of 110 kDa (Non-patent Document 1), and binds to slit homolog 2 (Slit2), which is known as an angiogenesis inhibitory factor. It is known to suppress neoplasia (Patent Document 1, Non-Patent Document 2). Slit2 has been reported to suppress VEGF-promoted HUVEC migration, and in vascular endothelial cells into which ROBO4 gene has been introduced (basic endothelial cell: hereinafter sometimes referred to as “EC”), an empty vector is used. It has been reported that cell migration promoted by vascular endowment growth factor (VEGF) or bFGF is suppressed as compared with introduced EC (Patent Document 1, Non-Patent Documents 2 to 4).

  In addition, in the case of EC in which the ROBO4 gene is knocked down by introducing EC or siRNA derived from a ROBO4 gene knockout mouse, cell migration promotion and tube formation by VEGF, which is observed in ECs derived from wild type mice or ECs in which control siRNA is introduced. It has been reported that the inhibitory effect of Slit2 on promotion and permeation enhancement is not recognized (Patent Document 2, Non-Patent Documents 4 to 6). Furthermore, in the mouse laser-induced choroidal neovascularization model and oxygen-induced retinopathy model, which are animal pathological models of wet age-related macular degeneration and diabetic retinopathy, Slit2 is an angiogenesis in these pathological models via ROBO4. It has been reported to suppress the increase in vascular permeability (Patent Document 2, Non-Patent Document 4).

  On the other hand, there are reports showing that ROBO4 and Slit2 do not bind to each other (Non-patent Document 9 and Patent Document 5). In terms of function, EC that knocks down the ROBO4 gene inhibits its migration and tube formation, and therefore, there is a report that ROBO4 is involved in the promotion of angiogenesis rather than angiogenesis suppression (Non-Patent Document 10, 11).

  It has been reported clinically that ROBO4 is highly expressed in the intravascular blood vessels of colorectal cancer liver metastasis, glioma, bladder cancer, breast cancer, metastatic melanoma, renal cancer, lung cancer, liver cancer and colon cancer. (Patent Document 3, Non-Patent Documents 1, 3, and 7). In addition, it has been reported that ROBO4 is also expressed in blood vessels in fibrovascular proliferative membranes of proliferative diabetic retinopathy patients (Non-patent Document 8). Thus, ROBO4 is expressed in vascular endothelial cells, particularly vascular endothelial cells newly born in a pathological state. This is thought to be due to the high expression of ROBO4 resulting in pathological angiogenesis, while ROBO4 is also expressed in a compensatory manner to suppress pathological angiogenesis.

  As described above, since ROBO4 is involved in angiogenesis-suppressing action, antibodies against ROBO4 and functional fragments thereof are considered useful for the treatment of diseases involving angiogenesis. It is not clear which will suppress or promote angiogenesis.

  As antibodies against ROBO4 (hereinafter referred to as “anti-ROBO4 antibodies”), the antibodies described in European Patent No. 1,565,491 (Patent Document 4) and WO2008 / 100805 (Patent Document 5) are known. In vivo anti-angiogenic or inhibitory action is not shown.

WO2004 / 003163 WO2008 / 073441 WO2002 / 036771 European Patent 1,565,491 WO2008 / 100805

Genomics, 2002, vol. 79, p. 547-552 Developmental Biology, 2003, 261, p. 251-267 Biochemical and Biophysical Research Communications, 2005, 332, p. 533-541 Nature Medicine, 2008, No. 14, p. 448-453 Science Translational Medicine, 2010, Vol. 2, p. 23ra19 Proceedings of the National Academy of Sciences, 2010, 107, p. 10520-10525 Oncology Reports, 2006, Vol. 15, p. 1437-1443 Molecular Vision, 2009, Vol. 15, p. 1057-1069 FASEB Journal, 2005, Vol. 19, p. 121-123 BMC Cell Biology, 2008, Vol. 9, p. 61-72 The FASEB Journal, 2009, Vol. 23, p. 513-522

One object of the present invention is to provide an antibody against ROBO4.
Another object of the present invention is to provide a pharmaceutical composition containing an anti-ROBO4 antibody having an anti-angiogenic effect.
Another object of the present invention is to provide a method for producing the antibody.
Another object of the present invention is to provide a method for inhibiting angiogenesis using the antibody.

  The present inventors diligently studied to solve the above problems, and succeeded in constructing a screening system that detects activation of downstream signals of ROBO4. In addition, by utilizing the screening system, it activates downstream signals of ROBO4, has an inhibitory activity on cell migration induced by VEGF and bFGF in ROBO4-expressing EC, and also has an anti-angiogenic effect in an in vivo model. The present invention was completed by successfully obtaining a novel anti-ROBO4 monoclonal antibody exhibiting

That is, the present invention
(1) An antibody or functional fragment thereof having the properties described in (I) to (III) below:
(I) binds to ROBO4 protein,
(II) suppress or inhibit vascular endothelial cell migration in the absence of cross-linking antibodies in vitro, and (III) suppress or inhibit angiogenesis in vivo.
(2) The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a human ROBO4 protein;
(3) The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a protein comprising an amino acid sequence of amino acid numbers 1 to 1007 of SEQ ID NO: 2 in the sequence listing;
(4) The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a protein comprising the amino acid sequence of amino acid numbers 46 to 1007 of SEQ ID NO: 2 in the sequence listing;
(5) The antibody or functional fragment thereof according to claim 3 or 4, which binds to a site consisting of the amino acid sequence of amino acid numbers 132 to 209 of SEQ ID NO: 2 in the sequence listing,
(6) The antibody or functional fragment thereof according to (1) above, which is a monoclonal antibody or functional fragment thereof,
(7) CDRH1 consisting of the amino acid sequence shown in SEQ ID NO: 44 (FIG. 25) in the sequence listing, the amino acid sequence shown in SEQ ID NO: 46 (FIG. 26) in the sequence listing, or one amino acid in the amino acid sequence was substituted CDRH2 consisting of an amino acid sequence, a heavy chain comprising CDRH3 consisting of an amino acid sequence shown in SEQ ID NO: 48 (FIG. 27) of the sequence listing, and an amino acid sequence shown in SEQ ID NO: 50 (FIG. 28) of the sequence listing Alternatively, CDRL1 consisting of an amino acid sequence in which 1 to 3 amino acids are substituted in the amino acid sequence, CDRL2 consisting of an amino acid sequence shown in SEQ ID NO: 52 (FIG. 29), and SEQ ID NO: 54 (FIG. 30) Any one of (1) to (6) above, which comprises a light chain comprising CDRL3 comprising the amino acid sequence shown in FIG. Antibody or functional fragment thereof according to one or,
(8) CDRH1 consisting of the amino acid sequence shown in SEQ ID NO: 44 (FIG. 25) in the sequence listing, amino acid sequence shown in SEQ ID NO: 46 (FIG. 26) in the sequence listing, or SEQ ID NO: 68 (FIG. 44) in the sequence listing. A heavy chain comprising CDRH2 consisting of the amino acid sequence shown in FIG. 27 and a CDRH3 consisting of the amino acid sequence shown in SEQ ID NO: 48 (FIG. 27) in the sequence listing, and the amino acid shown in SEQ ID NO: 50 (FIG. 28) in the sequence listing. CDRL1 consisting of the amino acid sequence shown in SEQ ID NO: 70 (FIG. 46) of the sequence or sequence listing, CDRL2 consisting of the amino acid sequence shown in SEQ ID NO: 52 (FIG. 29) of the sequence listing, and SEQ ID NO: 54 (FIG. 30) of the sequence listing. The antibody according to any one of claims 1 to 7, which comprises a light chain comprising CDRL3 comprising the amino acid sequence represented by Ability to fragment,
(9) It comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 31 of the sequence listing, and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 33 of the sequence listing. The antibody or the functional fragment thereof according to any one of 7;
(10) The above (1) to (8), comprising any one heavy chain variable region selected from a) to d) below and a light chain variable region selected from e) or f) Or the antibody or functional fragment thereof according to any one of
a) a heavy chain variable region comprising the amino acid sequence represented by amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32) in the sequence listing;
b) a heavy chain variable region comprising the amino acid sequence represented by amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34) in the sequence listing;
c) a heavy chain variable region comprising the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 60 (FIG. 36), or d) amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) of the sequence listing. A heavy chain variable region comprising the amino acid sequence shown,
And e) a light chain variable region comprising the amino acid sequence shown by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40), or f) amino acid numbers 21 to 134 of SEQ ID NO: 66 (FIG. 42) of the sequence listing A light chain variable region comprising the amino acid sequence shown in

(11) The method according to any one of (1) to (8) above, comprising any one of the combinations of the heavy chain variable region and the light chain variable region described in 1) to 6) below. Antibody or functional fragment thereof:
1) a heavy chain variable region comprising the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32), and amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
2) The heavy chain variable region comprising the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34), and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
3) The heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34) and the amino acid numbers 21 to 134 of SEQ ID NO: 66 (FIG. 42) A light chain variable region comprising an amino acid sequence,
4) The heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 60 (FIG. 36) and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
5) The heavy chain variable region consisting of the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) Or 6) a heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38), and SEQ ID NO: 66 (SEQ ID NO: 66) The light chain variable region comprising the amino acid sequence shown in amino acid numbers 21 to 134 of FIG. 42),
(12) The antibody or functional fragment thereof according to any one of (1) to (11) above, which is a chimeric antibody or a functional fragment thereof,
(13) The antibody or the functional fragment thereof according to any one of the above (1) to (11), which is a humanized antibody or a functional fragment thereof,
(14) The antibody or the functional fragment thereof according to any one of (1) to (13), comprising a heavy chain constant region of human IgG1 or human IgG2,
(15) The antibody or the functional fragment thereof according to any one of (1) to (6), which binds to a site on an antigen recognized by the antibody according to (7) to (14),
(16) The antibody or the functional fragment thereof according to any one of claims 1 to 6, which competes with any one of the antibodies described in (7) to (14) above for binding to the ROBO4 protein. ,
(17) The antibody according to any one of (1) to (8) above, which comprises any one of the combinations of heavy chains and light chains described in 1) to 6) below:
1) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 56 (FIG. 32) and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
2) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 58 (FIG. 34), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
3) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 58 (FIG. 34) and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 66 (FIG. 42) of the sequence listing A light chain consisting of a sequence,
4) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 60 (FIG. 36), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
5) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 62 (FIG. 38), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain comprising the sequence, or 6) a heavy chain comprising the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 62 (FIG. 38) in the sequence listing, and an amino acid number of SEQ ID NO: 66 (FIG. 42) in the sequence listing. A light chain comprising the amino acid sequence represented by 21 to 239,
(18) The antibody according to any one of (17), wherein the antibody comprises a heavy chain from which one to several amino acids on the carboxyl-terminal side have been deleted,
(19) The antibody according to any one of claims 1 to 6, wherein the amino acid sequence of any one of the antibodies according to (10) to (14) and (17) is 95% or more identical.
(20) The antibody or functional fragment thereof according to claim 15, which is a human antibody or functional fragment thereof,

(21) The nucleotide according to any one of (I) to (III) below:
(I) a nucleotide comprising a base sequence encoding part or all of the amino acid sequence of the heavy chain or light chain of the antibody according to any one of (1) to (20) above,
(II) a nucleotide comprising a base sequence comprising a base sequence encoding part or all of the amino acid sequence of the heavy chain or light chain of the antibody according to any one of (1) to (20) above, or (III ) A nucleotide comprising a base sequence encoding part or all of the heavy chain or light chain of the antibody according to any one of (1) to (20) above;
(22) A recombinant vector into which the nucleotide according to (21) is inserted.
(23) A recombinant cell into which the nucleotide according to (21) or the recombinant vector according to (23) is introduced,
(24) A cell that produces the antibody according to any one of (1) to (20) above,
(25) The method for producing an antibody or a functional fragment thereof according to any one of (1) to (20), comprising the following steps (I) and (II):
(I) the step of culturing the cell according to (23) or (24); and (II) the culture obtained in the step (I) according to any one of (1) to (20) above. Recovering the antibody or functional fragment thereof,
(26) an antibody or a functional fragment thereof produced by the production method according to (25) above,
(27) A modified form of the antibody or functional fragment thereof according to any one of (1) to (20) and (26) above,
(28) A pharmaceutical composition comprising as an active ingredient the antibody or functional fragment thereof according to any one of (1) to (20) and (26) above, or the modified form according to (27) above,
(29) The pharmaceutical composition according to the above (28), which is a therapeutic or prophylactic agent for angiogenic diseases,
(30) Angiogenic diseases are exudative age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroplasia, hemangioma, chronic inflammation, intraocular neoplasia The pharmaceutical composition according to the above (28), which is vascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, and obesity,
(31) Angiogenic diseases are exudative age-related macular degeneration, diabetic retinopathy, macular edema, posterior lens fibroproliferation, intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, and immunity of transplanted corneal tissue The pharmaceutical composition according to the above (28), which is rejection,
(32) An angiogenesis inhibitor comprising as an active ingredient the antibody or functional fragment thereof according to any one of (1) to (20) and (26) above, or the modified product according to claim 27,
About.

  ADVANTAGE OF THE INVENTION According to this invention, the therapeutic agent etc. of an angiogenesis disease containing the antibody which couple | bonds with ROBO4 and has an angiogenesis inhibitory effect can be obtained.

The figure which shows the presence or absence of the fluctuation | variation of the reporter activity which used NF- (kappa) B, GAS, ISRE, IL-8 promoter, and TCF as a response element by transient expression to HEK293 cell of human ROBO4. Error bars in the figure indicate standard errors (n = 3). The figure which shows the presence or absence of the fluctuation | variation of IL-8 promoter activity by the transient expression to HEK293 cell of the full length of human ROBO4, or an intracellular region defect | deletion body. Error bars in the figure indicate standard errors (n = 5 or 10). The figure which shows the fluctuation | variation of IL-8 promoter activity in the human ROBO4 introduction | transduction HEK293 cell by an anti- ROBO4 antibody and MAb1. Error bars in the figure indicate standard errors (n = 3). The figure which shows the fluctuation | variation of IL-8 promoter activity in human ROBO4 introduction | transduction HEK293 cell by anti- ROBO4 antibody, MAb2, MAb3, or MAb4. Error bars in the figure indicate standard errors (n = 3). The figure which shows the fluctuation | variation of the migration ability of HUVEC in the presence of VEGF or bFGF by anti-ROBO4 antibody and MAb1. Error bars in the figure indicate standard errors (n = 3 or 4). The figure which shows the fluctuation | variation of the migration ability of HUVEC in presence of bFGF by anti-ROBO4 antibody, MAb2, MAb3, MAb4. Error bars in the figure indicate standard errors (n = 4). The figure which shows the presence or absence of the binding activity with respect to anti- ROBO4 antibody, human ROBO4 of MAb1, mouse | mouth ROBO4, rat ROBO4, or cynomolgus monkey ROBO4. The figure which shows the presence or absence of the binding activity with respect to human ROBO1, human ROBO2, or human ROBO3 of anti-ROBO4 antibody and MAb1. The upper row shows the results with MAb1, and the lower row shows the results with a positive control antibody for confirming whether these proteins are expressed on the cell surface. The figure which shows the presence or absence of the binding activity with respect to the human ROBO4 extracellular region domain deletion body of anti-ROBO4 antibody and MAb1. The upper row shows the results with MAb1, and the lower row shows the results with an anti-FLAG antibody that confirms whether these proteins are expressed on the cell surface. The figure which shows the fluctuation | variation of angiogenesis in the laser induction choroidal neovascularization model of anti- ROBO4 antibody and MAb1. Error bars in the figure indicate standard errors (n = 4 eyes), and ■ or □ indicate the results for each eye. The figure which shows the fluctuation | variation of IL-8 promoter activity in human ROBO4 introduction | transduction HEK293 cell by anti- ROBO4 chimeric antibody, cMAb1-1, and cMAb1-2. Error bars in the figure indicate standard errors (n = 3). The figure which shows the fluctuation | variation of the migration ability of HUVEC in presence of bFGF by anti-ROBO4 chimeric antibody, cMAb1-1, and cMAb1-2. Error bars in the figure indicate standard errors (n = 4). Human ROBO4 full length cDNA (SEQ ID NO: 1) Full-length amino acid sequence of human ROBO4 (SEQ ID NO: 2) Nucleotide sequence of cDNA encoding MAb1 heavy chain variable region (SEQ ID NO: 30) Amino acid sequence of MAb1 heavy chain variable region (SEQ ID NO: 31) Nucleotide sequence of cDNA encoding MAb1 light chain variable region (SEQ ID NO: 32) Amino acid sequence of MAb1 light chain variable region (SEQ ID NO: 33) Nucleotide sequence of cDNA encoding cMAb1 light chain (SEQ ID NO: 37) cMAb1 light chain amino acid sequence (SEQ ID NO: 38) Nucleotide sequence of cDNA encoding cMAb1-1 heavy chain (SEQ ID NO: 39) Amino acid sequence of cMAb1-1 heavy chain (SEQ ID NO: 40) Nucleotide sequence of cDNA encoding cMAb1-2 heavy chain (SEQ ID NO: 41) cMAb1-2 heavy chain amino acid sequence (SEQ ID NO: 42) Amino acid sequence of MAb1 heavy chain CDRH1 (SEQ ID NO: 44) Amino acid sequence of MAb1 heavy chain CDRH2 (SEQ ID NO: 46) Amino acid sequence of MAb1 heavy chain CDRH3 (SEQ ID NO: 48) Amino acid sequence of MAb1 light chain CDRL1 (SEQ ID NO: 50) Amino acid sequence of MAb1 light chain CDRL2 (SEQ ID NO: 52) Amino acid sequence of MAb1 light chain CDRL3 (SEQ ID NO: 54) Nucleotide sequence of cDNA encoding hMAb1-H1 type heavy chain (SEQ ID NO: 55) Amino acid sequence of hMAb1-H1 type heavy chain (SEQ ID NO: 56). Nucleotide sequence of cDNA encoding hMAb1-H2 type heavy chain (SEQ ID NO: 57) Amino acid sequence of variable region of hMAb1-H2 type heavy chain (SEQ ID NO: 58) Nucleotide sequence of cDNA encoding variable region of hMAb1-H3 type heavy chain (SEQ ID NO: 59) Amino acid sequence of variable region of hMAb1-H3 type heavy chain (SEQ ID NO: 60) Nucleotide sequence of cDNA encoding variable region of hMAb1-H4 type heavy chain (SEQ ID NO: 61) Amino acid sequence of variable region of hMAb1-H4 type heavy chain (SEQ ID NO: 62) Nucleotide sequence of cDNA encoding variable region of hMAb1-L1 type light chain (SEQ ID NO: 63) Amino acid sequence of variable region of hMAb1-L1 type light chain (SEQ ID NO: 64) Nucleotide sequence of cDNA encoding variable region of hMAb1-L2 type light chain (SEQ ID NO: 65) Amino acid sequence of variable region of hMAb1-L2 type light chain (SEQ ID NO: 66) Amino acid sequence of CDRH1 of hMAb1-H2 or H4 type heavy chain (SEQ ID NO: 67) Amino acid sequence of CDRH2 of hMAb1-H2 or H4 type heavy chain (SEQ ID NO: 68) Amino acid sequence of CDRH3 of hMAb1-H2 or H4 type heavy chain (SEQ ID NO: 69) Amino acid sequence of CDRL1 of hMAb1-L2 type light chain (SEQ ID NO: 70) Amino acid sequence of CDRL2 of hMAb1-L2 type light chain (SEQ ID NO: 71) Amino acid sequence of CDRL3 of hMAb1-L2 type light chain (SEQ ID NO: 72) The figure which shows the fluctuation | variation of the IL-8 promoter activity in the human ROBO4 introduction | transduction HEK293 cell by H-1040, H-1143, H-1140, H-2040, H-2143, and H-2140. The figure which shows the fluctuation | variation of the migration ability of HUVEC in the presence of bFGF by H-1143, H-2140, and H-2143. Error bars in the figure indicate standard errors (n = 4). The figure which shows the seed crossing property of H-1143. The figure which shows the seed crossing property of H-2140. The figure which shows the seed crossing property of H-2143. The figure which shows the binding specificity of H-1143, H-2140, and H-2143. The figure which shows the fluctuation | variation of angiogenesis in the laser induction choroidal neovascularization model of H-2143. Error bars in the figure indicate standard errors (n = 3-4 eyes).

1. Definitions In the present invention, “gene” means a nucleotide containing a nucleotide sequence encoding a protein amino acid or a complementary strand thereof, for example, a nucleotide containing a nucleotide sequence encoding a protein amino acid or a complementary strand thereof. Certain polynucleotides, oligonucleotides, DNA, mRNA, cDNA, cRNA and the like are included in the meaning of “gene”. Such a gene is a single-stranded, double-stranded, or triple-stranded nucleotide, and an assembly of a DNA strand and an RNA strand, and ribonucleotide (RNA) and deoxyribonucleotide (DNA) are mixed on one nucleotide strand. Also included within the meaning of “gene” are double-stranded or triple-stranded nucleotides comprising such nucleotide chains. Examples of the “ROBO4 gene” of the present invention include DNA, mRNA, cDNA, cRNA and the like containing a base sequence encoding the amino acid sequence of ROBO4 protein.

  In the present invention, “nucleotide” and “nucleic acid” are synonymous. For example, DNA, RNA, probe, oligonucleotide, polynucleotide, primer and the like are also included in the meaning of “nucleotide”. Such nucleotide is a nucleotide composed of a single strand, a double strand, or three or more strands, and an assembly of a DNA strand and an RNA strand, and ribonucleotide (RNA) and deoxyribonucleotide (DNA) on a single nucleotide strand. Also included within the meaning of “nucleotide” are those that are intermingled and aggregates of two or more strands containing such nucleotide strands.

In the present invention, “polypeptide”, “peptide” and “protein” are synonymous.
In the present invention, “antigen” is sometimes used to mean “immunogen”.
In the present invention, “cells” include various cells derived from individual animals, subcultured cells, primary culture cells, cell lines, recombinant cells, and the like.
In the present invention, an antibody that recognizes the ROBO4 protein may be referred to as an “anti-ROBO4 antibody”. “Anti-ROBO4 antibody” includes anti-ROBO4 chimeric antibody, anti-ROBO4 humanized antibody, anti-ROBO4 human antibody and the like.

  The “functional fragment of an antibody” in the present invention means an antibody fragment that exhibits at least a part of the function exhibited by the original antibody. Examples of the “functional fragment of an antibody” include, but are not limited to, Fab, F (ab ′) 2, scFv, Fab ′, single chain immunoglobulin and the like. Such functional fragments of antibodies are recombinant proteins produced in appropriate host cells using recombinant genes in addition to those obtained by treating full-length antibody protein molecules with enzymes such as papain and pepsin. May be.

  In the present invention, the “site” to which the antibody binds, that is, the “site” recognized by the antibody means a partial peptide or a partial higher structure on the antigen to which the antibody binds or recognizes. In the present invention, such a site is also referred to as an epitope or an antibody binding site. As a site | part on ROBO4 protein which the anti- ROBO4 antibody of this invention couple | bonds or recognizes, the partial peptide on a ROBO4 protein, a partial higher-order structure, etc. can be illustrated.

  It is known that there are three complementarity determining regions (CDRs) in each of the heavy and light chains of an antibody molecule. Complementarity-determining regions, also called hypervariable domains, are sites in the variable regions of antibody heavy and light chains that have particularly high variability in primary structure. In the primary structure of the polypeptide chain, it is usually separated at three points. In the present invention, for the complementarity determining region of an antibody, the complementarity determining region of the heavy chain is denoted as CDRH1, CDRH2, CDRH3 from the amino terminal side of the heavy chain amino acid sequence, and the complementarity determining region of the light chain is defined as the light chain amino acid. CDRL1, CDRL2, and CDRL3 are represented from the amino terminal side of the sequence. These sites are close to each other on the three-dimensional structure and determine the specificity for the antigen to be bound.

  In the present invention, the “antibody variant” has an amino acid sequence in which amino acids are substituted, deleted, added and / or inserted (hereinafter collectively referred to as “mutation”) in the amino acid sequence of the original antibody. And a polypeptide that binds to the ROBO4 protein of the present invention. The number of variant amino acids in such antibody variants is 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9 1 to 10, 1 to 12, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 40, or 1 to 50. Such antibody variants are also included in the “antibody” of the present invention.

  In the present invention, “several” in “1 to several” refers to 3 to 10.

  Examples of the activity / property exhibited by the antibody of the present invention include biological activity, physicochemical properties, and the like. Specifically, various biological activities, binding activity to antigens and epitopes, stability during production and storage Property, heat stability, etc. can be raised.

  In the present invention, “hybridize under stringent conditions” means hybridization at 65 ° C. in a solution containing 5 × SSC, and then in an aqueous solution containing 2 × SSC-0.1% SDS. 20 minutes at 65 ° C. in an aqueous solution containing 0.5 × SSC-0.1% SDS for 20 minutes at 65 ° C. and 65 ° C. in an aqueous solution containing 0.2 × SSC-0.1% SDS Means to hybridize under the conditions of washing for 20 minutes or under equivalent conditions. SSC is an aqueous solution of 150 mM NaCl-15 mM sodium citrate, and nx SSC means n-fold concentration of SSC.

2. ROBO4 protein In this specification, "ROBO4" and "ROBO4 protein" are used synonymously.
(2-1) Properties The ROBO4 protein of the present invention has the following properties.
(I) ROBO4 has a single transmembrane structure with a molecular weight of about 110 kDa, and is a receptor protein of the Slit2 protein involved in angiogenesis. The ROBO4 protein of the present invention may exist in a form released from a membrane such as a cell membrane, but may be in a shape bound to a membrane such as a cell membrane. The molecular weight here means an apparent molecular weight under non-reducing conditions in SDS-PAGE. There are two immunoglobulin-like domains (hereinafter referred to as “Ig-like domains”) and two fibronectin type III domains in the extracellular region on the N-terminal side of ROBO4, and in the intracellular region on the C-terminal side. A proline-rich region is present. In this specification, the two immunoglobulin-like domains are referred to as Ig-like domain 1 and Ig-like domain 2 from the amino terminal side, respectively. Human ROBO4 protein consists of the amino acid sequence of amino acid numbers 28 to 1007 of SEQ ID NO: 2 in the sequence listing. Amino acid numbers 1 to 27 in SEQ ID NO: 2 are secretion signals, 28 to 467 are extracellular regions, 46 to 131 are Ig-like domains 1, 137 to 224 are Ig-like domains 2, and 252 to 340 are fibronectin types. III domains 1, 347 to 438 are fibronectin type III domain 2, 468 to 490 are intracellular regions, and 491 to 1007 are intracellular regions.

(Ii) It has an angiogenesis inhibitory action. In the present invention, “anti-angiogenesis” refers to inhibiting and / or inhibiting angiogenesis either directly or jointly with other factors or as an association with other factors. Means. The angiogenesis inhibitory action can be evaluated using, for example, an inhibitory action on vascular permeability enhancement, cell migration promoting activity, or tube formation activity by VEGF as an index.

(Iii) comprising the amino acid sequence described in any one of the following (a) to (e) (hereinafter referred to as “ROBO4 amino acid sequence”), consisting of an amino acid sequence comprising the ROBO4 amino acid sequence, or It consists of the ROBO4 amino acid sequence.
(A) the amino acid sequence represented by SEQ ID NO: 2 (FIG. 14) in the sequence listing;
(B) 80% or more, 82% or more, 84% or more, 86% or more, 88% or more, 90% or more, 92% or more, 94% or more with the amino acid sequence shown in SEQ ID NO: 2 (FIG. 14) Amino acid sequences of polypeptides exhibiting sequence identity of 96% or more, 98% or more, or 99% or more and exhibiting an anti-angiogenic action;
(C) 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 in the amino acid sequence shown in SEQ ID NO: 2 in the Sequence Listing (1) 1-20, 1-15, 1-10, 1-6, 1-5, 1-4, 1-3, 1 or 2, or 1 amino acid An amino acid sequence of a polypeptide comprising a substitution, deletion, addition or insertion and inhibiting angiogenesis;
(D) an amino acid sequence of a polypeptide that is deleted from amino acid numbers 1 to 45 or 1 to 131 of SEQ ID NO: 2 in the sequence listing and that suppresses angiogenesis;
(E) encoded by a nucleotide sequence of a nucleotide that hybridizes under stringent conditions with a nucleotide having a nucleotide sequence complementary to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 (FIG. 14) And an amino acid sequence of a polypeptide that suppresses angiogenesis.
The ROBO4 protein may also exist as all or part of a homo or hetero oligo aggregate composed of two or more subunits.
Individual, tissue, body fluid, cell, fraction containing ROBO4 protein, purified or partially purified ROBO4 protein preparation, etc., or between multiple individuals, tissues, cells, ROBO4 protein-containing fraction or ROBO4 protein preparation The amino acid sequence and / or other properties of the ROBO4 protein may not be the same or may not be uniform. One individual, tissue, body fluid, cell, fraction containing ROBO4 protein, purified or partially purified ROBO4 protein preparation, etc. contain multiple types of ROBO4 proteins having different amino acid sequences and / or different properties. Also good. In addition, the amino acid sequence and / or other properties of the ROBO4 protein may differ among a plurality of individuals, tissues, cells, ROBO4 protein-containing fractions, or ROBO4 protein preparations. Even proteins having different amino acid sequences and / or properties are included in the “ROBO4 protein” of the present invention as long as they have the properties described in (i) to (iii) above.

(Iv) The ROBO4 protein of the present invention is a vertebrate, preferably a mammal, more preferably a rodent such as a mouse or a rat, and a human, more preferably a human or mouse tissue, a cell derived from such a tissue. Or a culture of such cells. Such tissues and cells are not particularly limited as long as ROBO4 protein is present, and examples thereof include joint tissues, blood, lymph, thymus, spleen, and cells derived from any of them. Suitable tissues and cells are tissues and cells derived from an animal or patient in which angiogenesis is occurring. However, the origin of the ROBO4 protein of the present invention is not limited to the above-mentioned ones, and even if it is derived from other animal species, other tissues, other cells, etc., the above (i) to (iii) are described. It is included in the meaning of the ROBO4 protein of the present invention.
The ROBO4 protein of the present invention may be either a natural type or a recombinant type. In addition, fusion with other peptides and proteins such as carriers and tags is also included in the meaning of the ROBO4 protein. Furthermore, a chemical modification including addition of a polymer such as PEG and / or a biological modification including a sugar chain modification is also included in the meaning of the ROBO4 protein. ROBO4 protein fragments are also included in the meaning of the ROBO4 protein of the present invention. Among the ROBO4 protein fragments, those having the properties described in (ii) above are referred to as ROBO4 protein functional fragments.

(2-2) ROBO4 Gene The ROBO4 gene of the present invention comprises the nucleotide sequence described in any one of the following (a) to (c) (hereinafter referred to as “ROBO4 gene sequence”), or ROBO4 It consists of a base sequence containing the gene sequence or consists of the ROBO4 gene sequence:
(A) a base sequence represented by SEQ ID NO: 1 (FIG. 13) in the sequence listing;
(B) encodes an amino acid sequence of a polypeptide that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 (FIG. 13) in the sequence listing and suppresses angiogenesis And (c) 1 to 150, 1 to 140, 1 to 130, 1 to 120, 1 to 110, 1 in the nucleotide sequence shown in SEQ ID NO: 1 (FIG. 13) 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 45, 1 to 40, 1 to 30, 1, 25 to 1, 1-20, 1-15, 1-10, 1-6, 1-5, 1-4, 1-3, 1 or 2, or 1 base Substitution, deletion, addition or insertion and blood Nucleotide sequence encoding the amino acid sequence of suppressing polypeptide newborn.
The expression of the ROBO4 gene is increased in a disease in which angiogenesis occurs, for example, a blood vessel in a fibrovascular proliferative membrane of a proliferative diabetic retinopathy patient or a blood vessel in a tumor. Other, wet age-related macular degeneration, macular edema, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, transplanted corneal tissue and others ROBO4 gene in a tissue or blood fraction derived from a patient suffering from a possible disease associated with angiogenesis such as immune rejection of other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, obesity, etc. It is thought that the expression of is increased.
The ROBO4 gene expression and expression level may be measured using either the ROBO4 gene transcript or the ROBO4 protein as an index. The former is based on the RT-PCR method, the Northern blot hybridization method, etc., and the latter is the enzyme-linked immunogen. -Sorbent assay (hereinafter referred to as "ELISA") and the like.

(2-3) Preparation of protein The ROBO4 protein of the present invention is purified and isolated from animal tissues (including body fluids), cells derived from the tissues or cell cultures, genetic recombination, in vitro translation, chemistry It can be prepared by synthesis or the like.

(2-3-1) Purification and isolation of natural ROBO4 Natural ROBO4 protein is, for example, exudative age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, lens Posterior fibroproliferation, hemangioma, chronic inflammation, intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, obesity, etc. It can be purified and isolated from tissues (including body fluids, cells, etc.) derived from patients suffering from angiogenic diseases or non-human animals, cells derived from such tissues, cultures of such cells, and the like. Such non-human animals also include the disease model animals. The animal used for the preparation of the model is not particularly limited as long as it is a vertebrate, but is preferably a mammal, more preferably a rodent such as a mouse or a rat, and even more preferably a mouse or a rat. It is. The tissue and cells of such a patient or model animal are not particularly limited as long as ROBO4 protein exists, but for example, cells derived from joint tissue, blood, lymph, thymus, spleen, or any of them Etc. Suitable tissues and cells are those from patients or model animals that are developing angiogenesis or exhibiting similar symptoms. However, the origin of the ROBO4 protein of the present invention is not limited to the above, and may be derived from other animal species, other tissues, other cells, and the like.
Purification and isolation from such tissues, cells, cell cultures and the like can be performed by combining techniques such as fractionation and chromatography well known to those skilled in the art. Such techniques include, but are not limited to, salting out, gel filtration, ion exchange chromatography, affinity chromatography, hydrophobic chromatography, normal phase or reverse phase chromatography. A column for affinity chromatography can be prepared by preparing and packing an affinity gel cross-linked with an anti-ROBO4 monoclonal antibody. Add a crude or partially purified fraction containing ROBO4 protein to such a column, then remove non-specific adsorbate with sterile phosphate buffered saline (PBS), and then add elution buffer. Thus, the ROBO4 protein can be selectively recovered. The ROBO4 protein-containing solution can be subjected to buffer exchange and / or concentration with a concentration device such as gel filtration or Centriprep.

(2-3-2) Preparation of recombinant ROBO4 protein The ROBO4 protein of the present invention can also be prepared as a recombinant. That is, a gene encoding the amino acid sequence of ROBO4 protein or ROBO4 protein fragment can be introduced into a host cell, and ROBO4 protein can be recovered from the culture of such cells. For example, if the ROBO4 gene or a fragment thereof is inserted into an expression vector, and then the recombinant cell obtained by introducing the recombinant vector into a prokaryotic or eukaryotic host cell is incubated, the ROBO4 protein is expressed in the cell. be able to. As an expression form, known forms such as secretory expression, intracellular soluble expression, inclusion body method and the like can be used. In addition, the amino terminus (N terminus) and / or carboxy terminus (C terminus) is not only the same molecule as the natural type, but also a secretory signal, intracellular localization signal, affinity purification tag, and fusion protein with partner peptide It can also be expressed. The purification and isolation of the ROBO4 protein from the recombinant cell culture is performed by appropriately combining operations such as fractionation and chromatography described in the purification and isolation of the natural ROBO4 protein described in (2-3-1). Can be performed.
The ROBO4 gene or a fragment thereof can be prepared by methods well known to those skilled in the art.
For example, a polymerase chain reaction (hereinafter referred to as “PCR”: Saiki, RK, et al.) Using a cDNA library expressing ROBO4 as a template and a set of primers capable of specifically amplifying the sequence. al., Science (1988) 239, p. 487-489), using a mRNA fraction expressing ROBO4 as a template, a primer that can reverse-transcribe the sequence and a set of primers that can specifically amplify the sequence Reverse transcription PCR (hereinafter referred to as “RT-PCR”), expression cloning using an immunoassay, cDNA cloning using a partial amino acid sequence of purified ROBO4 protein, and the like.

(2-3-3) In vitro translation The ROBO4 protein of the present invention can also be prepared by in vitro translation. Such a translation method is not particularly limited as long as it is a method using a cell-free translation system containing an enzyme, a substrate and an energy substance necessary for transcription and translation. For example, Roche Diagnostics Co., Ltd. A method of using a rapid translation system (RTS) can be given.

(2-3-4) Chemical synthesis The ROBO4 protein of the present invention can also be prepared by chemical synthesis. Examples of the chemical synthesis method include peptide solid phase synthesis methods such as Fmoc synthesis method and Boc synthesis method.

3. Anti-ROBO4 antibody (3-1) Types of anti-ROBO4 antibody The antibody of the present invention may be either a monoclonal antibody or a polyclonal antibody. Examples of the monoclonal antibody of the present invention include non-human animal-derived antibodies (non-human animal antibodies), human-derived antibodies (human antibodies), chimeric antibodies, humanized antibodies, and the like.
Examples of non-human animal antibodies include antibodies derived from vertebrates such as mammals and birds. Examples of the antibody derived from mammals include antibodies derived from rodents such as mouse antibodies and rat antibodies. Examples of avian-derived antibodies include chicken antibodies.
Examples of the chimeric antibody include, but are not limited to, an antibody obtained by binding a variable region derived from a non-human animal antibody and a human antibody (human immunoglobulin) constant region. Examples of variable regions derived from non-human animal antibodies include MAb1-derived heavy chain and light chain variable regions described below.
As humanized antibodies, CDRs in the variable region of a non-human animal antibody are transplanted to a human antibody (variable region of human immunoglobulin). However, the present invention is not limited to these, and those obtained by substituting one or more amino acids derived from any of these non-human animal antibodies with human amino acids. Examples of the CDR in the variable region of the non-human animal antibody include CDRH1 to 3 in the heavy chain variable region derived from MAb1 described below and CDRL1 to 3 in the light chain variable region.
The human antibody is not particularly limited as long as it is an antibody that recognizes the antigen of the present invention. And human antibodies that bind to the same site.
The antibody in the present invention may be an antibody composed of a portion derived from a plurality of different antibodies, for example, a heavy chain and / or a light chain exchanged between a plurality of different antibodies, a heavy chain and / or Examples include those in which the entire length of the light chain is exchanged, those in which only the variable region or only the constant region is exchanged, and those in which all or part of the CDR is exchanged. The heavy chain variable region and the light chain variable region of the chimeric antibody may be derived from different antibodies of the present invention. CDRH1-3 and CDRL1-3 in the variable regions of the heavy and light chains of the humanized antibody may be derived from two or more antibodies of the invention. CDRH1 to 3 and CDRL1 to 3 in the variable region of the heavy and light chains of the human antibody may be a combination of CDRs of two or more of the antibodies of the present invention.
The isotype of the monoclonal antibody of the present invention is not particularly limited, and examples thereof include IgG such as IgG1, IgG2, IgG3, and IgG4, IgA such as IgM, IgA1, and IgA2, IgD, IgE, and the like. May include IgG and IgM, and more preferably IgG2. The isotype and subclass of a monoclonal antibody can be determined by, for example, the Octellony method, ELISA method, Radio immunoassay (hereinafter referred to as “RIA”) method, etc. RAD MONOCLONAL ANTIBODY ISOTYPING TEST KIT (manufactured by serotec, etc.) can also be used.

(3-2) Binding specificity of anti-ROBO4 antibody The antibody of the present invention recognizes the ROBO4 protein. In other words, the antibody of the present invention binds to ROBO4 protein. Such an antibody is referred to as an “anti-ROBO4 antibody”. The preferred antibody of the present invention specifically recognizes the ROBO4 protein. In other words, preferred antibodies of the present invention specifically bind to ROBO4 protein. Furthermore, the more preferred antibody of the present invention specifically binds to the Ig-like domain of the ROBO4 protein. Examples of such Ig-like domains include Ig-like domain 1 and Ig-like domain 2. A more preferred antibody of the present invention is a region consisting of the amino acid sequence of amino acid numbers 132 to 209 of SEQ ID NO: 2 in the sequence listing. Recognize The antibodies of the invention bind to human ROBO4 protein, monkeys, preferably cynomolgus monkey ROBO4 protein, and rabbit ROBO4 protein, but not to mouse or rat ROBO4 protein.
In the present invention, “specific recognition”, that is, “specific binding” means binding that is not non-specific adsorption. As a criterion for determining whether or not the binding is specific, for example, a dissociation constant (hereinafter referred to as “KD”) can be given. The KD value for the ROBO4 protein of the preferred antibody of the present invention is 1 × 10 ⁻⁵ or less, 5 × 10 ⁻⁶ or less, 2 × 10 ⁻⁶ or less, or 1 × 10 ⁻⁶ or less, more preferably 5 × 10 ^−7. 2 × 10 ⁻⁷ or less or 1 × 10 ⁻⁷ or less, more preferably 5 × 10 ⁻⁸ or less, 2 × 10 ⁻⁸ or less or 1 × 10 ⁻⁸ or less, and even more preferably 5 × 10 ⁻⁹ or less, 2 × 10 ⁻⁹ or less or 1 × 10 ⁻⁹ or less, optimally 5 × 10 ⁻¹⁰ or less, 2 × 10 ⁻¹⁰ or less, or 1 × 10 ⁻¹⁰ or less.
The binding between an antigen and an antibody in the present invention can be measured or determined by ELISA, RIA, Surface Plasmon Resonance (hereinafter referred to as “SPR”) analysis method or the like. As equipment used for SPR analysis, BIAcore ^™ (manufactured by GE Healthcare), ProteOn ^™ (manufactured by BioRad), SPR-Navi ^™ (manufactured by BioNavis), Spreeta ^™ (manufactured by Texas Instruments), SPri-PlexII ^™ ( Horiba SPR ^™ (manufactured by Metrohm) and the like can be exemplified. The binding between the antigen expressed on the cell surface and the antibody can be measured by a flow cytometry method or the like.

(3-3) In vitro antiangiogenic activity of anti-ROBO4 antibody The antibody of the present invention has an antiangiogenic activity in vitro in the absence of a cross-link antibody. Antibodies that do not show pharmacological activity in the absence of cross-linking antibodies in vitro and show pharmacological activity in vivo are known (Cancer Cell (2011), 19, p. 101-113). This is because, in vivo, there are leukocytes expressing Fcγ receptor having the same function as the cross-link antibody (Nature (2008), 8, p. 34-47), so even without the cross-link antibody. In the presence of leukocytes, it is considered that a cross-link is established and exhibits pharmacological activity. However, in an actual living body, the number of leukocytes in the lesion varies from individual to individual (Cancer Res (2011), 71, 5670-5679), and antibodies that exhibit pharmacological activity depend on the cross-linking by leukocytes. It is expected that there will be a difference in the effect. The antibody of the present invention exhibits excellent angiogenesis-inhibiting activity even in the absence of cross-linking antibodies in vitro, and thus is considered to have an angiogenesis-inhibiting action that does not depend on the leukocyte count even in vivo. Is preferred.
The angiogenesis inhibitory activity means an activity that inhibits the proliferation, migration, lumen formation and the like of vascular endothelial cells. The angiogenesis inhibitory activity can be evaluated in vitro by a vascular permeability test, a vascular endothelial cell migration test, and a tube formation test.
For example, the vascular permeability test is evaluated by seeding normal human umbilical vein endothelial cells (HUVEC) on the upper layer of Boyden Chamber with a pore size of 1 μm to form a monolayer, and then measuring the permeation amount of FITC-labeled dextran, etc. it can. The amount of permeation can be measured using, for example, In Vitro Vascular Permeability Assay (Cat. ECM640, manufactured by Millipore). When the antibody exhibits an action of suppressing the permeation amount of FITC-labeled dextran by addition of 10 μg / mL or less, it can be evaluated as having an anti-angiogenic activity and an anti-angiogenic activity. The antibody of the present invention exhibits vascular permeability-inhibiting activity at 10 μg / mL or less, more preferably 1 μg / mL or less, and particularly preferably 0.5 μg / mL or less, under the above measurement conditions.
The cell migration test can be evaluated by seeding HUVEC on the upper layer of Boyden Chamber with a pore size of 3-8 μm, adding a medium containing endothelial cell migration promoting factors such as VEGF to the lower layer, and measuring the number of cells migrating to the lower layer. . In the case of showing the action of reducing the number of migratory cells of HUVEC, it can be evaluated that it has an action of inhibiting the migration of vascular endothelial cells and has an anti-angiogenic activity. For example, it can be measured using a vascular endothelial cell migration assay system (Cat. 354143, manufactured by BD Biosciences). The antibody of the present invention exhibits cell migration inhibitory activity, preferably 10 μg / mL or less, more preferably 1 μg / mL or less, particularly preferably 0.5 μg / mL or less, under the above measurement conditions.
The lumen formation test can be evaluated by seeding HUVEC in a cell culture container coated with Matrigel, and measuring the number of branch points and the length of the lumen structure formed by HUVEC on Matrigel. When the effect of reducing the number of branch points and the lumen length of the luminal structure is exhibited, it can be evaluated as having a luminal formation inhibitory activity and an angiogenesis inhibitory activity. For example, it can be measured using a vascular endothelial cell tube formation assay system (Cat. 354149, manufactured by BD Biosciences) or the like. The antibody of the present invention exhibits a lumen formation inhibitory activity at 10 μg / mL or less, more preferably 1 μg / mL or less, and particularly preferably 0.5 μg / mL or less under the above measurement conditions.
However, as long as it is a system that can measure angiogenesis induced by ROBO4 protein and its inhibition, it is not limited to the above-described test.
The cross-linked antibody means an antibody that binds to the Fc region of the antibody of the present invention and has an action of crosslinking two or more molecules of the antibody of the present invention. For example, when the Fc region of the antibody of the present invention is derived from a mouse, the antibody of the present invention binds to the mouse Fc region, and each of the antibodies of the present invention binds to two binding sites of the cross-linked antibody. An antibody that associates two or more molecules of the antibody according to the present invention is a cross-linked antibody.
“Having an anti-angiogenic activity in the absence of a cross-link antibody” means that an angiogenesis-inhibiting action is exhibited even in the evaluation system for angiogenesis inhibition, for example, in the above-described evaluation system without the presence of a cross-link antibody. means.
“Having an anti-angiogenic activity in the presence of a cross-link antibody” means that in an evaluation system related to angiogenesis, for example, the above-described evaluation system related to an anti-angiogenic activity, no anti-angiogenic activity is exhibited in the absence of a cross-link antibody. It means that the anti-angiogenic activity is exhibited when one or more cross-link antibodies, preferably two or more molecules, coexist with one antibody molecule of the present invention.

(3-4) In Vivo Angiogenesis Suppressing or Inhibitory Activity of Anti-ROBO4 Antibody The antibody of the present invention suppresses or inhibits angiogenesis in vivo. In vivo angiogenesis inhibitory or inhibitory activity can be evaluated by a disease state model animal according to a conventional method. For example, the laser-induced choroidal neovascularization model described in Example 4) -6, which will be described later, is widely used as an angiogenic pathological model, and the amount of neovascularization can be evaluated as a score. Also in the case of a patient, for example, before and after administration of the antibody of the present invention, a tumor specimen is collected from a tumor patient by biopsy, the blood vessel density of the intravascular tumor is measured by immunohistochemical analysis (IHC), and the amount of new blood vessels is determined. It can be scored.

(3-5) Downstream signal activation by anti-ROBO4 antibody The anti-ROBO4 antibody of the present invention may be subjected to an evaluation system using a cell line or a primary cultured cell in which some response is induced by the ROBO4 protein. Examples of such cell lines include mouse vascular endothelial cell line (ATCC NO. CRL-2779), and examples of primary cultured cells include mouse vascular endothelial cells and human vascular endothelial cells.
The antibody of the present invention is an agonist antibody against ROBO4. That is, the antibody of the present invention binds to ROBO4 and activates a downstream signal of ROBO4. Therefore, the angiogenesis inhibitory action of the antibody of the present invention can be evaluated using the activation of downstream signals of ROBO4 as an index. Examples of downstream signals of ROBO4 include IL-8 promoter activity. The promoter activity of IL-8 is significantly increased in full-length human ROBO4-expressing cells as compared to non-human ROBO4-expressing cells, and is hardly observed in human ROBO4-expressing cells lacking the intracellular domain. An increase in 8 promoter activity was shown to detect activation of ROBO4 signal (Example 3). The promoter activity of IL-8 is, for example, after adding an anti-ROBO4 antibody to a cell into which a reporter vector into which an IL-8 promoter sequence is inserted and a human ROBO4 expression plasmid are introduced, or co-adding an anti-ROBO4 antibody and a cross-link antibody, It can be evaluated by measuring the reporter activity.

(3-6) Anti-ROBO4 mouse monoclonal antibody and chimeric antibody MAb1 is an anti-ROBO4 mouse monoclonal antibody obtained by the method described in Example 2.
The nucleotide sequence of cDNA encoding the heavy chain variable region of MAb1 is shown in SEQ ID NO: 30 (FIG. 15) and the amino acid sequence is shown in SEQ ID NO: 31 (FIG. 16). The amino acid sequence of CDRH1 is described in SEQ ID NO: 44 (FIG. 25), the amino acid sequence of CDRH2 is described in SEQ ID NO: 46 (FIG. 26), and the amino acid sequence of CDRH3 is described in SEQ ID NO: 48 (FIG. 27). The nucleotide sequence of cDNA encoding the light chain variable region of MAb1 is shown in SEQ ID NO: 32 (FIG. 17) and the amino acid sequence is shown in SEQ ID NO: 33 (FIG. 18). The amino acid sequence of CDRL1 is described in SEQ ID NO: 50 (FIG. 28), the amino acid sequence of CDRL2 is described in SEQ ID NO: 52 (FIG. 29), and the amino acid sequence of CDRL3 is described in SEQ ID NO: 54 (FIG. 30).
The antibody variants of the present invention preferably have reduced sensitivity to protein degradation or oxidation, improved biological activity, improved antigen binding ability, or imparted physicochemical or functional properties. As an example of such an antibody variant, an antibody having an amino acid sequence obtained by conservative amino acid substitution in the amino acid sequence of the antibody can be mentioned. Conservative amino acid substitutions are those that take place within a group of amino acids that are related to an amino acid side chain.
Preferred amino acid groups are as follows: acidic group = aspartic acid, glutamic acid; basic group = lysine, arginine, histidine; nonpolar group = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; And uncharged polar family = glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Other suitable amino acid groups are: aliphatic hydroxy group = serine and threonine; amide-containing group = asparagine and glutamine; aliphatic group = alanine, valine, leucine and isoleucine; and aromatic group = phenylalanine, tryptophan And tyrosine. The amino acid substitution in such an antibody variant is preferably performed within a range that does not reduce the antigen binding activity of the original antibody.
An antibody variant having an amino acid sequence in which a conservative amino acid substitution has been made in the amino acid sequence of MAb1 of the present invention, and a conservative amino acid mutation in any of the amino acid sequences of CDRH1 to CDR3 and CDRL1 to 3 derived from MAb1 Mouse antibodies, rat antibodies, chimeric antibodies, humanized antibodies, human antibodies and the like containing the CDR having the amino acid sequence are also encompassed in the present invention.
The constant region of the antibody of the present invention is not particularly limited, but a human antibody is preferably used as the antibody of the present invention for treating or preventing a human disease. Examples of the heavy chain constant region of a human antibody include Cγ1, Cγ2, Cγ3, Cγ4, Cμ, Cδ, Cα1, Cα2, and Cε. Examples of the light chain constant region of a human antibody include Cκ and Cλ.
The light chain nucleotide sequence and amino acid sequence including the secretion signal of cMAb1-1 exemplified as the mouse-human IgG1-type chimeric antibody of the present invention and the heavy chain nucleotide sequence and amino acid sequence are represented by SEQ ID NOs: 37, 38, 39 and 40 (FIGS. 19, 20, 21 and 22), respectively. Similarly, the light chain nucleotide sequence and amino acid sequence including the secretion signal of cMAb1-2 exemplified as a mouse-human IgG2 type chimeric antibody, and the heavy chain nucleotide sequence and amino acid sequence are represented by SEQ ID NOs: 37, 38, 41 and 42 in the Sequence Listing. (FIGS. 19, 20, 23 and 24), respectively.

(3-7) Functional fragment of anti-ROBO4 antibody As one aspect, the present invention provides a functional fragment of the anti-ROBO4 antibody of the present invention. The functional fragment of an antibody means a fragment that retains at least part of the function of the antibody or a modified product thereof. Such antibody functions generally include antigen-binding activity, activity that regulates antigen activity, antibody-dependent cytotoxic activity, complement-dependent cytotoxic activity, and the like. Examples of the function of the anti-ROBO4 antibody of the present invention include ROBO4 protein binding activity, angiogenesis inhibitory activity, and ROBO4 downstream signal activation activity. More specifically, so long as the antibody against ROBO4 of the present invention has all or part of the activities described in the above (3-3) to (3-5), it is included in the functional fragment of the antibody of the present invention.
The functional fragment of the antibody is not particularly limited as long as it is a fragment of the antibody that retains at least a part of the activity of the antibody or a modified form thereof. For example, Fab, F (ab ′) 2, Fv, A single chain Fv (scFv), diabodies (diabodies), linear antibodies, and multispecific antibodies formed from antibody fragments, in which Fvs of heavy and light chains are linked with an appropriate linker, F (ab ′) 2 Examples include Fab ′, which is a monovalent fragment of the variable region of an antibody treated under reducing conditions, but are not limited thereto. Molecules containing portions other than fragments of the antibody of the present invention, such as scFv carrying a linker moiety, are also encompassed within the meaning of the functional fragment of the antibody of the present invention.
A molecule in which one or more amino acid and / or carboxy terminal amino acids of an antibody protein are deleted and which retains at least a part of the functions of the antibody is also a functional fragment of an antibody. Included in the meaning.
The antibody or functional fragment thereof of the present invention may be a multispecific antibody having specificity for at least two different antigens. The multispecific antibody is not limited to a bispecific antibody that binds to two different antigens, and an antibody having specificity for three or more different antigens also includes the “multispecific antibody” of the present invention. It is encompassed within the meaning of “antibody”.
The multispecific antibody of the present invention may be a full-length antibody or a functional fragment thereof (eg, F (ab ′) 2 bispecific antibody). Bispecific antibodies can also be made by combining the heavy and light chains (HL pairs) of two types of antibodies. It can also be obtained by fusing two or more hybridomas producing monoclonal antibodies to produce bispecific antibody-producing fused cells (Millstein et al., Nature (1983) 305, p. 537). -539). Multispecific antibodies can be prepared by similar methods.
One embodiment of the antibody of the present invention is a single chain antibody (hereinafter referred to as “scFv”). The scFv can be obtained by linking an antibody heavy chain variable region and light chain variable region with a polypeptide linker (Pluckthun, The Pharmacology of Monoclonal Antibodies, 113, edited by Rosenburg and Moore, Springer Verlag, New York, New York). 269-315 (1994), Nature Biotechnology (2005), 23, p. In addition, BiscFv produced by joining two scFvs with a polypeptide linker can be used as a bispecific antibody. Furthermore, MultiscFv can be used as a multispecific antibody from three or more scFvs.
The present invention includes single-chain immunoglobulins in which the full-length sequences of antibody heavy and light chains are linked using an appropriate linker (Lee, HS, et al., Molecular). Immunology (1999) 36, p. 61-71; Shirrmann, T. et al., MAbs (2010), 2, (1) p. By dimerizing such a single-chain immunoglobulin, it is possible to retain a structure and activity similar to those of an antibody that is originally a tetramer. The antibody of the present invention may be an antibody having a single heavy chain variable region and no light chain sequence. Such an antibody is called a single domain antibody (sdAb) or nanobody, and has been reported to retain the antigen-binding ability (Muyldemans S. et. Al.). , Protein Eng. (1994) 7 (9), 1129-35, Hamers-Casterman C. et al., Nature (1993) 363 (6428) 446-8). These antibodies are also included in the meaning of the functional fragment of the antibody in the present invention.

(3-8) Anti-ROBO4 humanized antibody In one aspect thereof, the present invention provides a humanized antibody or a functional fragment thereof. Examples of the humanized antibody of the present invention include an antibody in which only the complement determining region (CDR; complementarity determining region) of Mab1 is incorporated into a human-derived antibody (see Nature (1986) 321, p.522-525), CDR grafting method In some cases, an antibody (International Publication Pamphlet WO 90/07861) in which some framework amino acid residues in addition to the CDR sequence are grafted to a human antibody can be mentioned. In addition, humanized antibody variants in which 1 to 3 amino acid residues in each CDR are further substituted with other amino acid residues are all or one of the activities described in (3-3) to (3-5) above. As long as it has a part, it is included in the antibody of the present invention.
Examples of the anti-ROBO4 humanized antibody of the present invention or a functional fragment thereof include CDRH1 consisting of the amino acid sequence shown in SEQ ID NO: 44 (FIG. 25) of the sequence listing, and amino acid shown in SEQ ID NO: 46 (FIG. 26) of the sequence listing. A heavy chain having a variable region comprising CDRH2 consisting of the sequence or an amino acid sequence in which one amino acid is substituted in the amino acid sequence and CDRH3 consisting of the amino acid sequence shown in SEQ ID NO: 48 of the Sequence Listing (FIG. 27); CDRL1 composed of the amino acid sequence shown in SEQ ID NO: 50 (FIG. 28) in the sequence table or an amino acid sequence in which 1 to 3 amino acids of the amino acid sequence are substituted, and the amino acid sequence shown in SEQ ID NO: 52 (FIG. 29) in the sequence listing And CDRL3 consisting of the amino acid sequence shown in SEQ ID NO: 54 of the Sequence Listing (FIG. 30). Consists light chain having a variable region, it can be mentioned fragments, etc. of the antibody that retain ROBO4 protein binding activity of the ROBO4 protein recognizing antibody or antibody of the present invention.
An example of amino acid substitution in CDRH2 is CDRH2 in which the amino acid at amino acid number 4 in SEQ ID NO: 46 in the sequence listing is substituted. The amino acid to be substituted is not limited as long as it has all or part of the activities described in (3-3) to (3-5) shown by the antibody against ROBO4 of the present invention.
Examples of amino acid substitutions in CDRL1 include CDRL1 in which any one to three amino acids, preferably three amino acids of amino acid numbers 9, 11, and 13 in SEQ ID NO: 50 in the sequence listing are substituted. The amino acid to be substituted is not limited as long as it has all or part of the activities described in (3-3) to (3-5) shown by the antibody against ROBO4 of the present invention.
As the heavy chain variable region of the humanized antibody having CDRH, the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32) in the sequence listing, and amino acid number 20 of SEQ ID NO: 58 in the sequence listing (FIG. 34). Thru | or 137, the amino acid sequence shown by amino acid number 20 thru | or 137 of sequence number 60 (FIG. 36) of a sequence table, and the amino acid number 20 thru | or 137 of sequence number 62 (FIG. 38) of a sequence table. Examples of the amino acid sequence include the amino acid sequence represented by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) as the light chain variable region of the humanized antibody having the CDRL, and SEQ ID NO: 66 (FIG. The amino acid sequence shown in amino acid numbers 21 to 134 of 42) can be exemplified.
As the humanized antibody containing a combination of the heavy chain variable region and the light chain variable region, the heavy chain variable region comprising the amino acid sequence represented by amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32) in the sequence listing, and A humanized antibody comprising a light chain variable region consisting of the amino acid sequence shown by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40), amino acid number 20 of SEQ ID NO: 58 (FIG. 34) A humanized chain comprising a heavy chain variable region comprising the amino acid sequence represented by amino acid sequences 137 to 137 and a light chain variable region comprising the amino acid sequence represented by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) in the sequence listing. Antibody, heavy chain variable region consisting of amino acid sequence shown by amino acid number 20 to 137 of SEQ ID NO: 58 (FIG. 34), and sequence list A humanized antibody comprising a light chain variable region comprising the amino acid sequence shown by amino acid numbers 21 to 134 of No. 66 (FIG. 42), shown by amino acid numbers 20 to 137 of SEQ ID NO: 60 (FIG. 36) A humanized antibody comprising a heavy chain variable region comprising an amino acid sequence and a light chain variable region comprising an amino acid sequence represented by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) in the sequence listing, Sequence Listing From the heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) and the amino acid sequence shown in amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) in the sequence listing A humanized antibody comprising the light chain variable region, which is represented by amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) in the sequence listing A humanized antibody comprising a heavy chain variable region comprising a mino acid sequence and a light chain variable region comprising an amino acid sequence shown by amino acid numbers 21 to 134 of SEQ ID NO: 66 (FIG. 42) in the sequence listing is preferred. It can be illustrated.
As a full-length sequence of a humanized antibody comprising a combination of the heavy chain variable region and the light chain variable region, a heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 56 (FIG. 32) in the sequence listing And a humanized antibody (H-1040) comprising a light chain comprising the amino acid sequence shown by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40), SEQ ID NO: 58 (FIG. 34) comprising a heavy chain comprising the amino acid sequence represented by amino acid numbers 20 to 463 and a light chain comprising the amino acid sequence represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) in the sequence listing. A humanized antibody (H-1140), a heavy chain comprising the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 58 (FIG. 34), and a sequence A humanized antibody (H-1143) comprising a light chain consisting of the amino acid sequence shown in amino acid numbers 21 to 239 of SEQ ID NO: 66 (FIG. 42), amino acid number of SEQ ID NO: 60 (FIG. 36) in the sequence listing A humanized antibody comprising a heavy chain comprising an amino acid sequence represented by 20 to 463 and a light chain comprising an amino acid sequence represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) in the sequence listing (H −2040), a heavy chain consisting of the amino acid sequence shown by amino acid numbers 20 to 463 of SEQ ID NO: 62 (FIG. 38), and amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40). A humanized antibody (H-2140) comprising a light chain comprising the amino acid sequence or amino acid number 20 of SEQ ID NO: 62 (FIG. 38) in the sequence listing A humanized antibody comprising a heavy chain consisting of the amino acid sequence shown by 463 and a light chain consisting of the amino acid sequence shown by amino acid numbers 21 to 239 of SEQ ID NO: 66 (FIG. 42) in the sequence listing (H-2143) ).
The amino acid sequence of the antibody comprising the combination of the heavy chain variable region and the light chain variable region or the antibody comprising the combination of the heavy chain and the light chain is 95% or more, preferably 97 %, More preferably 99% or more of the antibodies are also included in the antibodies of the present invention as long as they have all or part of the activities described in (3-3) to (3-5) above. In addition, the antibody comprises a CDR comprising the same amino acid sequence as the CDR of an antibody comprising a combination of the heavy chain variable region and the light chain variable region, or an antibody comprising the combination of the heavy chain and light chain. In addition, antibodies with amino acid sequence identity other than the CDR amino acid sequence of the antibody of 95% or more, preferably 97% or more, more preferably 99% or more are also the above (3-3) to (3-5). As long as it has all or part of the activity described above, it is included in the antibody of the present invention.
The anti-ROBO4 humanized antibody or functional fragment thereof of the present invention has angiogenesis inhibitory activity, and preferably has angiogenesis inhibitory activity in vivo. Further, such a humanized antibody or a functional fragment thereof preferably binds specifically to the ROBO4 protein. Moreover, such a humanized antibody or a functional fragment thereof is an agonist antibody of ROBO4 and activates a downstream signal. Furthermore, in vitro, vascular endothelial cell migration is suppressed or inhibited in the absence of cross-linking antibodies.

(3-9) Antibody that binds to the same site “An antibody that binds to the same site” as the antibody provided by the present invention is also included in the antibody of the present invention. An “antibody that binds to the same site” as an antibody means another antibody that binds to a site on an antigen molecule that the antibody recognizes. If the second antibody binds to the partial peptide or partial conformation on the antigen molecule to which the first antibody binds, it can be determined that the first antibody and the second antibody bind to the same site. In addition, by confirming that the second antibody competes for the binding of the first antibody to the antigen, that is, the second antibody prevents the binding between the first antibody and the antigen, the peptide sequence of the specific binding site or Even if the three-dimensional structure is not determined, it can be determined that the first antibody and the second antibody bind to the same site. Further, when the first antibody and the second antibody bind to the same site and the first antibody has a characteristic effect in one embodiment of the antibody of the present invention, such as angiogenesis inhibitory activity, the second antibody has the same effect. The probability of having activity is very high. Therefore, if the second anti-ROBO4 antibody binds to the site to which the first anti-ROBO4 antibody binds, it can be determined that the first antibody and the second antibody bind to the same site on the ROBO4 protein. In addition, if it can be confirmed that the second anti-ROBO4 antibody competes with the binding of the first anti-ROBO4 antibody to the ROBO4 protein, the first antibody and the second antibody bind to the same site on the ROBO4 protein. Can be determined.
An antibody that binds to a site on the ROBO4 protein recognized by MAb1 of the present invention is also included in the present invention.
The binding site of the antibody can be determined by methods well known to those skilled in the art such as immunoassay. For example, a series of peptides are prepared by appropriately deleting the amino acid sequence of the antigen from the C-terminus or N-terminus, examining the reactivity of the antibody against them, determining a rough recognition site, and then synthesizing a shorter peptide. By examining the reactivity of antibodies to those peptides, the binding site can be determined. Antigen fragment peptides can be prepared using techniques such as gene recombination and peptide synthesis.
When an antibody binds to or recognizes a partial higher order structure of an antigen, the binding site of such antibody is determined by identifying amino acid residues on the antigen adjacent to the antibody using X-ray structural analysis. be able to.

(3-10) Modified form of anti-ROBO4 antibody or functional fragment thereof The present invention provides a modified form of the antibody or functional fragment thereof. The modified form of the antibody of the present invention or a functional fragment thereof means a product obtained by chemically or biologically modifying the antibody of the present invention or a functional fragment thereof. Chemical modifications include chemical modifications to the amino acid backbone, N-linked or O-linked carbohydrate chains, and the like. Biological modifications include post-translational modifications (eg, glycosylation on N- or O-links, N- or C-terminal processing, deamidation, aspartic acid isomerization, methionine oxidation) And those in which a methionine residue is added to the N-terminal by expression using a prokaryotic host cell. In addition, those modified to allow detection or isolation of the antibody or antigen of the present invention, for example, an enzyme label, a fluorescent label, and an affinity label are also included in the meaning of such a modified product. Such a modified product of the antibody of the present invention or a functional fragment thereof can be used to improve the stability and blood retention of the original antibody of the present invention or a functional fragment thereof, to reduce antigenicity, to detect or simply detect such an antibody or antigen. Useful for separation.
Examples of the chemical moiety contained in the chemically modified product include water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymer, carboxymethyl cellulose, dextran, and polyvinyl alcohol.
Biologically modified products include those modified by enzyme treatment or cell treatment, fusions to which other peptides such as tags have been added by genetic recombination, and endogenous or exogenous sugar chain-modifying enzymes. And the like, which are prepared using a cell expressing the protein as a host.
Such modifications may be made at any position in the antibody or functional fragment thereof, or at a desired position, and the same or two or more different modifications may be made at one or more positions.
In the present invention, “modified antibody fragment” includes “modified antibody fragment” in its meaning.
For example, antibodies produced in cultured mammalian cells are known to lack the lysine residue at the carboxyl terminus of the heavy chain (Journal of Chromatography A, 705: 129-134 (1995)), and It is known that two amino acid residues of glycine and lysine at the heavy chain carboxyl terminal are deleted and a proline residue located at the carboxyl terminal is newly amidated (Analytical Biochemistry, 360: 75-83 (2007). )). However, deletion and modification of these heavy chain sequences do not affect the antigen-binding ability and effector function (such as complement activation and antibody-dependent cytotoxicity) of the antibody. Accordingly, the present invention also includes the antibody having undergone the modification and a functional fragment of the antibody, and a deletion in which one or two amino acids are deleted from the heavy chain carboxyl terminus, and the amidated deletion ( For example, a heavy chain in which a proline residue at the carboxyl terminal site is amidated) can be used. However, as long as the antigen-binding ability and all or part of the activities described in (3-3) to (3-5) are maintained, the carboxyl-terminal deletion of the heavy chain of the antibody according to the present invention is as described above. It is not limited to the type. The two heavy chains constituting the antibody according to the present invention may be either one of the full length and the heavy chain selected from the group consisting of the above-mentioned deletion forms, or a combination of any two of them. It may be a thing. The amount ratio of each deletion can be influenced by the type and culture conditions of cultured mammalian cells that produce the antibody according to the present invention. As the main component of the antibody according to the present invention, for example, two heavy chains And the case where one amino acid residue at the carboxyl terminus is deleted on both of them: they are all encompassed within the meaning of the antibody variant, the functional fragment of the antibody, or a modification thereof.

4). Antibody Production Method (4-1) Method Using Hybridoma The anti-ROBO4 antibody of the present invention is prepared by the method of Kohler and Milstein (Nature (1975) 256, p. 495-497, Kennet, R. ed. , Monoclonal Antibody, p. 365-367, Prenum Press, NY (1980)), isolating anti-ROBO4 antibody-producing cells from the spleen of an animal immunized with ROBO4 protein, and fusing the cells with myeloma cells Thus, a hybridoma can be established, and a monoclonal antibody can be obtained from the culture of the hybridoma.

(4-1-1) Preparation of Antigen An antigen for producing an anti-ROBO4 antibody can be obtained according to a method for preparing a natural or recombinant ROBO4 protein described in other parts of the present invention. it can. Antigens that can be prepared in this way include ROBO4 protein or a ROBO4 protein fragment comprising at least 6 consecutive partial amino acid sequences, or derivatives having any amino acid sequence or carrier added thereto (hereinafter referred to as “ROBO4 protein fragment”). , Collectively referred to as “ROBO4 antigen”).
A recombinant ROBO4 antigen can be prepared by introducing a gene containing a base sequence encoding the amino acid sequence of the ROBO4 antigen into a host cell and recovering the antigen from the culture of the cell. The native ROBO4 antigen can be purified and isolated from, for example, human or rodent angiogenic tissue or cells derived from the tissue, or a culture of the cells. Also included in the “ROBO4 antigen” of the present invention is a ROBO4 antigen obtained in a cell-free system using a gene containing a nucleotide sequence encoding the amino acid sequence of the ROBO4 antigen in an in vitro translation system.

(4-1-2) Production of anti-ROBO4 monoclonal antibody Production of a monoclonal antibody usually involves the following steps.
(A) preparing an antigen;
(B) preparing antibody-producing cells;
(C) preparing a myeloma cell (hereinafter referred to as “myeloma”);
(D) a step of fusing antibody-producing cells and myeloma;
(E) a step of selecting a hybridoma group producing the target antibody, and (f) a step of obtaining a single cell clone (cloning).
If necessary, (g) a step of culturing the hybridoma, a step of raising the animal transplanted with the hybridoma, etc., (h) a step of measuring and determining the biological activity of the monoclonal antibody are added.
Hereinafter, although the manufacturing method of a monoclonal antibody is explained in full detail along the said process, the manufacturing method of this antibody is not restrict | limited to this, For example, antibody producing cells other than a spleen cell and myeloma can also be used.

(A) Step of preparing antigen According to the method for preparing ROBO4 protein described in (2-3) above.

(B) Step of preparing antibody-producing cells The antigen obtained in step (a) is mixed with Freund's complete or incomplete adjuvant or auxiliary agent such as potassium alum, and an experimental animal is immunized as an immunogen. . As the experimental animal, an animal used in a known hybridoma production method can be used without any problem. Specifically, for example, mice, rats, goats, sheep, cows, horses and the like can be used. However, from the viewpoint of easy availability of myeloma cells to be fused with the extracted antibody-producing cells, it is preferable to use mice or rats as immunized animals.
Further, the mouse and rat strains actually used are not particularly limited. In the case of mice, for example, A, AKR, BALB / c, BALB / cAnNCrj, BDP, BA, CE, C3H, 57BL, C57BL, C57L , DBA, FL, HTH, HT1, LP, NZB, NZW, RF, RIII, SJL, SWR, WB, 129, etc. are rats, for example, Wistar, Low, Lewis, Sprague-Dawley, ACI, BN, Fischer, etc. can be used.
These mice and rats can be obtained, for example, from laboratory animal breeders such as Japan Claire and Japan Charles River.
Among these, considering fusion compatibility with myeloma cells described later, BALB / c strain is particularly preferable for mice, and Wistar and Low strains are particularly preferable for immunized animals.
In consideration of the homology of antigens between humans and mice, it is also preferable to use mice with reduced biological mechanisms for removing autoantibodies, that is, autoimmune disease mice.
In addition, the age at the time of immunization of these mice or rats is preferably 5 to 12 weeks old, more preferably 6 to 8 weeks old.
To immunize animals with the ROBO4 protein, see, for example, Weir, D. et al. M.M. , Handbook of Experimental Immunology Vol. I. II. III. Blackwell Scientific Publications, Oxford (1987), Kabat, E .; A. and Mayer, M .; M.M. , Experimental Immunochemistry, Charles C Thomas Publisher Spigfield, Illinois (1964), and the like.
Examples of the antibody titer measurement method include immunoassays such as RIA method and ELISA method, but are not limited to these methods.
Antibody-producing cells derived from spleen cells or lymphocytes isolated from immunized animals are described, for example, in Kohler et al. , Nature (1975) 256, p. 495, Kohler et al. , Eur. J. et al. Immunol. (1977) 6, p. 511; Milstein et al. , Nature (1977), 266, p. 550,; Walsh, Nature, (1977) 266, p. 495,) and the like.
In the case of spleen cells, a general method of separating antibody-producing cells by chopping the spleen and filtering the cells through a stainless mesh and then suspending them in Eagle's minimum essential medium (MEM) or the like can be employed.

(C) Step of preparing myeloma There is no particular limitation on the myeloma cell used for cell fusion, and it can be appropriately selected from known cell lines, but considering the convenience in selecting a hybridoma from the fused cell Thus, HGPRT (Hypoxanthine-guanine phosphoryltransferase) -deficient strains, ie, mouse-derived X63-Ag8 (X63), NS1-ANS / 1 (NS1), P3X63-Ag8. Ul (P3Ul), X63-Ag8.653 (X63.653), SP2 / 0-Ag14 (SP2 / 0), MPC11-45.6TG1.7 (45.6TG), FO, S149 / 5XXO, BU. 1st, etc. 210 derived from rat. RSY3. Ag. 1.2.3 (Y3), etc., human-derived U266AR (SKO-007), GM1500 / GTG-A12 (GM1500), UC729-6, LICR-LOW-HMy2 (HMy2), 8226AR / NIP4-1 (NP41) Etc. are preferably used. These HGPRT-deficient strains can be obtained from, for example, American Type Culture Collection (ATCC).
These cell lines contain 8-azaguanine in a suitable medium, for example, 8-azaguanine medium [RPMI-1640 medium supplemented with glutamine, 2-mercaptoethanol, gentamicin, and fetal calf serum (hereinafter referred to as “FCS”). Added medium], Iscove's Modified Dulbecco's Medium (Iscove's Modified Dulbecco's Medium; hereinafter referred to as “IMDM”), or Dulbecco's Modified Eagle Medium (Dulbecco's Modified Eagle Medium; hereinafter referred to as “DMEM”). However, subcultured in a normal medium [for example, ASF104 medium containing 10% FCS (manufactured by Ajinomoto Co., Inc.)] 3 to 4 days before cell fusion to secure a cell count of 2 × 10 ⁷ or more on the day of fusion. Keep it.

(D) Step of Fusing Antibody-Producing Cells and Myeloma Cells Fusion of antibody-producing cells and myeloma cells can be accomplished by a known method (Weir, DM, Handbook Experimental Immunology Vol. I. III., Blackwell Scientific Public , Oxford (1987), Kabat, EA and Mayer, MM, Experimental Immunochemistry, Charles C Thomas Publisher Publisher, Illinois (1964), etc.) Can be implemented. For example, a chemical method of mixing antibody-producing cells and myeloma cells in a high-concentration polymer solution such as polyethylene glycol, a physical method using electrical stimulation, or the like can be used.

(E) Step of selecting a hybridoma group producing an antibody of interest The method of selecting a hybridoma obtained by cell fusion is not particularly limited. , Nature (1975) 256, p. 495; Milstein et al., Nature (1977) 266, p. 550). This method is effective when hybridomas are obtained using myeloma cells of HGPRT-deficient strains that cannot survive with aminopterin. That is, by culturing unfused cells and hybridomas in a HAT medium, only hybridomas having resistance to aminopterin can selectively remain and grow.

(F) Step of obtaining a single cell clone (cloning)
As a method for cloning a hybridoma, for example, a known method such as a methylcellulose method, a soft agarose method, a limiting dilution method, or the like can be used (for example, Barbara, B.M. and Stanley, MS: Selected Methods in). Cellular Immunology, WH Freeman and Company, San Francisco (1980)), preferably the limiting dilution method.

(G) Hybridoma culture process, breeding process of animal transplanted with hybridoma Monoclonal antibody can be produced by culturing the selected hybridoma. Preferably, the desired hybridoma is cloned before producing the antibody. To serve.
Monoclonal antibodies produced by such hybridomas can be recovered from the hybridoma culture. Moreover, it can also be recovered as a recombinant antibody from a culture of cells into which the monoclonal antibody gene has been introduced. Furthermore, the hybridoma can be injected into the abdominal cavity of the same strain of mice (for example, the above-mentioned BALB / cAnNCrj) or Nu / Nu mouse, and the hybridoma can be proliferated to recover from the ascites.

(H) Monoclonal antibody biological activity measurement step / judgment step Various biological tests can be selected and applied according to the purpose.

(4-2) Cell immunization method By using cells expressing natural ROBO4 protein, cells expressing recombinant ROBO4 protein or fragments thereof as an immunogen, anti-ROBO4 antibody is prepared by the hybridoma method described above. can do.
Examples of cells that express the natural ROBO4 protein include cells derived from patients suffering from angiogenic diseases such as proliferative diabetic retinopathy and tumors, and cells derived from tissues of the patients. Such cells are preferably vascular endothelial cells, but are not limited thereto. Those ROBO4 protein expressing cells are 1 × 10 ^{5 to} 1 × 10 ⁹ cells, preferably 1 × 10 ^{6 to} 1 × 10 ⁸ cells, more preferably 0.5 to 2 × 10 ⁷ cells, and even more preferable. 1 × 10 ⁷ cells are used for one immunization, but the number of cells to be immunized can be changed according to the expression level of ROBO4 protein. Such an immunogen is generally administered intraperitoneally, but can also be administered intradermally or the like. As a method for producing a hybridoma, the method described in (4-1-2) can be applied.

(4-3) Genetic Recombination The antibody of the present invention comprises a nucleotide containing a nucleotide sequence encoding its heavy chain amino acid sequence (heavy chain nucleotide) and a nucleotide containing a nucleotide sequence encoding its light chain amino acid sequence (light chain). A chain nucleotide), or a vector into which such a heavy chain nucleotide is inserted and a vector into which a light chain nucleotide is inserted into a host cell, culturing the cell, and then recovering the antibody from the culture. be able to. A heavy chain nucleotide and a light chain nucleotide may be inserted into one vector.
Prokaryotic cells or eukaryotic cells can be used as host cells. When eukaryotic cells are used as hosts, animal cells, plant cells, and eukaryotic microorganisms can be used.
Examples of animal cells include mammalian-derived cells, that is, monkey-derived COS cells (Gluzman, Y. Cell (1981) 23, p.175-182, ATCC CRL-1650), mouse fibroblasts NIH3T3 (ATCC No. CRL-1658), Chinese hamster ovary cells (CHO cells, ATCC CCL-61), dihydrofolate reductase deficient strains (CHOdhfr-: Urlaub, G. and Chasin, LA Proc. Natl. Acad. Sci. U.S.A. (1980) 77, p.4126-4220), avian-derived cells such as chickens, and insect-derived cells.
In addition, cells modified so that the biological activity of the antibody can be increased by modifying the sugar chain structure can also be used as a host. For example, among N-glycoside-bonded complex sugar chains that bind to the Fc region of an antibody, the sugar chain in which fucose is not bound to N-acetylglucosamine at the sugar chain reducing end has been modified to be 20% or more. By using CHO cells, it is possible to prepare an antibody with enhanced ADCC activity or CDC activity (WO02 / 31140).
Examples of eukaryotic microorganisms include yeast. Examples of prokaryotic cells include Escherichia coli and Bacillus subtilis.
The signal peptide for secreting the antibody of the present invention (monoclonal antibody derived from various animals, rat antibody, mouse antibody, chimeric antibody, humanized antibody, human antibody, etc.) is the same type, the same type and the same subtype as the antibody. The secretion signal of the antibody of the present invention, and the secretion signal of the antibody itself, but are not limited to those of other types or subtypes of antibodies, or secretion of proteins from other eukaryotic species or prokaryotes Any signal can be selected and used.

(4-4) Design method and preparation method of humanized antibody As a humanized antibody, an antibody in which only the CDR of a non-human animal antibody is incorporated into a human-derived antibody (Nature (1986) 321, p.522-525). ), Antibodies obtained by grafting some framework amino acid residues in addition to CDR sequences to human antibodies by the CDR grafting method (see WO90 / 07861, US6972323), 1 of non-human animal antibodies in any of them Examples include, but are not limited to, antibodies in which one or two or more amino acids are substituted with human amino acids.

(4-5) Method for Preparing Human Antibody The antibody of the present invention can further include a human antibody. The anti-ROBO4 human antibody means an anti-ROBO4 antibody consisting of the amino acid sequence of a human-derived antibody. The anti-ROBO4 human antibody is a method using a human antibody-producing mouse having a human genomic DNA fragment containing heavy and light chain genes of human antibody (Tomizuka, K. et al., Nature Genetics (1997) 16, p. 133). Kuroiwa, Y. et.al., Nuc.Acids Res. (1998) 26, p.3447-3448; Yoshida, H.et.al., Animal Cell Technology: Basic and Applied Aspects vol.10. p. 69-73 (Kitagawa, Y., Matsuda, T. and Iijima, S. eds.), Kluwer Academic Publishers, 1999.; Tomizuka, K. et., Proc. Natl.Acad.Sci.USA (2000) 97, can be obtained by reference.) The p.722-727 like.
Such a human antibody-producing animal specifically destroys the endogenous immunoglobulin heavy chain and light chain loci of a non-human mammal, and instead uses a yeast artificial chromosome (YAC) vector or the like. Through the introduction of human immunoglobulin heavy chain and light chain loci. In addition, by means of gene recombination technology, eukaryotic cells are transformed with cDNA encoding each of the heavy and light chains of such a human antibody, preferably a vector containing the cDNA, to produce a gene recombinant human monoclonal antibody. This antibody can also be obtained from the culture supernatant by culturing the transformed cells.
Here, for example, eukaryotic cells, preferably CHO cells, mammalian cells such as lymphocytes and myeloma can be used as the host.
In addition, a method for obtaining a human antibody derived from phage display selected from a human antibody library (Wormstone, IM et al, Investigative Ophthalmology & Visual Science. (2002) 43 (7), p. 2301-2308; Carmen, S. et.al., Briefings in Functional Genomics and Proteomics (2002), 1 (2), p.189-203; Siriwardena, D. et.al, Optalmology (2002) 109 (3), p. 427-431 etc.) are also known.
For example, a phage display method (Nature Biotechnology (2005), 23, (9), p. 1105) in which a variable region of a human antibody is expressed on a phage surface as a single chain antibody (scFv) and a phage that binds to an antigen is selected. −1116) can be used.
By analyzing the gene of the phage selected by binding to the antigen, the DNA sequence encoding the variable region of the human antibody that binds to the antigen can be determined.
If the DNA sequence of scFv that binds to the antigen is clarified, an expression vector having the sequence is prepared, and introduced into a suitable host for expression to obtain a human antibody (WO92 / 01047, WO92 / 20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, WO 95/15388, Annu. Rev. Immunol (1994) 12, p. 433-455, Nature Biotechnology (2005) 23 (9), p. 1105-1116).

(4-6) Preparation Method of Functional Fragment of Antibody A method for producing a single chain antibody is well known in the art (for example, US Pat. No. 4,946,778, US Pat. No. 5,260,203). U.S. Pat. No. 5,091,513, U.S. Pat. No. 5,455,030). In this scFv, the heavy chain variable region and the light chain variable region are linked via a linker that does not form a conjugate, preferably a polypeptide linker (Huston, JS et al., Proc. Natl. Acad. Sci.U.S.A. (1988), 85, p.5879-5883). The heavy chain variable region and the light chain variable region in scFv may be derived from the same antibody or different antibodies.
As the polypeptide linker that links the variable regions, for example, any single chain peptide consisting of 12 to 19 residues is used.
The scFv-encoding DNA is a DNA encoding the heavy chain or heavy chain variable region of the antibody, and a DNA encoding the light chain or light chain variable region. Amplification by PCR using a primer pair that defines both ends of the DNA portion that encodes as a template, and then the DNA that encodes the polypeptide linker portion, and both ends thereof are connected to the heavy chain and light chain, respectively. Obtained by combining and amplifying the primer pairs defined in 1.
Using DNA encoding scFv, an expression vector containing the DNA and a host cell transformed with the expression vector can be prepared according to a conventional method, and by culturing the host cell, The scFv can be recovered from such culture according to the method.
Other antibody functional fragments can also be obtained by obtaining a gene encoding the functional fragment according to the above-described method, introducing the gene into the cell, and recovering the functional fragment from the cell culture.
The antibody of the present invention may be an antibody having increased affinity for an antigen by multimerization. The antibody that multiplies may be one type of antibody or a plurality of antibodies that recognize multiple epitopes of the same antigen. Examples of the method for increasing the number of antibodies include binding of an IgG CH3 domain and two scFvs, binding to streptavidin, introduction of a helix-turn-helix motif, and the like.
The antibody of the present invention may be a mixture of a plurality of types of anti-ROBO4 antibodies having different amino acid sequences, that is, a polyclonal antibody. Examples of the polyclonal antibody include a mixture of a plurality of types of antibodies in which part or all of the CDR set is different. Such a polyclonal antibody can be obtained by co-culturing cells producing different antibodies and recovering from the culture (WO 2004/061104). It is also possible to mix separately prepared antibodies. Furthermore, the antiserum which is one embodiment of the polyclonal antibody can be prepared by immunizing an animal with a desired antigen and collecting the serum from the animal according to a standard method.
As a modified antibody, an antibody conjugated with various molecules such as polyethylene glycol (PEG) can also be used.
The antibody of the present invention may be one in which these antibody and another drug form a conjugate (Immunoconjugate). As an example of such an antibody, the thing which this antibody couple | bonded with the radioactive substance and the compound which has a pharmacological action can be mentioned (Nature Biotechnology (2005) 23, p.1377-1146).

(4-7) Purification of antibody The obtained antibody can be purified to homogeneity. Separation and purification of antibodies may be carried out using separation and purification methods used for ordinary proteins.
For example, antibodies can be separated and purified by selecting and combining chromatography columns, filters, ultrafiltration, salting out, dialysis, preparative polyacrylamide gel electrophoresis, isoelectric focusing, etc. (Stratesies for) Protein Purification and Charcterization: A Laboratoy Course Manual, Daniel R.Marshak et al.eds, Cold Spring Harbor Laboratory Press (1996); Antibodies:. A Laboratory Manual.Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1988)) is Is limited to these No.
Chromatography includes affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, adsorption chromatography and the like.
These chromatography can be performed using liquid phase chromatography, such as HPLC and FPLC.
Examples of the column used for affinity chromatography include a protein A column, a protein G column, and an antigen column.
Examples of the protein A column include Hyper D (manufactured by Pall), POROS (manufactured by Applied Systems), Sepharose F. F. (Manufactured by GE Healthcare).
It is also possible to purify an antibody using a carrier on which an antigen is immobilized, utilizing the binding property to the antigen.
The present invention includes a gene encoding the antibody of the present invention or a functional fragment thereof or a modified product thereof, a recombinant vector into which the gene is inserted, a cell into which the gene or vector has been introduced, and other cells that produce the antibody of the present invention Also provide.

5. Pharmaceutical Composition The present invention provides a pharmaceutical composition comprising an anti-ROBO4 antibody or a functional fragment thereof or a modified form thereof.
In the pharmaceutical composition of the present invention, angiogenesis is seen as one of the pathological findings in the process of onset, progression and / or exacerbation, and the pathological condition is improved by suppressing such angiogenesis / vascular permeability. Is useful for the treatment or prevention of diseases that may lead to (hereinafter referred to as “angiogenic diseases” for convenience). Examples of angiogenic diseases include wet age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumors, atherosclerosis, posterior lens fibroproliferation, hemangiomas, chronic inflammation, intraocular Examples include neovascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, obesity, and the like.
In the present invention, for the treatment and / or prevention of a disease, such disease, preferably the onset of such a disease in an individual expressing the ROBO4 protein, prevention or exacerbation or inhibition of progression, or suffering from such a disease Examples include, but are not limited to, alleviation of one or more symptoms presented by an individual, suppression or remission of progression or progression, treatment or prevention of secondary diseases, and the like.
The pharmaceutical composition of the present invention comprises a therapeutically or prophylactically effective amount of an anti-ROBO4 antibody or a functional fragment of the antibody and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and / or adjuvant. Can be contained.
“Therapeutically or prophylactically effective amount” means an amount that exhibits a therapeutic or prophylactic effect for a specific disease, dosage form, and route of administration.
The pharmaceutical composition of the present invention includes pH, osmotic pressure, viscosity, transparency, color, isotonicity, sterility, stability of the composition or antibody contained therein, solubility, sustained release, absorbability, penetration. Substances for changing, maintaining, and maintaining properties, dosage forms, strength, properties, shapes, etc. (hereinafter referred to as “substances for formulation”) can be included. The substance for the preparation is not particularly limited as long as it is a pharmacologically acceptable substance. For example, non-toxicity or low toxicity is a property that a drug substance preferably has.
Examples of the substance for formulation include, but are not limited to, the following: amino acids such as glycine, alanine, glutamine, asparagine, histidine, arginine or lysine, antibacterial agent, ascorbic acid , Antioxidants such as sodium sulfate or sodium bisulfite, phosphoric acid, citric acid, boric acid buffer, sodium hydrogen carbonate, buffer such as tris-hydrochloric acid (Tris-Hcl) solution, filler such as mannitol and glycine, ethylenediamine Chelating agents such as tetraacetic acid (EDTA), caffeine, polyvinylpyrrolidine, complexing agents such as β-cyclodextrin and hydroxypropyl-β-cyclodextrin, bulking agents such as glucose, mannose or dextrin, monosaccharides, disaccharides, Glucose, mannose, dextrin, etc. Other carbohydrates, coloring agents, flavoring agents, diluents, hydrophilic polymers such as emulsifiers and polyvinylpyrrolidine, low molecular weight polypeptides, salt-forming counterions, benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, Preservatives such as propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide, solvents such as glycerin, propylene glycol or polyethylene glycol, sugar alcohols such as mannitol or sorbitol, suspending agents, PEG, sorbitan esters, polysorbate 20 and poly Polysorbites such as sorbitate 80, surfactants such as triton, tromethamine, lecithin or cholesterol, stabilization enhancers such as sucrose and sorbitol, sodium chloride Um, potassium chloride, mannitol and elasticity enhancers such as sorbitol, transport agent, diluent, excipient, and / or pharmaceutically adjuvants.
The amount of the substance for these preparations added is 0.001 to 1000 times, preferably 0.01 to 100 times, more preferably 0. 1 to 10 times.
An immunoliposome containing an anti-ROBO4 antibody or a functional fragment thereof or a modified product thereof in a liposome, or a pharmaceutical composition containing an antibody modified product (US Pat. No. 6,214,388, etc.) formed by binding an antibody and a liposome is also present in the present invention. Included in the pharmaceutical composition of the invention.
The excipient and carrier are usually liquid or solid, and are not particularly limited as long as they are water used for injection, physiological saline, artificial cerebrospinal fluid, and other substances used for oral or parenteral administration. . Examples of the physiological saline include neutral ones and those containing serum albumin.
Examples of the buffer include Tris buffer prepared so that the final pH of the pharmaceutical composition is 7.0 to 8.5, acetate buffer prepared so as to be 4.0 to 5.5, and 5. Examples thereof include a citrate buffer prepared to be 0 to 8.0, a histidine buffer prepared to be 5.0 to 8.0, and the like.
The pharmaceutical composition of the present invention is a solid, liquid, suspension or the like. Freeze-dried preparations can be mentioned. An excipient such as sucrose can be used to mold the lyophilized preparation.
The administration route of the pharmaceutical composition of the present invention may be enteral administration, topical administration or parenteral administration, and a suitable administration route may be selected depending on the target disease. Specific examples include intravenous administration, intraarterial administration, intramuscular administration, intradermal administration, subcutaneous administration, intraperitoneal administration, transdermal administration, intraosseous administration, intraarticular administration, and the like. Ocular blood vessels such as wet age-related macular degeneration, diabetic retinopathy, macular edema, posterior lens fibroproliferation, intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue For neoplastic diseases, intraocular administration can also be preferably used.
The composition of such a pharmaceutical composition can be determined depending on the administration method, the ROBO4 protein binding affinity of the antibody, and the like. The higher the affinity of the anti-ROBO4 antibody of the present invention or the functional fragment thereof or the modified product thereof for the ROBO4 protein (the lower the KD value), the more effective the drug can be exerted.
The dose of the anti-ROBO4 antibody of the present invention should be determined appropriately according to the species of the individual, the type of disease, symptoms, sex, age, disease, ROBO4 protein binding affinity of the antibody or its biological activity, and other factors. In general, 0.01 to 1000 mg / kg, preferably 0.1 to 100 mg / kg can be administered once every 1 to 180 days, or twice or three times a day.
The form of the pharmaceutical composition includes injections (including lyophilized preparations and infusions), suppositories, nasal absorption preparations, transdermal absorption preparations, sublingual preparations, capsules, tablets, ointments, granules, aerosols. Examples thereof include pills, pills, powders, suspensions, emulsions, eye drops, and implantable preparations.
The pharmaceutical composition containing the anti-ROBO4 antibody of the present invention or a functional fragment thereof or a modified form thereof as an active ingredient can be used in combination with an angiogenesis inhibitor, an anti-inflammatory agent and / or an anticancer agent. For example, after administering an angiogenesis inhibitor, an anti-inflammatory drug and / or an anticancer drug, a pharmaceutical composition containing an anti-ROBO4 antibody or a functional fragment of the antibody as an active ingredient is administered, or the pharmaceutical composition is administered Later, an angiogenesis inhibitor, an anti-inflammatory drug and / or an anti-cancer drug is administered, or the pharmaceutical composition and the angiogenesis inhibitor, an anti-inflammatory drug and / or an anti-cancer drug are administered simultaneously. Good. Examples of the angiogenesis inhibitor include ranibizumab.
The present invention relates to wet age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, intraocular neovascular disease, proliferation For treating or preventing angiogenic diseases such as retinopathy, angiogenic glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, obesity, and the like There is also provided use of the antibody of the present invention for preparing a pharmaceutical composition for use or prevention, and use of the antibody of the present invention for treatment or prevention of the angiogenic disease. A therapeutic or prophylactic kit containing the antibody of the present invention is also included in the present invention.

6). Diagnostic Composition A diagnostic or diagnostic composition (hereinafter collectively referred to as “diagnostic composition”) comprising the anti-ROBO4 antibody of the present invention or a functional fragment thereof or a modified form thereof is provided.
The diagnostic composition of the present invention comprises wet age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, intraocular Useful for testing or diagnosing neovascular diseases such as neovascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, and obesity . It is also useful for examination or diagnosis of early angiogenesis or pre-angiogenesis symptoms that do not satisfy conventional diagnostic criteria, undiagnosed symptoms that develop into angiogenesis, and the like. In the present invention, examination or diagnosis includes, for example, determination or measurement of morbidity risk, determination of presence or absence of morbidity, measurement of the degree of progression or deterioration, measurement or determination of the effect of drug treatment with a pharmaceutical composition such as an anti-ROBO4 antibody. In addition, measurement or determination of the effect of treatment other than drug treatment, measurement of recurrence risk, determination of the presence or absence of recurrence, and the like are included, but the test or diagnosis is not limited thereto.
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more in the subject sample compared to the healthy sample As described above, preferably, when a ROBO4 protein amount of 10 times or more is detected, the subject can be diagnosed as having or having a high risk of suffering from an angiogenic disease. Also, if the blood concentration of ROBO4 protein exceeds a specific reference value, the subject is diagnosed as having an angiogenic disease, or the subject is at risk of having an angiogenic disease. Can be diagnosed as high. Such a reference value is usually 0.01 to 10 ng / ml, preferably 0.1 to 1 ng / ml, more preferably 0.1 to 0.3 ng / ml.
Such a diagnostic composition may contain a pH buffer, an osmotic pressure regulator, salts, a stabilizer, an antiseptic, a developer, a sensitizer, an aggregation inhibitor, and the like.
The present invention relates to wet age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, intraocular neovascular disease, proliferative Retinopathy, angiogenic glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, obesity and other angiogenic disease testing method or diagnostic method, for diagnosis of the angiogenic disease Also provided is the use of an antibody of the invention for preparing a composition, use of an antibody of the invention for testing or diagnosing the angiogenic disease. A test or diagnostic kit containing the antibody of the present invention is also included in the present invention.
A sandwich ELISA is preferable as a test or diagnostic method including the antibody of the present invention, but a usual ELISA method, RIA method, ELISPOT (Enzyme-Linked ImmunoSpot) method, dot blot method, octalony method, CIE (Counterimmunoelectrophoresis) method, etc. Detection methods using antibodies can be used. As an antibody to be used in the sandwich ELISA measurement system, any antibody can be used as long as it is a combination of two types of antibodies that do not compete among antibodies that recognize ROBO4. As a method for labeling antibodies, in addition to biotin, labeling methods that can be used for biochemical analysis such as HRP, alkaline phosphatase, FITC, and the like can be used. For detection using an enzyme label, TMB (3,3 ', 5,5'-tetramethylbenzidine), BCIP (5-bromo-4-chloro-3-indylphosphate), ρ-NPP (ρ-nitrophenyl phosphate), OPD (o-Phenylenediamine), ABTS ( 3-Ethylbenzothiazoline-6-sulfonic acid), SuperSignal ELISA Pico Chemiluminescent substrate ( thermo Fisher Scientific Co., Ltd.) chromogenic substrate and QuantaBlu ^TM Fluorogenic Peroxidase substrate (thermo Fisher Scientific, Inc., such as ) Fluorescent substrate In addition, a chemiluminescent substrate can be used. In this measurement, in addition to a sample derived from a human or non-human animal, a sample to which an artificial treatment such as a recombinant protein has been added can be provided. Examples of test samples derived from living organisms include, but are not limited to, blood, joint fluid, ascites, lymph fluid, cerebrospinal fluid, tissue homogenate supernatant, and the like.
The sandwich ELISA kit for testing or diagnosis containing the antibody of the present invention may contain ROBO4 protein standard solution, coloring reagent, dilution buffer, solid phase antibody, detection antibody, washing solution and the like. As a method for measuring the amount of antibody bound to the antigen, an absorption method, a fluorescence method, a luminescence method, an RI (Radioisotope) method or the like is preferably applied. An RI liquid scintillation counter or the like is preferably used.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not limited to these.

  In the following Examples, unless otherwise specified, each operation relating to gene manipulation is from "Molecular Cloning" (Sambrook, J., Fritsch, EF, and Maniatis, T., Cold Spring Harbor Laboratory Press). (Published in 1989) and the methods described in other experimental documents used by those skilled in the art, or when using commercially available reagents and kits, they were performed according to the instructions for commercial products.

(Example 1) Expression vector preparation 1) -1 Preparation of human ROBO4 expression vector 1) -1-1 Preparation of full-length human ROBO4 expression vector Plasmid (manufactured by Open Biosystems) containing human ROBO4 cDNA (Accession No. BC039960) The human ROBO4 cDNA was excised from EcoR V and Not I from this, and this was inserted between EcoR V / Not I of the pCI vector (Promega) to obtain a full-length human ROBO4 expression vector (hereinafter referred to as “pCI-hROBO4”). Was made. The sequence of the human ROBO4 gene cloned in this vector is shown in SEQ ID NO: 1 in the sequence listing. The amino acid sequence of human ROBO4 is shown in SEQ ID NO: 2 in the sequence listing.

1) -1-2 Preparation of human ROBO4 extracellular region expression vector Human ROBO4 extracellular region polypeptide (consisting of amino acid sequences 1 to 461 of SEQ ID NO: 2 in the sequence listing. Hereinafter referred to as “human ROBO4-ECD” A primer set of cDNA encoding:
Primer 1F: 5′-aaaggtaccacccatgggctctggaggagagccctcctg-3 ′ and
Primer 1R: 5'-aaagatatatcctgctcccagggtccaggggaccatgctcact-3 '
Was amplified by PCR reaction. The obtained PCR product was cloned into a pEF6 / V5-His-TOPO vector (manufactured by Life Technologies) (hereinafter abbreviated as “pEF6-ROBO4-ECD”), and hereinafter expressed by “pEF6-ROBO4-ECD”. The replacement protein is referred to as “rROBO4-ECD”).

1) 1-3 Preparation of N-terminal FLAG-tag-added full-length human ROBO4 and human ROBO4 extracellular region domain-deficient expression vector From the amino acid sequences shown in amino acid numbers 28 to 1007 of SEQ ID NO: 2 in the sequence list of human ROBO4 A region (denoted as “hROBO4-28” in the figure), a region consisting of the amino acid sequence represented by amino acid numbers 46 to 1007 (denoted as “hROBO4-46” in the figure), amino acid numbers 132 to 1007 A region consisting of the amino acid sequence shown in (in the figure, indicated as “hROBO4-132”), and a region consisting of the amino acid sequence shown in amino acid numbers 210 to 1007 (in the figure, indicated as “hROBO4-210”). , A region consisting of an amino acid sequence represented by amino acid numbers 225 to 1007 (in the figure, “h OBO4-225 "), a protein having a FLAG-tag added to the N-terminus of the region consisting of the amino acid sequence shown by amino acid numbers 341 to 1007 (in the figure, indicated as" hROBO4-341 ") is expressed. To construct a vector to
hROBO4-28 amplification primer set:
Primer 2F: 5'-ggtaccgccatgggctctggaggagacagcctcctcgcgggcagaggttccctgccactacggccccggcatgacccgcccc
Primer 2R: 5'-gctagcgggaggtaatctacaggagagaccaccgccttg-3 ',
hROBO4-46 amplification primer set:
Primer 3F: 5'-ggtaccgccatgggctctggaggagacagcctcctcgcgggcagaggttccctgcctctgctgctgccccgctcatcatggcatgcc
hROBO4-132 amplification primer set:
Primer 4F: 5'-ggtaccgccatgggctctggaggaggacgcctcctcgcgggcagaggttccctgcctctgctgctgtcc
hROBO4-210 amplification primer set:
Primer 5F: 5'-ggtaccgccatggcctctggaggagacagcctcctcgcggcagaggttccctgcctactgctgcatgaccatgg
hROBO4-225 amplification primer set:
Primer 6F: 5'- ggtaccgccatggcctctggaggagagagcctcctcgcgggcagaggttccctgccactgctgcatcaccat-3
hROBO4-341 amplification primer set:
Primer 7F: 5'-ggtaccgccatgggctctggagagagcctcctcggcggcagaggttccc
PCR reaction was carried out using pCI-hROBO4 as a template using the respective primer sets. The obtained PCR product was incorporated into a pCR4 Blunt-TOPO vector (manufactured by Life Technologies) to prepare a cloning vector. Each cDNA was cut out from each cloning vector with Kpn I and Nhe I, and this was inserted between Kpn I / Nhe I of the pCI vector, so that N-terminal FLAG-tag-added full-length human ROBO4 and four human ROBO4 extracellular regions A domain-deficient expression vector was prepared. The N-terminal FLAG-tag-added full-length human ROBO4 vector is composed of a ROBO4 signal sequence (amino acids 1 to 27 of SEQ ID NO: 2 in the sequence listing) + FLAG sequence (DYKDDDDK) + ROBO4 (SEQ ID NO: 2 in the sequence listing) from the N-terminal side. Amino acid numbers 28 to 1007). Hereinafter, a vector expressing N-terminal FLAG-tag-added full-length human ROBO4 is referred to as “pCI-FLAG-hROBO4-28”. Further, a human ROBO4 extracellular region domain-deficient expression vector, for example, a vector that expresses ROBO4 consisting of amino acids 46 to 1007 of SEQ ID NO: 2 in the sequence listing, is a signal sequence of ROBO4 (amino acid number 1 of SEQ ID NO: 2 in the sequence listing). To 27 amino acids) + FLAG sequence (DYKDDDDK) + extracellular region-deficient ROBO4 (amino acids 46 to 1007 of amino acid numbers 46 to 1007 in SEQ ID NO: 2 in the sequence listing). This vector is referred to as “pCI-hROBO4-46”. Similarly, vectors encoding ROBO4 partially lacking in the extracellular region of ROBO4 are “pCI-hROBO4-132”, “pCI-hROBO4-210”, “pCI-hROBO4-225”, “pCI-hROBO4- 341 ".
Nucleotide sequences encoding the amino acid sequences of FLAG-tag-added full-length human ROBO4 and human ROBO4 extracellular region domain-deficient cloned in each vector are shown in SEQ ID NOs: 3, 5, 7, 9, 11, and 13 in the Sequence Listing. Has been. The amino acid sequences of the corresponding FLAG-tag-added full-length human ROBO4 and human ROBO4 extracellular region domain-deficient are shown in SEQ ID NOs: 4, 6, 8, 10, 12, and 14, respectively.

1) -1-4 Preparation of human ROBO4 intracellular region deletion expression vector Region consisting of amino acid sequence shown in amino acid Nos. 1 to 511 of SEQ ID No. 2 in human ROBO4 sequence table (hereinafter referred to as “hROBO4-ΔC”) To construct a vector that expresses the protein of
Primer set for hROBO4-ΔC:
Primer 8F: 5′-cagatataccagtgaggagtgcctgaatcctaaaacacaggatggac-3 ′ and
Primer 8R: 5'-gatcccatcctgtgtttagagattcaggcatcctcactgggtatactg-3 ',
Is used to insert a stop codon after the codon encoding the 511st amino acid of human ROBO4 with QuikChange XL Site-Directed Mutagenesis Kit (manufactured by Agilent Technologies) using pCI-hROBO4 as a template. A vector was prepared (hereinafter referred to as “pCI-hROBO4-ΔC”).

1) -2 Preparation of mouse ROBO4 expression vector Primer set using Mouse Heart QUICK-Clone cDNA (manufactured by Takara Bio Inc.) as a template:
Primer 9F: 5'-ggtaccgccatgggacaaggaggaggccgagagcaggccatg-3 'and
Primer 9R: 5'-gcggccgcgggagcaatcaccagccttggggcacaccaccag-3 '
A PCR reaction was carried out using and the resulting PCR product was incorporated into a pCR-BluntII-TOPO vector (manufactured by Life Technologies) to prepare a cloning vector containing mouse ROBO4 cDNA. A mouse ROBO4 cDNA was excised from the cloning vector with KpnI and NotI, and this was inserted between KpnI / NotI of the pCI vector to prepare a mouse ROBO4 expression vector (hereinafter referred to as "pCI-mROBO4"). The sequence of the ORF portion of the mouse ROBO4 gene cloned into this vector is shown in nucleotide numbers 7 to 3051 of SEQ ID NO: 15 in the sequence listing. The amino acid sequence of mouse ROBO4 is shown in SEQ ID NO: 16 in the sequence listing.

1) -3 Preparation of rat ROBO4 expression vector Rat Splen QUICK-Clone cDNA (manufactured by Takara Bio Inc.) as a template, primer set:
Primer 10F: 5′-ggtaccgccatgggacaaggaggaggctgagagcccc-3 ′ and
Primer 10R: 5'-gcggccgcgggagcaatccaccgccttgggcacaacacc-3 '
A cloning vector containing rat ROBO4 cDNA was prepared by incorporating the obtained PCR product into the pCR4Blunt-TOPO vector. A rat ROBO4 cDNA was excised from the cloning vector with Kpn I and Not I, and this was inserted between Kpn I / Not I of the pCI vector to prepare a rat ROBO4 expression vector (hereinafter referred to as “pCI-raROBO4”). The nucleotide sequence of rat ROBO4 cDNA is shown in SEQ ID NO: 17 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 18 in the sequence listing.

1) -4 Preparation of N-terminal FLAG-tag added cynomolgus monkey ROBO4 expression vector Primer set using cDNA synthesized from cynomolgus kidney total RNA as a template:
Primer 11F: 5′-ggtaccgccatggggctctgggaggagaagaccccccgg-3 ′ and
Primer 11R: 5′-ggagatatactacaggagagaccaccgccttg-3 ′
A PCR reaction was performed using By incorporating the obtained PCR product into the pCR4Blunt-TOPO vector, a cloning vector containing two types of cynomolgus monkey ROBO4 cDNA (hereinafter referred to as cynoROBO4-1 and cynoROBO4-2) was prepared (hereinafter referred to as pCR-cynoROBO4-1, pCR-cynoROBO4-2).
Next, primer sets using pCR-cynoROBO4-1 and pCR-cynoROBO4-2 as templates:
Primer 12F: 5′-ggatccgccatggggctctgggaggagaagaccccccg-3 ′ and
Primer 12R: 5′-gcggccgctcagggaatctacaggagagaccaccgccttg-3 ′
A PCR reaction was performed using The resulting PCR product was incorporated into the pCR4Blunt-TOPO vector to prepare a cloning vector containing each cynomolgus ROBO4 cDNA. Two types of cynomolgus ROBO4 expression vectors were prepared by cutting out cynomolgus ROBO4 cDNA from the cloning vector with BamH I and Not I and inserting it between BamH I / Not I of the pCI vector (hereinafter referred to as pCI-cynoROBO4-1, pCI-cynoROBO4-2).
Next, primer sets using pCI-cynoROBO4-1 and pCI-cynoROBO4-2 as templates:
Primer 13F: 5'-ggtaccgccatgggctctggaggagaagaagcctccgagctcccggggctccc
Primer 12R
A PCR reaction was performed using The obtained PCR product was incorporated into a pCR-TOPO vector (manufactured by Life Technologies) to prepare a cloning vector containing an N-terminal FLAG-tag added cynomolgus monkey ROBO4 cDNA. A cynomolgus ROBO4 cDNA was excised from the cloning vector with Kpn I and Not I, and this was inserted between the Kpn I / Not I of the pCI vector to produce an N-terminal FLAG-tag added cynomolgus ROBO4 expression vector (hereinafter referred to as “pCI”). -FLAG-cynoROBO4-1 "and" pCI-FLAG-cynoROBO4-2 "). In addition, the nucleotide sequences of the cynomolgus ROBO4 cDNAs cloned into pCI-FLAG-cynoROBO4-1 and pCI-FLAG-cynoROBO4-2 are arranged in SEQ ID NOs: 19 and 21, respectively, and the amino acid sequences encoded by the nucleotide sequences are arranged. They are shown in SEQ ID NOS: 20 and 22 in the column table.

1) -5 Preparation of N-terminal FLAG-tag added human ROBO1 expression vector Human Heart QUICK-Clone cDNA (manufactured by Takara Bio Inc.) as a template, primer set:
Primer 13F: 5'-ggggacaagttgtcacaaaaaaaggcaggctcaccatgattgcggagccccgctcactttacctg-3 ';
Primer 13R: 5'-ggggaccactttgtacaagaagaagctgggtcgctttcagtttcctctataattcttc-3 '
A PCR reaction was performed, and a BP reaction was performed between the obtained PCR product and the pDONR221 vector (Life Technologies) to prepare a donor vector containing human ROBO1 cDNA.
Next, using the donor vector as a template, the primer set:
Primer 14F: 5'-gcggccgcatgattgcggagcccgccacttttacctgtttggtatataatgttcttgtttcaggctcccgtcttgattatagagatgacgaccatgatc
Primer 14R: 5'-gctagctctagctttcagtttcctctattattctc-3 '
A cloning vector containing an N-terminal FLAG-tag-added human ROBO1 cDNA was prepared by incorporating the obtained PCR product into the pCR4Blunt-TOPO vector. An N-terminal FLAG-tag-added human ROBO1 cDNA was excised from the cloning vector with Nhe I and Not I, and this was inserted between Nhe I / Not I of the pCI vector to prepare an expression vector (hereinafter referred to as “pCI-FLAG”). -HROBO1)). The nucleotide sequence of the N-terminal FLAG-tag added human ROBO1 cDNA is shown in SEQ ID NO: 23 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 24 in the sequence listing.

1) -6 Preparation of human ROBO2 expression vector Human Lung QUICK-Clone cDNA (manufactured by Takara Bio Inc.) as a template, primer set:
Primer 15F: 5′-gcggccgcatgagtctgctgatgttacacaactactg-3 ′ and
Primer 15R: 5'-gctaggccataattcacctgtaaactgtccttgactgtgt-3 '
A cloning vector containing human ROBO2 cDNA was prepared by incorporating the obtained PCR product into the pCR4Blunt-TOPO vector. Human ROBO2 cDNA was excised from the cloning vector with Not I and Nhe I, and this was inserted between Not I / Nhe I of the pCI vector to prepare an expression vector (hereinafter referred to as “pCI-hROBO2”). The nucleotide sequence of human ROBO2 cDNA is shown in SEQ ID NO: 25 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 26 in the sequence listing.

1) -7 Production of human ROBO3 expression vector Primer set using human ROBO3 / pENTR223.1 (manufactured by Open Biosystems) as a template:
Primer 16F: 5'-gcggccgcatgctgcgcactctgctgaaaaacgctgctg-3 'and
Primer 16R: 5′-gctagctcatctttgtgtcctctcggcgtttctgtcc-3 ′
A cloning reaction containing human ROBO3 cDNA was prepared by incorporating the obtained PCR product into the pCR4Blunt-TOPO vector. Human ROBO3 cDNA was excised from the cloning vector with Not I and Nhe I, and this was inserted between Not I / Nhe I of the pCI vector to prepare an expression vector (hereinafter referred to as “pCI-hROBO3”). The sequence of the ORF portion of the human ROBO3 gene cloned in this vector is shown in nucleotide numbers 35 to 4192 of SEQ ID NO: 27 in the sequence listing. The amino acid sequence of human ROBO3 is shown in SEQ ID NO: 28 in the sequence listing.

(Example 2) Preparation of monoclonal antibody 2) -1 Preparation of antigen protein To express rROBO4-ECD, FreeStyle 293-F cells (Life Technologies) were prepared by using pEF6-ROBO4-ECD and 293fectin (Life Technologies). And transfected for 6 days at 37 ° C., 8% CO ₂ . After culturing, the culture solution was collected by centrifugation, and used as a purified raw material for rROBO4-ECD. The obtained culture supernatant was dialyzed against 20 mM Tris-HCl pH 7.5 using a dialysis tube having a molecular weight fraction of 15000, filtered (0.45 μm), and equilibrated with 20 mM Tris-HCl pH 7.5. Was added to HiTrap 16/10 Q XL (manufactured by GE Healthcare Bio-Sciences). Elution was performed by stepwise elution of NaCl (20 mM Tris-HCl pH 7.5 / 0.2 M NaCl, 20 mM Tris-HCl pH 7.5 / 1 M NaCl). A part of the eluted fraction was separated by SDS-polyacrylamide gel electrophoresis (hereinafter abbreviated as “SDS-PAGE”), and the gel was then stained by Coomassie Brilliant Blue (hereinafter abbreviated as “CBB staining”) and Western blotting. Detected and confirmed the fraction containing rROBO4-ECD. Next, the fraction containing rROBO4-ECD was collected and added to HiLoad 16/60 Superdex 75 pg (GE Healthcare Bio-Sciences) equilibrated with PBS. After elution with PBS, a part of the eluted fraction was separated by SDS-PAGE, and the gel was detected by CBB staining and Western blotting to confirm the fraction containing rROBO4-ECD. Fractions containing rROBO4-ECD were collected and used as an antigen for immunization and an antigen when measuring binding affinity. The protein concentration was measured using BCA Protein Assay Reagent (manufactured by PIERCE).

2) -2 Immunization Females of 6-week-old BALB / c mice were used. On day 0, a mixture of 50 μg of rROBO4-ECD and Freund's Complete Adjuvant was administered subcutaneously or intradermally to mice. On day 7, 14 and 21, a mixture of 50 μg of rROBO4-ECD and Freund's Incomplete Adjuvant was administered subcutaneously or intradermally to mice. On day 38, 50 μg of rROBO4-ECD was administered into the abdominal cavity of the mouse, and on day 42, the lymph node or spleen of the mouse was collected and used for hybridoma preparation.

2) -3 Hybridoma preparation Lymph node cells or spleen cells and mouse myeloma SP2 / 0-ag14 cells were electro-cell fused using a Hybridune Hybridoma Production System (manufactured by Cyto Pulse Sciences, Inc.), and ClonCell-SyDm Sect Cell-HYSm Sem Cell SMT And diluted to Technologies). Monoclonal hybridomas were prepared by collecting the emerging hybridoma colonies. Each collected hybridoma colony was cultured, and the resulting hybridoma culture supernatant was used to screen for anti-ROBO4 antibody-producing hybridomas.

2) -4 Antibody screening 2) -4-1 Preparation of cell-ELISA antigen gene-expressing cells HEK293 cells were prepared at 7.5 × 10 ⁵ cells / mL in DMEM medium containing 10% FBS. On the other hand, using Lipofectamine 2000 (manufactured by Life Technologies), pCI-hROBO4 or pCI-mock as a negative control was introduced, and 50 μL each was dispensed into 96-well half area plate (manufactured by Corning) and 10% FBS. The cells were cultured overnight at 37 ° C. in a DMEM medium containing 5% CO ₂ . The obtained introduced cells were used for Cell-ELISA in an adherent state.

2) -4-2 Preparation of antigen gene expression cells for flow cytometry analysis HEK293T cells were seeded in a 225 cm ² flask (manufactured by Sumitomo Bakelite Co., Ltd.) at 1.125 × 10 ⁷ cells / flask, and DMEM containing 10% FBS. The cells were cultured overnight at 37 ° C. and 5% CO _{2 in} the medium. On the next day, pCI-ROBO4 or pCI-mock as a negative control was introduced into HEK293T cells using Lipofectamine 2000, and further cultured overnight under conditions of 37 ° C. and 5% CO ₂ . The next day, the expression vector-introduced HEK293T cells were treated with TrypLE Express (manufactured by Life Technologies), washed with DMEM containing 10% FBS, and then suspended in PBS containing 5% FBS. The resulting cell suspension was used for flow cytometry analysis.

2) -5 Cell-ELISA
2) After removing the supernatant of expression vector-introduced HEK293 cells prepared in 4-4-1, hybridoma culture supernatant is added to each of pCI-hROBO4 and pCI-mock-introduced HEK293 cells, and left at 4 ° C. for 1 hour. did. After washing the cells in the well once with PBS containing 5% FBS, Anti-Mouse IgG-Peroxidase produced ingoat (manufactured by SIGMA-ARDRICH) diluted 500-fold with PBS containing 5% FBS was added, and the temperature was 4 ° C. And left for 1 hour. The cells in the wells were washed 5 times with PBS containing 5% FBS, and then washed with OPD coloring solution (OPD solution (0.05 M trisodium citrate, 0.1 M disodium hydrogenphosphate, 12 water, pH 4.5). o-Phenylenediamine dihydrochloride (manufactured by Wako Pure Chemical Industries, Ltd.) and H ₂ O ₂ dissolved in 0.4 mg / mL and 0.6% (v / v), respectively, were added at 25 μL / well. The color development reaction was carried out with occasional stirring, and the color development reaction was stopped by adding 25 μL / well of 1M HCl, and then the absorbance at 490 nm was measured with a plate reader (ENVISION: manufactured by PerkinElmer). In order to select a hybridoma that produces an antibody that specifically binds to ROBO4 expressed on the cell membrane surface, the pCI-hROBO4-introduced HEK293 cells exhibit higher absorbance than the negative control pCI-mock-introduced HEK293 cells. Hybridomas producing culture supernatants were selected as positive for anti-ROBO4 antibody production.

2) -6 Flow cytometry analysis 2) -5 The binding of antibodies produced by hybridomas determined to be positive by Cell-ELISA to ROBO4 was further confirmed by flow cytometry. 2) After centrifuging the HEK293T cell suspension prepared in 4-2 and removing the supernatant, the hybridoma culture supernatant was added to each of the pCI-hROBO4-introduced cells and the pCI-mock-introduced cells and suspended. It left still at 4 degreeC for 1 hour. After washing twice with PBS containing 5% FBS, Anti-Mouse IgG FITC conjugate (manufactured by SIGMA-ARDRICH) diluted 1000 times with PBS containing 5% FBS or Anti-mouse diluted 320 times with PBS containing 5% FBS Rat IgG FITC conjugate (manufactured by SIGMA-ARDRICH) was added and suspended, and allowed to stand at 4 ° C. for 1 hour. After washing 3 times with 5% FBS-containing PBS, the suspension was resuspended in 5% FBS-containing PBS containing 2 μg / mL 7-aminoactinomycin D (Molecular Probes) and detected with a flow cytometer (FC500: Beckman Coulter). went. Data analysis was performed with Flowjo (manufactured by TreeStar). After excluding 7-aminoactinomycin D-positive dead cells at the gate, a histogram of FITC fluorescence intensity of living cells was prepared. A hybridoma producing a sample in which the histogram of pCI-ROBO4-introduced HEK293T cells is shifted to the strong fluorescence intensity side with respect to the fluorescence intensity histogram of pCI-mock-introduced 293T cells as a negative control was obtained as an anti-ROBO4 antibody-producing hybridoma. The anti-ROBO4 antibodies produced by the obtained hybridomas were designated as MAb1, MAb2, MAb3, and MAb4, respectively.

2) -7 Isotype Determination of Monoclonal Antibody The isotype of the monoclonal antibody was determined by Mouse monoclonal isotyping kit or Rat monoisotopic kit (Serotec). As a result, they were IgG1 (MAb1, MAb2) and IgG2b (MAb3, MAb4).

2) -8 Preparation of Monoclonal Antibody The monoclonal antibody was purified from the hybridoma culture supernatant (hereinafter referred to as “antibody purification raw material”).
The antibody purification raw material was prepared as follows. 8-9 × 10 ⁷ hybridomas were seeded in 1272 cm ² flasks (Corning) and incubated at 37 ° C., 5% CO _{2 in} 20% Ultra-LoW IgG fetal bovine serum-containing hybridoma SFM medium (Life Technologies). After culturing for 4 days under these conditions, the supernatant was recovered.
The antibody was purified with Hitrap Protein G HP or Hitrap MabSelect SuRe (manufactured by GE Healthcare Bio-Sciences). In Hitrap Protein G HP, an antibody purification material was added to the column, washed with a binding buffer (0.02 M sodium phosphate pH 7.0), and eluted with 0.1 M glycine pH 2.7. On the other hand, with Hitrap MabSelect SuRe, the antibody purification material was added to the column, washed with PBS, and eluted with 2M Arginine-HCl pH 4.0. The eluted antibody solution was neutralized and then buffer-substituted with PBS. The concentration of the antibody purified with Hitrap Protein G HP was measured using BCA Protein Assay Reagent. Note that Mouse IgG2A (manufactured by R & D systems) was used as the standard substance for the calibration curve. The concentration of the antibody purified with Hitrap MabSelect SuRe was as follows: POROS G 20 μm Column PEEK, 4.6 mm × 50 mm, 0.83 mL (manufactured by Applied Biosystems) was eluted, and the absorbance of the eluate (O.D. D. 280 nm). Specifically, POROS G 20 μm equilibrated with an equilibration buffer (30.6 mM sodium dihydrogen phosphate · 12 water, 19.5 mM monopotassium phosphate, 0.15 M NaCl, pH 7.0) was diluted with PBS. After adding an antibody sample and washing the column with equilibration buffer, the antibody bound to the column was eluted with an eluent (0.1% (v / v) HCl, 0.15 M NaCl). The peak area of the absorbance (OD 280 nm) of the eluate was measured, and the concentration was calculated by the following formula. Antibody sample concentration (mg / mL) = (peak area of antibody sample) / (peak area of standard product (human IgG1)) × concentration of standard product (mg / mL) × dilution ratio of sample.

(Example 3) Detection of downstream signal activation of ROBO4 3) -1 Preparation of reporter vector using Interleukin-8 (IL-8) promoter region as response element Primer set using DNA of IL-8 promoter region as template :
Primer 17F: 5′-ggtaccgataatagagaaaagaggaag-3 ′ and
Primer 17R: 5'-gagctcagttgtgtgtgctctgctgtc-3 '
A cloning vector containing the DNA of the IL-8 promoter region (−253 to −59) was prepared by incorporating the obtained PCR product into the pCR4Blunt-TOPO vector. The DNA of the IL-8 promoter region (−253 to −59) was excised from the cloning vector with Kpn I and Sac I, and this was inserted into Kpn I / Sac I of the pGL4.15 vector (Promega) to obtain IL. A reporter vector using the -8 promoter region as a response element was prepared. The nucleotide sequence of the DNA of the IL-8 promoter region (−253 to −59) is shown in SEQ ID NO: 29 in the sequence listing.

3) -2 Nuclear Factor-κB (NF-κB), Interferon gamma activation sequence (GAS), Interferon stimulated response element (ISRE), Transfection grade T cell F , ISRE and TCF as response elements are pGL4.32 [luc2P / NF-κB-RE / Hygro] Vector (Promega), pGAS-TA-Luc Vector (Takara Bio), pISRE- TA-Luc Vector (manufactured by Takara Bio Inc.) and TOPflash (Millipore) ) Was used. Moreover, pTA-Luc Vector (made by Takara Bio Inc.) which does not contain a response element was used as a negative control, and pRL-TK Vector (made by Takara Bio Inc.) was used as an internal control.

3) -3 Signal analysis fluctuating in transient expression cells of human ROBO4 HEK293 cells were seeded in a 96-well plate (collagen I coat, manufactured by Asahi Glass Co., Ltd.) at 2 × 10 ⁴ cells / well, and contained 10% FBS. The cells were cultured overnight in DMEM medium at 37 ° C. and 5% CO ₂ . On the next day, pCI-ROBO4, pCI-ROBO4-ΔC or the negative control pCI-mock and the reporter vectors shown in 3) -1 and 3) -2 were introduced into HEK293 cells using FuGene6 Transfection Reagent, respectively, The cells were further cultured overnight under 5% CO ₂ conditions. On the next day, firefly luciferase activity and renilla luciferase activity of each well were measured as luminescence intensity with the following formula using a Dual-Glo Luciferase Assay System (Promega) with a plate reader (Mithras: Berthold Technologies). The reporter activity was calculated. Reporter activity = luminescence intensity derived from firefly luciferase activity / luminescence intensity derived from Renilla luciferase activity. As a result, only IL-8 promoter activity was increased in the pCI-hROBO4-introduced cells as compared to the negative control pCI-mock-introduced cells (FIG. 1). In addition, the increase in IL-8 promoter activity detected in pCI-hROBO4-introduced cells was greatly attenuated in cells into which mutants lacking the intracellular region of hROBO4 were introduced, and in pCI-hROBO4-ΔC-introduced cells. It was shown that the intracellular region of ROBO4 is required for the increase in IL-8 promoter activity detected in pCI-hROBO4-introduced cells (FIG. 2). Therefore, it was shown that the increase in the promoter activity of IL-8 in the pCI-hROBO4-introduced cells detected the activation of the downstream signal of ROBO4.

(Example 4) Property 4 of MAb1) -1 Downstream signal activation of ROBO4 of MAb1 The pCI-hROBO4-introduced cells or pCI-mock-introduced cells prepared in 3) -3 were cultured overnight, and the next day, anti-ROBO4 antibody ( MAb1, MAb2, MAb3, MAb4) or Mouse IgG1 (manufactured by R & D systems) as a negative control, 0, 0.3125, 1.25, 5, 20 μg / mL or 0, 0.25, 1, 4, 16 μg / mL It was added so that the mL, 37 ° C., for 5 hours at under 5% CO _2. Then, using a Dual-Glo Luciferase Assay System (Promega), measure the firefly luciferase activity and Renilla luciferase activity of each well as luminescence intensity with a plate reader (Mithras), and calculate the reporter activity of each well using the following formula did. Reporter activity = luminescence intensity derived from firefly luciferase activity / luminescence intensity derived from Renilla luciferase activity. As a result, negative IgG mouse IgG did not affect IL-8 promoter activity in human ROBO4 transient expression cells, but MAb1 increased IL-8 promoter activity (FIG. 3). MAb2 also increased IL-8 promoter activity, as did MAb1, but MAb3 and MAb4 did not increase IL-8 promoter activity (FIG. 4). In pCI-mock cells, MAb1 and MAb2 did not increase IL-8 promoter activity. From these results, it became clear that MAb1 activates the downstream signal of ROBO4, and that all ROBO4 antibodies do not activate the downstream signal of ROBO4.
For MAb3 and MAb4 in which no increase in the activity of the downstream signal of ROBO4 was observed, coexisting with cross-linked antibody (AffiPure Goat Anti-Mouse IgG Fc Fragment Specific, Cat NO. 115-005-071, Jackson ImmunoResearch) MA (1 molecule) When the promoter activity was evaluated by adding 2 molecules of cross-linked antibody to MAb4), an increase in promoter activity was observed in any antibody.

4) -2 HUVEC migration test HUVEC (manufactured by KURABO) was cultured overnight at 37 ° C. and 5% CO _{2 in} HuMedia-EB2 (manufactured by KURABO) containing 0.1% BSA, and then 0.1% BSA. It was prepared to 4 × 10 ⁵ cells / mL with the contained HuMedia-EB2. 0.25 mL of 4 × 10 ⁵ cells / mL cell suspension was added to the upper layer of the chamber of the BD Falcon fluoroblock 24 multiwell insert system (Pore size: 8 μm) coated with gelatin, and then 10 ng / mL was added to the lower layer of the chamber. HuB2E containing 0.1% BSA containing mL of human VEGF165 (manufactured by PeproTech) or human bFGF (manufactured by BD Healthcare Biosciences) and 2 μg / mL of Mouse IgG2A or anti-ROBO4 antibody (MAb1, MAb2, MAb3, MAb4) Was added. HUVECs that had been incubated for 2 to 3 hours at 37 ° C. and 5% CO ₂ and migrated to the lower layer were stained with HuMedia-EB2 containing 4 μg / mL Calcein-AM (manufactured by Life Technologies) for 15 minutes. Thereafter, the fluorescence intensity (excitation wavelength / fluorescence wavelength: 485 nm / 538 nm) of each well was measured with a plate reader (FlexStation: Molecular Devices), and the migrating cells of each well were calculated by the following formula. Migratory cells = fluorescence intensity of wells added with HUVEC−fluorescence intensity of wells not added with HUVEC. As a result, MAb1 suppressed HUVEC migration induced by VEGF or bFGF (FIG. 5). In addition, MAb2, like MAb1, inhibited HFGFEC migration induced by bFGF, but MAb3 and MAb4 did not inhibit cell migration (FIG. 6). From these results, it was shown that the increase in IL-8 promoter activity of anti-ROBO4 antibody correlates with the migration inhibition activity of HUVEC.

4) -3 Species crossover 4) -3-1 Preparation of antigen gene-expressing cells HEK293 cells were seeded in a 60 mm dish (Corning) at 1.5 × 10 ⁶ cells / dish, and DMEM containing 10% FBS. The cells were cultured overnight at 37 ° C. and 5% CO _{2 in} the medium. The next day, pCI-hROBO4, pCI-mROBO4, pCI-raROBO4, pCI-FLAG-cynoROBO4-1, pCI-FLAG-cynoROBO4-2, pCI-hROBO1, pCI-hROBO3 or pCI-HROB3 And further cultured overnight at 37 ° C. under 5% CO ₂ . On the next day, the expression vector-introduced cells were treated with TrypLE Express (manufactured by Life Technologies), washed with 5% FBS-containing PBS, and then suspended in 5% FBS-containing PBS. The resulting cell suspension was used for flow cytometry analysis.

4) -3-2 Flow cytometry analysis
4) After centrifuging the cell suspension prepared in 3-1 and removing the supernatant, the expression vector-introduced cells of 2 × 10 ⁵ cells were treated with MAb1 and Mouse IgG2A as a negative control at 10 μg / mL, respectively. Was added and suspended, and allowed to stand at 4 ° C. for 1 hour. After washing once with 5% FBS-containing PBS, Anti-Mouse IgG FITC conjugate diluted 1000 times with 5% FBS-containing PBS was added and suspended, and the mixture was allowed to stand at 4 ° C. for 1 hour. After washing 3 times with 5% FBS-containing PBS, the suspension was resuspended in 5% FBS-containing PBS and detected with a flow cytometer (BD FACSCalibur). Data analysis was performed with Flowjo. A histogram of FITC fluorescence intensity was prepared, and when the histogram of MAb1 was shifted to the strong fluorescence intensity side with respect to the fluorescence intensity histogram of Mouse IgG2A, which is a negative control, it was determined to be combined. As a result, MAb1 did not bind to mouse ROBO4 and rat ROBO4 but was found to bind to human ROBO4 and cynomolgus monkey ROBO4 in the cross-species study (FIG. 7).

4) -4 Binding specificity 4) -4-1 Preparation of antigen gene expressing cells
HEK293 cells were seeded in a 60 mm dish (Corning) at 1.2 × 10 ⁶ cells / dish or 1.5 × 10 ⁶ cells / dish, and 37% at 5 ° C. in DMEM medium containing 10% FBS. Cultured overnight under ₂ conditions. On the next day, pCI-hROBO4, pCI-FLAG-hROBO1, pCI-hROBO2 and pCI-hROBO3 were each introduced into HEK293 cells using FuGENE6 Transfection Reagent and further cultured overnight at 37 ° C. and 5% CO ₂ . On the next day, the expression vector-introduced cells were treated with TrypLE Express (manufactured by Life Technologies), washed with 5% FBS-containing PBS, and then suspended in 5% FBS-containing PBS. The resulting cell suspension was used for flow cytometry analysis.

4) -4-2 Flow cytometry analysis 4) After centrifuging the cell suspension prepared in 4-1 and removing the supernatant, MAb1, positive against 2 × 10 ⁵ cell expression vector-introduced cells Human ROBO4 Antibody as a control (R & D systems, Inc.), Monoclonal ANTI-FLAG (manufactured by SIGMA-ALDRICH Corp.) M2 antibody produced in mouse, Human ROBO2 Antibody (R & D systems, Inc.) or Monoclonal Anti-human ROBO3 Antibody (R & D systems, Inc. ) As a negative control, Mouse IgG1 or Mouse IgG2A was added to 10 μg / mL. And suspended at 4 ° C. for 1 hour. After washing once with 5% FBS-containing PBS, Anti-Mouse IgG FITC conjugate diluted 1000 times with 5% FBS-containing PBS was added and suspended, and the mixture was allowed to stand at 4 ° C. for 1 hour. After washing 3 times with 5% FBS-containing PBS, the suspension was resuspended in 5% FBS-containing PBS and detected with a flow cytometer (BD FACSCalibur). Data analysis was performed with Flowjo. A histogram of FITC fluorescence intensity was prepared, and when the histogram of MAb1 was shifted to the strong fluorescence intensity side with respect to the fluorescence intensity histogram of Mouse IgG1 or Mouse IgG2A which is a negative control, it was judged to be combined. As a result, it was revealed that MAb1 does not bind to hROBO1, hROBO2 or hROBO3 but specifically binds to hROBO4 (FIG. 8). The expression of hROBO4, hROBO1, hROBO2, and hROBO3 on the cell membrane was confirmed using a positive control antibody (FIG. 8).

4) -5 Epitope determination 4) -5-1 Preparation of antigen gene-expressing cells HEK293 cells were seeded in a 60 mm dish (Corning) at 1.5 × 10 ⁶ cells / dish, and DMEM medium containing 10% FBS. Incubated overnight under conditions of 37 ° C. and 5% CO ₂ . The next day, pCI-FLAG-hROBO4-28, pCI-FLAG-hROBO4-46, pCI-FLAG-hROBO4-132, pCI-FLAG-hROBO4-210, pCI-FLAG-hROBO4-225, pCI-FLAG-hROBO4-341 Each was introduced into HEK293 cells using FuGENE6 Transfection Reagent, and further cultured overnight at 37 ° C. and 5% CO ₂ . On the next day, the expression vector-introduced cells were treated with TrypLE Express (manufactured by Life Technologies), washed with 5% FBS-containing PBS, and then suspended in 5% FBS-containing PBS. The resulting cell suspension was used for flow cytometry analysis.

4) -5-2 Flow cytometric analysis 4) After centrifuging the cell suspension prepared in -5-1 and removing the supernatant, MAb1, positive against 2 × 10 ⁵ expression vector-introduced cells. Monoclonal ANTI-FLAG M2 antibody produced in mouse as a control and Mouse IgG2A as a negative control were added at 10 μg / mL, suspended, and allowed to stand at 4 ° C. for 1 hour. After washing once with 5% FBS-containing PBS, Anti-Mouse IgG FITC conjugate diluted 1000 times with 5% FBS-containing PBS was added and suspended, and the mixture was allowed to stand at 4 ° C. for 1 hour. The plate was washed 3 times with 5% FBS-containing PBS, resuspended in 5% FBS-containing PBS, and detected with a flow cytometer (BD FACSCalibur: BD Biosciences). Data analysis was performed with Flowjo. A histogram of FITC fluorescence intensity was prepared, and when the histogram of MAb1 was shifted to the strong fluorescence intensity side with respect to the fluorescence intensity histogram of Mouse IgG2A, which is a negative control, it was determined to be combined. As a result, MAb1 binds to pCI-FLAG-hROBO4-28, pCI-FLAG-hROBO4-46 or pCI-FLAG-hROBO4-132-introduced cells, and pCI-FLAG-hROBO4-210, pCI-FLAG-hROBO4- It did not bind to 225 or pCI-FLAG-hROBO4-341-introduced cells. Therefore, MAb1 was shown to recognize the amino acid sequence of human ROBO4 at positions 132 to 209 shown in SEQ ID NO: 2 (FIG. 9). It was confirmed by using a positive control anti-FLAG antibody that each intracellular domain domain-deficient was expressed on the cell membrane (FIG. 9).

4) -6 Drug efficacy evaluation in monkey laser induced choroidal neovascularization model 4) -6-1 Anesthesia Medetomidine hydrochloride (manufactured by Nippon Zenyaku Kogyo Co., Ltd.) was intramuscularly injected into cynomolgus monkeys at a dose of 0.04 mg / kg, 15 Minutes later, ketamine hydrochloride (Daiichi Sankyo Co., Ltd.) was intramuscularly injected at a dose of 15 mg / kg.

4) -6-2 Model preparation 4) Cynomolgus monkeys anesthetized in 6-6-1 were held in a monkey chair. Both eyes were instilled with 4% xylocaine ophthalmic solution (manufactured by AstraZeneca) to treat the surface of the eye with anesthesia and analgesia. 5 mg / mL tropicamide and 5 mg / mL phenylephrine hydrochloride mixed ophthalmic solution (manufactured by Santen Pharmaceutical Co., Ltd.) are instilled and dilated, and laser irradiation (irradiation) to the retinal macular region using a green laser photocoagulator OcuLight GLx (manufactured by Irideric) The amount of heat was 350-500 mW, the irradiation time was 0.1 seconds, the spot size was 50 μm, the number of spots was 6 or 9 spots), and thermal damage was applied.

4) -6-3 Test substance administration On the 7th day after model preparation, 50 μL of Vehicle or 13.2 mg / mL MAb1 was inserted into the vitreous body through the conjunctiva, and a 100 μL Hamilton syringe was inserted through the PE20 polyethylene tube. Infused over 2 minutes. Each group was performed with 4 eyes. After completion of the administration, 0.5% levofloxacin hydrate ophthalmic solution (manufactured by Santen Pharmaceutical Co., Ltd.) was instilled.

4) -6-4 Efficacy Evaluation On the 7th, 14th and 21st days after model preparation, normal fundus photography was performed with a hybrid fundus camera CX-1 (manufactured by Canon Inc.) under anesthesia. Thereafter, 10% fluorescein was intravenously administered at a dose of 0.1 mL / Kg. After intravenous injection of fluorescein, fluorescent angiography was performed every minute until a maximum of 6 minutes. Image data was preserve | saved and the area of the fluorescein retention part was computed with the image-analysis apparatus (WinRoof, Mitani Corporation make). The amount of new blood vessels was calculated by the following formula. New blood vessel amount = area of fluorescein staying part on the 21st day after model preparation−area of fluorescein staying part on the 7th day after model preparation. As a result, the amount of neovascularization in the vehicle administration group and that in the MAb1 administration group were compared. As a result, one of the four eyes in the MAb1 administration group showed no difference from the neovascularization amount in the vehicle group. A decrease was observed. That is, administration of MAb1 suppressed laser-induced choroidal neovascularization (FIG. 10).

Example 5 Cloning of MAb1 cDNA and Sequence Determination 5) -1 Determination of N-terminal amino acid sequences of heavy and light chains of MAb1 To determine the N-terminal amino acid sequences of heavy and light chains of MAb1, MAb1 purified in Example 2) -8 was separated by SDS-PAGE. The protein in the gel is transferred from the separated gel to a Sequi-Blot PVDF membrane (manufactured by BIO-RAD), washed with a washing buffer (25 mM NaCl, 10 mM sodium borate buffer pH 8.0), and then stained (50 % Methanol, 20% acetic acid, 0.05% Coomassie brilliant blue) and dyed for 5 minutes, and then decolorized with 90% methanol. Band portions corresponding to the heavy chain (the lower mobility band) and the light chain (the higher mobility band) visualized on the PVDF membrane were cut off. Using the Procise cLC protein sequencer Model 492cLC (Applied Biosystems), identification of each N-terminal amino acid sequence was attempted by the automated Edman method (see Edman et al. (1967) Eur. J. Biochem. 1, 80). . As a result, the N-terminal amino acid sequence of the band corresponding to the heavy chain of MAb1 is
EVQLVESGGGLVKPGGSLKL
And the N-terminal amino acid sequence of the band corresponding to the light chain is
DAVMQQTPLSLPPVSL
Met.

5) -2 Preparation of mRNA from MAb1-producing hybridoma In order to clone the cDNA encoding the heavy and light chains of MAb1, mRNA was prepared from the MAb1-producing hybridoma using the mRNA Isolation kit (Roche applied science).

5) -3 Cloning and sequencing of MAb1 cDNA The heavy and light chain isotypes determined in MAb1 heavy chain and light chain isotypes are γ1 and κ (Example 2) -7), 5-1) N-terminal amino acid sequences, and the amino acid sequence database of antibodies prepared by Kabat et al. (Strausberg, RL, et al. (2002) Proc. Natl. Acad. Sci. USA 99. 16899- 16903, and Kabat, EA, et al. (1991) in Sequences of Proteins of Immunological Interest Vol. I and II, US Department of Health and References, and the Humans region). Several oligonucleotide primers that hybridize to the 5 ′ terminal side and the 3 ′ terminal part including the stop codon were synthesized, respectively, and the mRNA prepared in 5) -2 and TaKaRa One Step RNA PCR Kit (AMV) (manufactured by Takara Bio Inc.) ) Was used to amplify the cDNA encoding the heavy chain and the light chain, and the cDNA encoding the heavy chain and the light chain of the antibody could be amplified with the following primer set.
Heavy chain primer set LYHF6: 5'-cctccaccagaactttgg-3 '
G1EVR1: 5′-aagatatatttattattaccaggagagtgggagg-3 ′
Light chain primer set MK19EIF1: 5'-agaagaattcatgaagttgcctgttag-3 '
KEVR1: 5'-aagatatcttaactactcattcctgttgaagct-3 '
The heavy chain and light chain cDNAs amplified by PCR were cloned using pEF6 / V5-His TOPO TA Expression Kit (manufactured by Invitrogen), and the nucleotide sequences of the variable regions of the cloned heavy chain and light chain, respectively. Was determined using a gene sequence analyzer (“ABI PRISM 3700 DNA Analyzer; Applied Biosystems” or “Applied Biosystems 3730xl Analyzer; Applied Biosystems”). GeneAmp 9700 (Applied Biosystems) was used for the sequence reaction.
The nucleotide sequence of the cDNA encoding the determined variable region of the heavy chain of MAb1 is shown in SEQ ID NO: 30 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 31. The nucleotide sequence of cDNA encoding the light chain variable region of mouse antibody MAb1 is shown in SEQ ID NO: 32 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 33 in the sequence listing.

(Example 6) Preparation of chimeric MAb1 (cMAb1) 6) -1 Preparation of expression vectors pCMA-LK, pCMA-G1, and pCMA-G2 6) -1-1 Preparation of chimeric and humanized light chain expression vector pCMA-LK Construction An approximately 5.4 kb fragment obtained by digesting plasmid pcDNA3.3-TOPO / LacZ (manufactured by Invitrogen) with restriction enzymes XbaI and PmeI, a human κ chain secretion signal and a human κ chain constant region shown in SEQ ID NO: 34 A DNA fragment containing a DNA sequence coding for was ligated using an In-Fusion Advantage PCR cloning kit (Clontech) to prepare pcDNA3.3 / LK.
Using pcDNA3.3 / LK as a template, PCR was performed with the following primer set, and the resulting 3.8 kb fragment was phosphorylated and then self-ligated to clone a signal sequence from pcDNA3.3 / LK downstream of the CMV promoter. Chimeric and humanized light chain expression vectors pCMA-LK with sites and human kappa chain constant regions were constructed.
Primer set 3.3-F1: 5′-tataccgtcgacctcttagctaggagtttggc-3 ′
3.3-R1: 5′-gctatggcagggcctgccgccccgacgtg-3 ′

6) -1-2 Construction of chimeric and humanized IgG1-type heavy chain expression vector pCMA-G1 A DNA fragment obtained by digesting pCMA-LK with XbaI and PmeI to remove the κ chain secretion signal and the human κ chain constant region; A DNA fragment (SEQ ID NO: 35) containing a heavy chain signal sequence and a DNA sequence encoding the amino acid of the human IgG1 constant region was ligated using an In-Fusion Advantage PCR cloning kit (Clontech) and downstream of the CMV promoter. A chimeric and humanized IgG1 type heavy chain expression vector pCMA-G1 having a signal sequence, a cloning site, a human IgG1 heavy chain constant region was constructed.

6) -1-3 Construction of chimeric and humanized IgG2-type heavy chain expression vector pCMA-G2 A DNA fragment obtained by digesting pCMA-LK with XbaI and PmeI to remove the kappa chain secretion signal and the human kappa chain constant region; A DNA fragment (SEQ ID NO: 36) comprising a heavy chain signal sequence and a DNA sequence encoding the amino acid of the human IgG2 constant region was ligated using an In-Fusion Advantage PCR cloning kit (Clontech) and downstream of the CMV promoter. A chimeric and humanized IgG2 type heavy chain expression vector pCMA-G2 having a signal sequence, a cloning site, a human IgG2 heavy chain constant region was constructed.

6) -2 Construction of MAb1 chimera type light chain expression vector Using the cDNA encoding the MAb1 light chain variable region as a template, KOD-Plus- (manufactured by TOYOBO) and the following primer set code the light chain variable region. By amplifying the portion containing cDNA to be inserted and inserting the chimeric and humanized antibody light chain expression general-purpose vector pCMA-LK with the restriction enzyme BsiWI using an In-Fusion Advantage PCR cloning kit (Clontech) The MAb1 chimeric type light chain expression vector was constructed. The obtained expression vector was named "pCMA-LK / MAb1L". The nucleotide sequence of MAb1 chimeric type light chain is shown in SEQ ID NO: 37 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 38. Nucleotide numbers 1 to 60 of SEQ ID NO: 37 in the sequence listing are signal sequences, 61 to 402 are variable regions, 403 to 717 are nucleotide sequences encoding constant regions, and amino acid numbers 1 to 20 of SEQ ID NO: 38 are signal sequences, 21 to 134 are variable regions, and 135 to 239 are constant region amino acids.
Light chain primer set MAb1LF: 5'-tctccgggcgcgtacggcgatgctgtgatgaccccaaactccactctcc-3 '
MAb1LR: 5'-ggaggggggcggcccaggcccgtttgattttccagctttggtgcctcc-3 '

6) -3 Construction of MAb1 chimeric IgG1-type heavy chain expression vector Using cDNA encoding heavy chain variable region of MAb1 as a template, KOD-Plus- (manufactured by TOYOBO) and the following primer set, Amplify the portion containing the encoded cDNA and insert the chimeric and humanized IgG1-type heavy chain expression vector pCMA-G1 with the restriction enzyme BsiWI using the In-Fusion Advantage PCR cloning kit (Clontech). Thus, an MAb1 chimeric IgG1-type heavy chain expression vector was constructed. The resulting expression vector was named “pCMA-G1 / MAb1H”. The nucleotide sequence of MAb1 chimeric IgG1 type heavy chain is shown in SEQ ID NO: 39 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 40. In the sequence listing, SEQ ID NO: 39, nucleotide numbers 1 to 57 are signal sequences, 58 to 411 are variable regions, 412 to 1401 are nucleotide sequences encoding constant regions, and amino acid numbers 1 to 19 of SEQ ID NO: 40 are signal sequences, 20 to 137 are variable regions, and 138 to 467 are constant region amino acid sequences.
Primer set MAb1HF for IgG1 type heavy chain: 5′-cagagtgggtgctgagcgaagtgcagctggtggagtctgggggag-3 ′
MAb1H1R: 5′-ttgggtggaggctgagctgactgtgagagtgggtgccgtggccccag-3 ′

6) -4 Construction of MAb1 chimeric IgG2 type heavy chain expression vector Using cDNA encoding the MAb1 heavy chain variable region as a template, KOD-Plus- (manufactured by TOYOBO) and the following primer set, the heavy chain variable region Amplify the portion containing the encoded cDNA, and insert the chimeric and humanized IgG2-type heavy chain expression vector pCMA-G2 with the restriction enzyme BsiWI using the In-Fusion Advantage PCR cloning kit (Clontech). Thus, an MAb1 chimeric IgG2 type heavy chain expression vector was constructed. The resulting expression vector was named “pCMA-G2 / MAb1”. The nucleotide sequence of MAb1 chimeric IgG2 type heavy chain is shown in SEQ ID NO: 41 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 42.
Primer set MAb1HF for IgG2 type heavy chain: 5′-cagagtgggtgctgagcgaagtgcagctgggtggagtctgggggag-3 ′
MAb12R: 5′-ttgggtgctggctgagctgactgtgagagtgggtgccgtggccccag-3 ′

(Example 7) Preparation of IgG1 type chimeric MAb1 antibody and IgG2 type chimeric MAb1 antibody 7) -1 Production of IgG1 type chimeric MAb1 antibody and IgG2 type chimeric MAb1 antibody FreeStyle 293F cells (manufactured by Invitrogen) were subcultured according to the manual. Culture was performed. Logarithmic growth phase 1.2 × 10 ⁹ FreeStyle 293F cells (Invitrogen) were seeded in 3L Fernbach Erlenmeyer Flask (CORNING), diluted with FreeStyle 293 expression medium (Invitrogen) 1.0 After adjusting to 10 ⁶ cells / mL, the cells were cultured with shaking at 90 rpm in an 8% CO ₂ incubator at 37 ° C. for 1 hour. Polyethyleneimine (Polyscience # 24765) 3.6 mg was dissolved in Opti-Pro SFM medium (Invitrogen) 20 ml, and then the H-chain expression vector (0) prepared using PureLink HiPure Plasmid kit (Invitrogen). 4 mg) and the L chain expression vector (0.8 mg) were suspended in 20 ml of Opti-Pro SFM medium (manufactured by Invitrogen). 20 ml of an expression vector / Opti-Pro SFM mixture was added to 20 ml of a polyethylenemine / Opti-Pro SFM mixture, gently stirred, allowed to stand for another 5 minutes, and then added to FreeStyle 293F cells. The culture supernatant obtained by shaking culture at 90 rpm for 7 days in a 37 ° C., 8% CO ₂ incubator was filtered with a Disposable Capsule Filter (# CCS-045-E1H manufactured by Advantec).
IgG1 type and IgG2 type chimeric MAb1 antibodies obtained by the combination of pCMA-G1 / MAb1H and pCMA-LK / MAb1L, and pCMA-G2 / MAb1H and pCMA-LK / MAb1L are designated as “cMAb1-1” and “ abbreviated as “cMAb1-2”. “CMAb1” means both IgG1 type and IgG2 type chimeric MAb1 antibodies.

7) -2 Purification of cMAb1-1 and cMAb1-2 The culture supernatant obtained in 7-1) was purified by rProtein A affinity chromatography (under 4-6 ° C). The buffer replacement step after purification of rProtein A affinity chromatography was performed at room temperature. First, 1100-1200 ml of the culture supernatant was applied to MabSelectSuRe (GE Healthcare Bioscience, HiTrap column: volume 1 ml × 2 linked) equilibrated with PBS. After all of the culture solution entered the column, the column was washed with PBS. Next, elution was performed with a 2M arginine hydrochloride solution (pH 4.0), and fractions containing the antibody were collected. The fraction was replaced with PBS by a desalting column (manufactured by GE Healthcare Bioscience, HiTrap Desalting column: volume 5 ml × 2 linked). Finally, it was concentrated with Centrifugal UF Filter Device VASPASP20 (fractionated molecular weight 30K, manufactured by Sartorius, 4 ° C.), and the IgG concentration was adjusted to 20.0 mg / ml or more to obtain a purified sample.

7) -3 Properties of cMAb1-1 and cMAb1-2 7) -3-1 Downstream signal activation of ROBO4 4) -1. However, Human IgG (manufactured by SIGMA-ARDRICH) was used as a negative control. Moreover, Human IgG, cMAb1-1, or cMAb1-2 was added to the medium so that the final concentration was 0.313 μg / mL. As a result, human IgG as a negative control did not affect IL-8 promoter activity in human ROBO4 transient expression cells, whereas cMAb1-1 and cMAb1-2 increased IL-8 promoter activity (FIG. 11). ). From these results, it became clear that cMAb1-1 or cMAb1-2 activates the downstream signal of ROBO4 in the same manner as MAb1.

7) -3-2 HUVEC migration test It was carried out according to the method of 4) -2. However, Human IgG was used as a negative control. Moreover, Human IgG, cMAb1-1, or cMAb1-2 was added to the medium so that the final concentration was 0.5 μg / mL. As a result, cMAb1-1 or cMAb1-2 suppressed migration of HUVEC induced by bFGF (FIG. 12). From these results, it was clarified that cMAb1-1 or cMAb1-2 suppresses HUVEC migration in the same manner as MAb1.

(Example 8) Design of humanized antibody of mouse anti-human ROBO4 monoclonal antibody MAb1 8) -1 Design of humanized version of MAb1 8) -1-1 Molecular modeling of variable region of MAb1 Molecular modeling of variable region of MAb1 The method was performed by a method generally known as homology modeling (Methods in Enzymology, 203, 121-153, (1991)). Primary sequence of variable region of human immunoglobulin registered in Protein Data Bank (Nuc. Acid Res. 35, D301-D303 (2007)) (three-dimensional structure derived from X-ray crystal structure is available) Were compared to the variable region of MAb1 determined above. As a result, 3FFD was selected as having the highest sequence homology among antibodies that are similarly defective in the framework to the variable region of the heavy chain of MAb1. 1T66 was also selected as having the highest sequence homology to the variable region of the light chain of MAb1. The three-dimensional structure of the framework region was created by combining the 3FFD and 1T66 coordinates of MAb1 corresponding to the heavy and light chains to obtain a “framework model”. The CDRs of MAb1 are described in Thornton et al. According to the classification of (J. Mol. Biol., 263, 800-815, (1996)), CDRL1, CDRL2, CDRL3, CDRH1 and CDRH2 were assigned to clusters 16A, 7A, 9A, 10A, and 10B, respectively. CDRH3 was classified as k (7) B using the H3 rule (FEBS letter 399, 1-8 (1996)). A representative conformation for each CDR was then incorporated into the framework model.
Finally, in order to obtain a molecular model of the MAb1 variable region in terms of energy, an energy calculation was performed to eliminate adverse interatomic contacts. The above procedure was performed using a commercially available protein tertiary structure prediction program Prime and a conformational search program MacroModel (Schrodinger, LLC).

8) -1-2 Designing the amino acid sequence for humanized MAb1 The construction of the humanized MAb1 antibody (hMAb1) is commonly described as CDR grafting (Proc. Natl. Acad. Sci. USA 86, 1000029-10033 (1989)). By a known method. Acceptor antibodies were selected in two ways based on amino acid homology within the framework regions. The sequence of the MAb1 framework region was compared with all human frameworks in the Kabat database of antibody amino acid sequences (Nuc. Acid Res. 29, 205-206 (2001)), resulting in the B3 antibody being the framework region. Was selected as an acceptor due to the 83% sequence homology for. The amino acid residues in the framework region for B3 were aligned with the amino acid residues for MAb1, and the positions where different amino acids were used were identified. The positions of these residues are analyzed using the 3D model of MAb1 constructed above, and the donor residues to be graphed on the acceptor are described in Queen et al. (Proc. Natl. Acad. Sci. USA 86, 1000029-10033 (1989)). A humanized MAb1 sequence was constructed as described in the examples below by transferring several selected donor residues into the acceptor antibody. In addition, hMAb1 mutants in which 1 to 3 amino acid residues in each CDR of hMAb1 were substituted with other amino acid residues were also constructed as described in the following examples.

8) -2 Humanization of cMAb1 heavy chain 8) -2-1 hMAb1-H1 type heavy chain:
The amino acid number 32 (lysine) of the cMAb1-2 heavy chain shown in SEQ ID NO: 42 in the sequence listing is glutamine, amino acid number 38 (lysine) is arginine, amino acid number 59 (threonine) is alanine, and amino acid number 61 (glutamic acid). ) To glycine, amino acid number 63 (arginine) to glycine, amino acid number 95 (glutamic acid) to lysine, amino acid number 103 (serine) to asparagine, amino acid number 107 (serine) to alanine, amino acid number 112 (methionine) ) To valine, amino acid number 114 (phenylalanine) to tyrosine, amino acid number 129 (histidine) to glutamine, amino acid number 132 (threonine) to leucine, and amino acid number 133 (leucine) to valine. Humanization The Ab1 heavy chain was named "hMAb1-H1-type heavy chain".
The amino acid sequence of the hMAb1-H1 type heavy chain is set forth in SEQ ID NO: 56 in the Sequence Listing. The sequence consisting of amino acid residues 1 to 19 of the amino acid sequence of SEQ ID NO: 56, the sequence consisting of amino acid residues 20 to 137, the sequence consisting of amino acid residues 138 to 463 are respectively a signal sequence and a heavy chain It corresponds to the variable region and heavy chain constant region. The sequence consisting of amino acid residues 50 to 54, the sequence consisting of amino acid residues 69 to 85, and the sequence consisting of amino acid residues 118 to 126 of the amino acid sequence of SEQ ID NO: 56 are the CDRH1 sequence and CDRH2 sequence, respectively. Corresponds to the CDRH3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 56 is set forth in SEQ ID NO: 55 of the Sequence Listing. The sequence consisting of nucleotides 1 to 57, the sequence consisting of nucleotides 58 to 411, and the sequence consisting of nucleotides 412 to 1389 of the nucleotide sequence of SEQ ID NO: 55 are a signal sequence, a heavy chain variable region sequence and a heavy chain constant, respectively. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 55 and the amino acid sequence of SEQ ID NO: 56 are also shown in FIGS. 31 and 32, respectively.

8) -2-2 hMAb1-H2 type heavy chain:
The amino acid number 32 (lysine) of the cMAb1-2 heavy chain shown in SEQ ID NO: 42 in the sequence listing is glutamine, amino acid number 38 (lysine) is arginine, amino acid number 59 (threonine) is alanine, and amino acid number 61 (glutamic acid). ) To glycine, amino acid number 63 (arginine) to glycine, amino acid number 72 (asparagine) to glutamine, amino acid number 95 (glutamic acid) to lysine, amino acid number 103 (serine) to asparagine, amino acid number 107 (serine) ) Is alanine, amino acid number 112 (methionine) is valine, amino acid number 114 (phenylalanine) is tyrosine, amino acid number 129 (histidine) is glutamine, amino acid number 132 (threonine) is leucine, and amino acid number 133 (leucine). Was the the accompanying designed humanized MAb1 heavy chain to replace the valine designated "hMAb1-H2-type heavy chain".
The amino acid sequence of the hMAb1-H2 type heavy chain is set forth in SEQ ID NO: 58 in the Sequence Listing. The sequence consisting of amino acid residues 1 to 19 of the amino acid sequence of SEQ ID NO: 58, the sequence consisting of amino acid residues 20 to 137, the sequence consisting of amino acid residues 138 to 463 are respectively a signal sequence and a heavy chain It corresponds to the variable region and heavy chain constant region. The sequence consisting of amino acid residues 50 to 54, the sequence consisting of amino acid residues 69 to 85, the sequence consisting of amino acid residues 118 to 126 of the amino acid sequence of SEQ ID NO: 58 are the CDRH1 sequence and CDRH2 sequence, respectively. Corresponds to the CDRH3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 58 is set forth in SEQ ID NO: 57 of the Sequence Listing. The sequence consisting of nucleotides 1 to 57, the sequence consisting of nucleotides 58 to 411, and the sequence consisting of nucleotides 412 to 1389 of the nucleotide sequence of SEQ ID NO: 57 are a signal sequence, a heavy chain variable region sequence and a heavy chain constant, respectively. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 57 and the amino acid sequence of SEQ ID NO: 58 are also shown in FIGS. 33 and 34, respectively.

8) -2-3 hMAb1-H3 type heavy chain:
The amino acid number 32 (lysine) of the cMAb1-2 heavy chain shown in SEQ ID NO: 42 in the sequence listing is glutamine, amino acid number 38 (lysine) is arginine, amino acid number 59 (threonine) is alanine, and amino acid number 61 (glutamic acid). ) For glycine, amino acid number 95 (glutamic acid) for lysine, amino acid number 103 (serine) for asparagine, amino acid number 107 (serine) for alanine, amino acid number 112 (methionine) for valine, amino acid number 114 (phenylalanine). ) To tyrosine, amino acid number 129 (histidine) to glutamine, amino acid number 132 (threonine) to leucine, and amino acid number 133 (leucine) to valine for the humanized MAb1 heavy chain designated “hMAb1- H3 type heavy chain " It was named.
The amino acid sequence of the hMAb1-H3 type heavy chain is set forth in SEQ ID NO: 60 in the Sequence Listing. The sequence consisting of the 1st to 19th amino acid residues of the amino acid sequence of SEQ ID NO: 60, the sequence consisting of the 20th to 137th amino acid residues, and the sequence consisting of the 138th to 463rd amino acid residues are respectively a signal sequence and a heavy chain It corresponds to the variable region and heavy chain constant region. The sequence consisting of amino acid residues 50 to 54, the sequence consisting of amino acid residues 69 to 85, and the sequence consisting of amino acid residues 118 to 126 of the amino acid sequence of SEQ ID NO: 60 are the CDRH1 sequence and CDRH2 sequence, respectively. Corresponds to the CDRH3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 60 is set forth in SEQ ID NO: 59 of the Sequence Listing. The sequence consisting of nucleotides 1 to 57, the sequence consisting of nucleotides 58 to 411, and the sequence consisting of nucleotides 412 to 1389 of the nucleotide sequence of SEQ ID NO: 59 are the signal sequence, heavy chain variable region sequence and heavy chain constant, respectively. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 59 and the amino acid sequence of SEQ ID NO: 60 are also shown in Figs.

8) -2-4 hMAb1-H4 type heavy chain:
The amino acid number 32 (lysine) of the cMAb1-2 heavy chain shown in SEQ ID NO: 42 in the sequence listing is glutamine, amino acid number 38 (lysine) is arginine, amino acid number 59 (threonine) is alanine, and amino acid number 61 (glutamic acid). ) To glycine, amino acid number 72 (asparagine) to glutamine, amino acid number 95 (glutamic acid) to lysine, amino acid number 103 (serine) to asparagine, amino acid number 107 (serine) to alanine, amino acid number 112 (methionine) ) To valine, amino acid number 114 (phenylalanine) to tyrosine, amino acid number 129 (histidine) to glutamine, amino acid number 132 (threonine) to leucine, and amino acid number 133 (leucine) to valine. Tahi It was named "hMAb1-H4-type heavy chain" and of MAb1 heavy chain.
The amino acid sequence of the hMAb1-H4 type heavy chain is set forth in SEQ ID NO: 62 in the sequence listing. The sequence consisting of amino acid residues 1 to 19 of the amino acid sequence of SEQ ID NO: 62, the sequence consisting of amino acid residues 20 to 137, the sequence consisting of amino acid residues 138 to 463 are respectively a signal sequence and a heavy chain It corresponds to the variable region and heavy chain constant region. The sequence consisting of amino acid residues 50 to 54, the sequence consisting of amino acid residues 69 to 85, and the sequence consisting of amino acid residues 118 to 126 of the amino acid sequence of SEQ ID NO: 62 are respectively CDRH1 sequence and CDRH2 sequence. Corresponds to the CDRH3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 62 is described in SEQ ID NO: 61 of the Sequence Listing. The sequence consisting of nucleotides 1 to 57, the sequence consisting of nucleotides 58 to 411, and the sequence consisting of nucleotides 412 to 1389 of the nucleotide sequence of SEQ ID NO: 61 are a signal sequence, a heavy chain variable region sequence and a heavy chain constant, respectively. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 61 and the amino acid sequence of SEQ ID NO: 62 are also shown in FIGS. 37 and 38, respectively.

8) -3 Humanization of MAb1 light chain 8) -3-1 hMAb1-L1 type light chain:
The amino acid number 22 (alanine) of the cMAb1 light chain shown in SEQ ID NO: 38 in the sequence listing is isoleucine, amino acid number 27 (threonine) is serine, amino acid number 34 (serine) is threonine, and amino acid number 37 (aspartic acid). Is glutamic acid, amino acid number 38 (glutamine) is proline, amino acid number 62 (phenylalanine) is leucine, amino acid number 84 (leucine) is proline, amino acid number 108 (phenylalanine) is valine, and amino acid number 112 (phenylalanine). To tyrosine, amino acid number 125 (glycine) to proline, amino acid number 129 (leucine) to valine, amino acid number 130 (glutamic acid) to aspartic acid, and amino acid number 134 (alanine) to threonine. The have designed humanized MAb1 light chain was designated "hMAb1-L1 type light chain".
The amino acid sequence of the hMAb1-L1 type light chain is set forth in SEQ ID NO: 64 in the sequence listing. The sequence consisting of the 1st to 20th amino acid residues, the sequence consisting of the 21st to 134th amino acid residues, and the sequence consisting of the 135th to 239th amino acid residues of the amino acid sequence of SEQ ID NO: 64 are respectively a signal sequence and a light chain It corresponds to the variable region and the light chain constant region. The sequence consisting of the 44th to 59th amino acid residues, the sequence consisting of the 75th to 81st amino acid residues, and the sequence consisting of the 114th to 122nd amino acid residues of the amino acid sequence of SEQ ID NO: 64 are the CDRL1 sequence and the CDRL2 sequence, respectively. , Corresponding to the CDRL3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 64 is set forth in SEQ ID NO: 63 of the Sequence Listing. The sequence consisting of the 1st to 60th nucleotides, the sequence consisting of the 61st to 402nd nucleotides, and the sequence consisting of the 403th to 717th nucleotides of the nucleotide sequence of SEQ ID NO: 63 are respectively a signal sequence, a light chain variable region sequence and a light chain constant. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 63 and the amino acid sequence of SEQ ID NO: 64 are also shown in FIGS. 39 and 40, respectively.

8) -3-2 hMAb1-L2 type light chain:
The amino acid number 22 (alanine) of the cMAb1 light chain shown in SEQ ID NO: 38 in the sequence listing is isoleucine, amino acid number 27 (threonine) is serine, amino acid number 34 (serine) is threonine, and amino acid number 37 (aspartic acid). Is glutamic acid, amino acid number 38 (glutamine) is proline, amino acid number 52 (serine) is glutamic acid, amino acid number 54 (glycine) is lysine, amino acid number 56 (threonine) is leucine, and amino acid number 62 (phenylalanine). Amino acid number 84 (leucine) as proline, amino acid number 108 (phenylalanine) as valine, amino acid number 112 (phenylalanine) as tyrosine, amino acid number 125 (glycine) as proline, amino acid number 129 (leucine) The valine amino acid Nos 130 (glutamic acid) aspartic acid, amino acid number 134 humanized MAb1 light chain designed with replacing the threonine (alanine) designated "hMAb1-L2 type light chain".
The amino acid sequence of the hMAb1-L2 type light chain is set forth in SEQ ID NO: 66 in the sequence listing. The sequence consisting of the 1st to 20th amino acid residues, the sequence consisting of the 21st to 134th amino acid residues, and the sequence consisting of the 135th to 239th amino acid residues of the amino acid sequence of SEQ ID NO: 66 are respectively a signal sequence and a light chain It corresponds to the variable region and the light chain constant region. The sequence consisting of the 44th to 59th amino acid residues, the sequence consisting of the 75th to 81st amino acid residues, and the sequence consisting of the 114th to 122nd amino acid residues of the amino acid sequence of SEQ ID NO: 66 are the CDRL1 sequence and the CDRL2 sequence, respectively. , Corresponding to the CDRL3 sequence. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 66 is set forth in SEQ ID NO: 65 of the Sequence Listing. The sequence consisting of the 1st to 60th nucleotides, the sequence consisting of the 61st to 402th nucleotides, and the sequence consisting of the 403th to 717th nucleotides of the nucleotide sequence of SEQ ID NO: 65 are respectively a signal sequence, a light chain variable region sequence and a light chain constant. The normal region sequence is encoded. The nucleotide sequence of SEQ ID NO: 65 and the amino acid sequence of SEQ ID NO: 66 are also shown in FIGS. 41 and 42, respectively.

(Example 9) Production of humanized MAb1 9) -1 Construction of heavy chain expression vector of humanized MAb1 9) -1-1 Construction of hMAb1-H1 type heavy chain expression vector Amino acid number 20 of SEQ ID NO: 56 in the sequence listing To 137, DNA containing the gene encoding the hMAb1-H1 type heavy chain variable region is synthesized (GENEART Co., Ltd., artificial gene synthesis service), and the DNA fragment excised with the restriction enzyme BlpI is synthesized into chimeric and humanized IgG2 type heavy chain. The hMAb1-H1 type heavy chain expression vector was constructed by inserting the chain expression vector (pCMA-G2) into the site cleaved with the restriction enzyme BlpI. The obtained expression vector was designated as “pCMA-G2 / hMAb1-H1”. The nucleotide sequence of the hMAb1-H1 type heavy chain is shown in SEQ ID NO: 55 in the Sequence Listing.

9) -1-2 Construction of hMAb1-H2 type heavy chain expression vector 9) Using the pCMA-G2 / hMAb1-H1 constructed in 1-1 as a template, the following primer set and QuikChange XL Site-Directed An hMAb1-H2 type heavy chain expression vector was constructed using Mutagenesis Kit (manufactured by Agilent Technologies). The obtained expression vector was designated as “pCMA-G1 / hMAb1-H2”. The nucleotide sequence of the hMAb1-H2 type heavy chain is shown in SEQ ID NO: 57 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 58.
Primer set H-N53Q-F: 5′-gggtggcaacccatcacccaggcggcaccactacactac-3 ′
H-N53Q-R: 5′-gtaggtgttaggtgccgccttggctctatgtgtcccccc-3 ′

9) -1-3 Construction of hMAb1-H3 type heavy chain expression vector A DNA containing a gene encoding the hMAb1-H3 type heavy chain variable region shown in amino acid numbers 20 to 137 of SEQ ID NO: 60 in the sequence listing was synthesized. (GENEART artificial gene synthesis service), a DNA fragment excised with the restriction enzyme BlpI is inserted into a site where the chimeric and humanized IgG2 type heavy chain expression vector (pCMA-G2) has been cleaved with the restriction enzyme BlpI, thereby hMAb1- An H3 type heavy chain expression vector was constructed. The obtained expression vector was designated as “pCMA-G2 / hMAb1-H3”. The nucleotide sequence of the hMAb1-H3 type heavy chain is shown in SEQ ID NO: 59 in the Sequence Listing.

9) -1-4 Construction of hMAb1-H4 type heavy chain expression vector 9) Using the pCMA-G2 / hMAb1-H3 constructed in 1-3 as a template, the following primer set and QuikChange XL Site-Directed An hMAb1-H4 type heavy chain expression vector was constructed using Mutagenesis Kit (manufactured by Agilent Technologies). The obtained expression vector was designated as “pCMA-G1 / hMAb1-H4”. The nucleotide sequence of the hMAb1-H4 type heavy chain is shown in SEQ ID NO: 61 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 62.
Primer set H-N53Q-F: 5′-gggtggcaacccatcacccaggcggcaccactacactac-3 ′
H-N53Q-R: 5′-gtaggtgttaggtgccgccttggctctatgtgtcccccc-3 ′

9) -2 Construction of humanized MAb1 light chain expression vector 9) -2-1 Construction of hMAb1-L1 type light chain expression vector hMAb1-L1 type light chain variable region represented by amino acid numbers 21 to 134 of SEQ ID NO: 64 DNA containing a gene coding for the gene (GENEART, artificial gene synthesis service), a DNA fragment excised with the restriction enzyme BsiWI, a chimeric and humanized antibody light chain expression general-purpose vector (pCMA-LK) with the restriction enzyme BsiWI An hMAb1-L1 type light chain expression vector was constructed by inserting into the cut site. The obtained expression vector was designated as “pCMA-LK / hMAb1-L1”. The nucleotide sequence of the hMAb1-L1 type light chain is shown in SEQ ID NO: 63 of the Sequence Listing.

9) 2-2 Construction of hMAb1-L2 type light chain expression vector 9) Using pCMA-LK / hMAb1-L1 constructed in 2-1 as a template, KOD-Plus- (manufactured by TOYOBO) and primer set A The DNA fragment obtained by PCR using the primer set B and the DNA fragment obtained by performing PCR using the primer set B were combined by overlap extension PCR using the primer set C to obtain a hMAb1-L2 type light chain. A DNA containing a gene encoding a chain is prepared, a DNA fragment excised with restriction enzyme XbaI and restriction enzyme PmeI, a chimeric and humanized antibody light chain expression general-purpose vector (pCMA-LK) with restriction enzyme XbaI and restriction enzyme PmeI HMAb by inserting into the cut location A 1-L2 type light chain expression vector was constructed. The obtained expression vector was designated as “pCMA-LK / hMAb1-L2”. The nucleotide sequence of the hMAb1-L2 type light chain is shown in SEQ ID NO: 65 of the Sequence Listing, and the amino acid sequence is shown in SEQ ID NO: 66.

Primer set A
L inf-F: 5′-gcctccggactctagagccccaccgggtgctgcagaccccaggtgtc-3 ′
L-EKL-R: 5'-caggtacaggttctttgtttcgtttttccagggctctggctctctctgcagc-3 '

Primer set B
L-EKL-F: 5'-gaaaacgagaacaagaacctgtacctgaactggtattctgcaagaccccg-3 '
L inf-R: 5'-tagcctccccccgtttaaacggggccccataactcccccctg-3 '

Primer set C
L inf-F: 5′-gcctccggactctagagccccaccgggtgctgcagaccccaggtgtc-3 ′
L inf-R: 5'-tagcctccccccgtttaaacggggccccataactcccccctg-3 '

Example 10 Preparation 10 of Humanized MAb1 Production of Humanized MAb1
FreeStyle 293F cells (manufactured by Invitrogen) were subcultured and cultured according to the manual.
Logarithmically growing 1.2 × 10 ⁹ FreeStyle 293F cells (Invitrogen) were seeded in 3L Fernbach Erlenmeyer Flask (CORNING), and FreeStyle 293 expression medium (INVITROG) diluted with INVITROEN 1.0 After adjusting to 10 ⁶ cells / mL, the cells were cultured with shaking at 90 rpm in an 8% CO ₂ incubator at 37 ° C. for 1 hour. Polyethyleneimine (Polyscience # 24765) 3.6 mg was dissolved in 20 ml of Opti-Pro SFM medium (Invitrogen), and then an H chain expression vector (0.4 mg) prepared using PureLink HiPure Plasmid kit (Invitrogen) And the L chain expression vector (0.8 mg) were suspended in 20 ml of Opti-Pro SFM medium (manufactured by Invitrogen). 20 ml of an expression vector / Opti-Pro SFM mixture was added to 20 ml of a polyethylenemine / Opti-Pro SFM mixture, gently stirred, allowed to stand for another 5 minutes, and then added to FreeStyle 293F cells. The culture supernatant obtained by shaking culture at 90 rpm for 7 days in a 37 ° C., 8% CO ₂ incubator was filtered with a Disposable Capsule Filter (ADVANTEC # CCS-045-E1H) and purified in the same manner as 7) -2. did.
The humanized MAb1 antibody obtained by the combination of pCMA-G2 / hMAb1-H1 and pCMA-LK / hMAb1-L1 was designated as “H-1040”, pCMA-G2 / hMAb1-H2 and pCMA-LK / hMAb1-L1. The humanized MAb1 antibody obtained by the combination is “H-1140”, the humanized MAb1 antibody obtained by the combination of pCMA-G2 / hMAb1-H2 and pCMA-LK / hMAB1-L2 is “H-1143”, pCMA -The humanized MAb1 antibody obtained by the combination of G2 / hMAb1-H3 and pCMA-LK / hMAb1-L1 is designated as “H-2040”, the combination of pCMA-G2 / hMAb1-H4 and pCMA-LK / hMAb1-L1 The humanized MAb1 antibody obtained by the method "H-2140" and p MA-G2 / hMAb1-H4 and pCMA-LK / hMAb1-L2 and humanized MAb1 antibodies obtained by a combination of designated "H-2143".

(Example 11) Properties of humanized anti-ROBO4 antibody 11) -1 Binding affinity The dissociation constant of the antibody and rROBO4-ECD was measured using Biacore 3000 (GE Healthcare Bioscience), and the antibody was immobilized as a ligand. Antigen was measured as an analyte. About 80 RU was bound to the antibody via an anti-human IgG antibody (GE Healthcare Bioscience) immobilized on a sensor chip CM5 (GE Healthcare Bioscience) by the amine coupling method. PBS containing 0.05% Surfactant P20 was used as a running buffer. A dilution series solution of the antigen (0.1-200 nM) was added to the antibody-bound chip for 300 seconds at a flow rate of 30 μL / min, and then the dissociation phase for 300 seconds was monitored. As a regeneration solution, 3M MgCl ₂ was added at a flow rate of 10 μL / min for 30 seconds. For the analysis of the data, a 1: 1 binding model of analysis software (BIAevaluation Software, version 4.1) was used, and the association rate constant kon, the dissociation rate constant koff and the dissociation constant (K _D ; K _D = koff / kon) Was calculated. As a result, _{K D} values H-1040 is 0.41 nM, H-1143 is 3.5 nM, H-1140 is 3.9 nM, H-2040 is 0.40 nM, H-2143 is 1.7 nM, H-2140 Was 1.8 nM.

11) -2 Downstream signal activation of ROBO4 It carried out according to the method of 4) -1. However, Human IgG was used as a negative control. Moreover, Human IgG, H-1143, H-2140, H-2143, or cMAb1-2 was added to the medium so that the final concentration was 0.63 μg / mL. As a result, human IgG as a negative control did not affect IL-8 promoter activity in human ROBO4 transient expression cells, but any humanized anti-ROBO4 antibody exhibited IL-8 promoter activity equivalent to cMAb1-2. Raised (Figure 49). From these results, it was revealed that any humanized anti-ROBO4 antibody activates the downstream signal of ROBO4, similar to MAb1.

11) -3 HUVEC migration test It implemented according to the method of 4) -2. However, human IgG was used as a negative control. Further, Human IgG, H-1143, H-2140 or H-2143 was added to the medium so that the final concentration was 0.5 μg / mL. The fluorescence intensity (excitation wavelength / fluorescence wavelength: 485 nm / 538 nm) of each well was measured with a plate reader (EnVision: PerkinElmer). As a result, H-1143, H-2140, or H-2143 suppressed the migration of HUVEC induced by bFGF (FIG. 50). From these results, it became clear that H-1143, H-2140 or H-2143 inhibits HUVEC migration.

11) -4 Species crossover 11) -4-1 Preparation of antigen gene expression cell 4) It was carried out according to the method of 3-1

11) -4-2 Flow cytometry analysis
4) Implemented according to the method of 3-2. However, human IgG was used as a negative control, and FITC-AffiniPure Goat Anti-Human IgG, Fcγ Fragment Specific (manufactured by Jackson ImmunoResearch) was used as the secondary antibody. Further, a flow cytometer (FC500: manufactured by Beckman Coulter) was used as the detection device. As a result, H-1143, H-2140, or H-2143 did not bind to mouse ROBO4 and rat ROBO4, but to human ROBO4 and cynomolgus monkey ROBO4, similarly to MAb1 of the parent antibody ( 51, 52, 53).

11) -5 Binding specificity of H-1143, H-2140, H-2143 11) -5-1 Preparation of antigen gene expression cells
4) Carried out according to the method of 4-1 However, pCI-FLAG-hROBO4-28 was used as the human ROBO4 expression vector.

11) -5-2 Flow cytometry analysis 4) The analysis was performed according to the method of 4-2. However, human IgG or Mouse IgG2A was used as a negative control, and the secondary antibody was Fluorescein-conjugated goat IgG fraction to mouse IgG (manufactured by Cappel) or FITC-AffiniPure Goat Anti-HumanFc, which was used as a secondary control. Moreover, the flow cytometer (FC500) was used for the detection apparatus. As a result, it became clear that H-1143, H-2140, and H-2143 do not bind to hROBO1, hROBO2, or hROBO3, but specifically bind to hROBO4, similarly to MAb1 of the parent antibody (FIG. 54). ). The expression of hROBO4, hROBO1, hROBO2, and hROBO3 on the cell membrane was confirmed using a positive control antibody (FIG. 54).

11) -6 Efficacy evaluation in monkey laser induced choroidal neovascularization model 11) -6-1 Anesthesia Medetomidine hydrochloride is intramuscularly injected into cynomolgus monkey at a dose of 0.08 mg / kg, and 15 mg / kg is administered 15 minutes later. Intramuscularly injected with ketamine hydrochloride.

11) -6-2 Model preparation 11) Cynomolgus monkeys anesthetized in 6-6-1 are held in a supine position on a stainless surgical table, and 5 mg / mL tropicamide, 5 mg / mL phenylephrine hydrochloride mixed ophthalmic solution is instilled to make mydriasis. Then, using a green laser photocoagulation apparatus OccuLight GLx, the retinal macular region was irradiated with laser (irradiation heat amount: 500 mW, irradiation time: 0.1 second, spot size: 50 μm, spot number: 9 spots), and heat damage was applied. After the operation, Cravit eye drops were dropped on the surgical eye.

11) -6-3 Test substance administration After anesthesia on the seventh day after the model was prepared, it was held in a supine position on a stainless surgical table. Thereafter, PA / iodine ophthalmic solution (manufactured by Nippon Eye Drops Research Institute) diluted 4 times with sterilized purified water was instilled to sterilize the external eye, and a 33G needle was inserted into the vitreous from the conjunctiva, using a 1 mL syringe. Saline (or 0.05 mL of H-2143 prepared to 1.1 mg / 0.05 mL was injected. After administration, Linderon A ointment for ophthalmology and otology was applied to the conjunctiva with a sterile cotton swab, and the eyelids were opened and closed. And spread all over the eye surface.

11) -6-4 Evaluation of drug efficacy On the seventh day, the 14th day, and the 21st day after model preparation, normal fundus photography was performed with the hybrid fundus camera CX-1 under anesthesia. Thereafter, fluorescein was intravenously administered at a dose of 0.05 mL / kg. After intravenous injection of fluorescein, fluorescent angiography was performed every minute until a maximum of 10 minutes and stored as image data. From the image data, according to the method of Zahn G et al. (Zahn G et. Al Arch. Ophthalmol. 2009 127: 1329-1335), the intensity of fluorescence in the fluorescein-retained portion at each laser irradiation site is divided into 5 levels (from grade 1). The severity classification of 5) was performed. Thereafter, the proportion corresponding to the severity classification of grades 4 and 5 in the severity classification in all laser irradiation sites was calculated as a percentage, and choroidal neovascularization was evaluated. As a result of comparing the choroidal neovascularization of the Saline administration group and the H-2143 administration group, the proportion of grades 4 and 5 increased with time after the model was prepared in the Saline administration group, whereas in the H-2143 administration group The increase was not observed. That is, administration of H-2143 suppressed laser-induced choroidal neovascularization (FIG. 55).

  By using the antibody provided by the present invention, wet age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, Intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis, treatment or prevention of angiogenic diseases such as obesity, and The angiogenic disease can be examined or diagnosed.

SEQ ID NO: 1 Nucleotide sequence of human ROBO4 full-length cDNA (FIG. 13)
SEQ ID NO: 2; amino acid sequence of human ROBO4 (FIG. 14)
SEQ ID NO: 3: Nucleotide sequence encoding the amino acid sequence of N-terminal FLAG-tag added full-length human ROBO4 SEQ ID NO: 4: Amino acid sequence of N-terminal FLAG-tag added full-length human ROBO4 SEQ ID NO: 5: Human ROBO4 of SEQ ID NO: 2 Nucleotide sequence that encodes the amino acid sequence of an N-terminal FLAG-tag added human ROBO4 extracellular region domain-deficient that is an extracellular region domain-deficient comprising the amino acid sequence of amino acid numbers 46 to 1007 SEQ ID NO: 6: human ROBO4 is a sequence Amino acid sequence of N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient, which is an extracellular region domain-deficient consisting of amino acid sequences of amino acid numbers 46 to 1007 of number 2 SEQ ID NO: 7: human ROBO4 is SEQ ID NO: 2 Amino acid numbers 132 to A nucleotide sequence that encodes the amino acid sequence of an N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient that is an extracellular region domain-deficient comprising the amino acid sequence of 007 SEQ ID NO: 8: human ROBO4 is the amino acid of SEQ ID NO: 2 Amino acid sequence of N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient, which is an extracellular region domain-deficient comprising the amino acid sequences of Nos. 132 to 1007 SEQ ID NO: 9: Amino acid number of human ROBO4 of SEQ ID NO: 2 Nucleotide sequence SEQ ID NO: 10 encoding the amino acid sequence of an N-terminal FLAG-tag added human ROBO4 extracellular region domain-deficient, which is an extracellular region domain-deficient comprising 210 to 1007 amino acid sequences SEQ ID NO: 2 Amino acid number 21 Amino acid sequence of N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient, which is an extracellular region domain-deficient comprising amino acid sequences of 1007 to 1007 SEQ ID NO: 11: Amino acids 225 to 1007 of human ROBO4 of SEQ ID NO: 2 Nucleotide sequence that encodes the amino acid sequence of an N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient that is an extracellular region domain-deficient comprising the amino acid sequence of SEQ ID NO: 12: amino acid number of human ROBO4 of SEQ ID NO: 2 Amino acid sequence of N-terminal FLAG-tag-added human ROBO4 extracellular region domain deficient, which is an extracellular region domain deficient consisting of amino acid sequences of 225 to 1007 SEQ ID NO: 13: Amino acid numbers 341 to 1007 amino Nucleotide sequence that encodes the amino acid sequence of an N-terminal FLAG-tag-added human ROBO4 extracellular region domain-deficient that is an extracellular region domain-deficient comprising an acid sequence SEQ ID NO: 14: amino acid number 341 of human ROBO4 is SEQ ID NO: 2 Amino acid sequence of N-terminal FLAG-tag-added human ROBO4 extracellular region domain deficient, which is an extracellular region domain deficient consisting of amino acid sequences of 1007 to 1007 SEQ ID NO: 15: nucleotide sequence of mouse ROBO4 cDNA SEQ ID NO: 16: mouse ROBO4 amino acid SEQ ID NO: 17: nucleotide sequence of rat ROBO4 cDNA SEQ ID NO: 18: rat ROBO4 amino acid sequence SEQ ID NO: 19: nucleotide sequence of monkey ROBO4 cDNA1 SEQ ID NO: 20: monkey ROBO4 amino acid sequence 1
SEQ ID NO: 21: nucleotide sequence of monkey ROBO4 cDNA2 SEQ ID NO: 22: monkey ROBO4 amino acid sequence 2
SEQ ID NO: 23: nucleotide sequence of human ROBO1 cDNA SEQ ID NO: 24: human ROBO1 amino acid sequence SEQ ID NO: 25: nucleotide sequence of human ROBO2 cDNA SEQ ID NO: 26: human ROBO2 amino acid sequence SEQ ID NO: 27: nucleotide sequence of human ROBO3 cDNA SEQ ID NO: 28: human ROBO4 amino acid SEQ ID NO: 29: nucleotide sequence of IL-8 promoter region SEQ ID NO: 30: nucleotide sequence of cDNA encoding MAb1 heavy chain variable region (FIG. 15)
SEQ ID NO: 31: amino acid sequence of MAb1 heavy chain variable region (FIG. 16)
SEQ ID NO: 32: nucleotide sequence of cDNA encoding MAb1 light chain variable region (FIG. 17)
SEQ ID NO: 33: amino acid sequence of MAb1 light chain variable region (FIG. 18)
SEQ ID NO: 34: Nucleotide sequence comprising cDNA encoding amino acids of human κ chain secretion signal and human κ chain constant region SEQ ID NO: 35: Nucleotide sequence comprising cDNA encoding human heavy chain signal sequence and amino acids of human IgG1 constant region No. 36: Nucleotide sequence comprising cDNA encoding amino acid of human heavy chain signal sequence and human IgG2 constant region SEQ ID No. 37: Nucleotide sequence of cDNA encoding cMAb1 light chain (FIG. 19)
SEQ ID NO: 38: amino acid sequence of cMAb1 light chain (FIG. 20)
SEQ ID NO: 39: nucleotide sequence of cDNA encoding cMAb1-1 heavy chain (FIG. 21)
SEQ ID NO: 40: amino acid sequence of cMAb1-1 heavy chain (FIG. 22)
SEQ ID NO: 41: nucleotide sequence of cDNA encoding cMAb1-2 heavy chain (FIG. 23)
SEQ ID NO: 42: amino acid sequence of cMAb1-2 heavy chain (FIG. 24)
SEQ ID NO: 43: nucleotide sequence encoding amino acid sequence of MAb1 heavy chain CDRH1 SEQ ID NO: 44: amino acid sequence of MAb1 heavy chain CDRH1 (FIG. 25)
SEQ ID NO: 45: Nucleotide sequence encoding the amino acid sequence of MAb1 heavy chain CDRH2 SEQ ID NO: 46: Amino acid sequence of MAb1 heavy chain CDRH2 (FIG. 26)
SEQ ID NO: 47: nucleotide sequence encoding the amino acid sequence of MAb1 heavy chain CDRH3 SEQ ID NO: 48: amino acid sequence of MAb1 heavy chain CDRH3 (FIG. 27)
SEQ ID NO: 49: Nucleotide sequence encoding the amino acid sequence of MAb1 light chain CDRL1 SEQ ID NO: 50: Amino acid sequence of MAb1 light chain CDRL1 (FIG. 28)
SEQ ID NO: 51: nucleotide sequence encoding the amino acid sequence of MAb1 light chain CDRL2 SEQ ID NO: 52: amino acid sequence of MAb1 light chain CDRL2 (FIG. 29)
SEQ ID NO: 53: Nucleotide sequence encoding the amino acid sequence of MAb1 light chain CDRL3 SEQ ID NO: 54: Amino acid sequence of MAb1 light chain CDRL3 (FIG. 30)
SEQ ID NO: 55: Nucleotide sequence of cDNA encoding hMAb1-H1 type heavy chain (FIG. 31)
SEQ ID NO: 56: amino acid sequence of hMAb1-H1 type heavy chain (FIG. 32)
SEQ ID NO: 57: nucleotide sequence of cDNA encoding hMAb1-H2 type heavy chain (FIG. 33)
SEQ ID NO: 58: amino acid sequence of hMAb1-H2 type heavy chain (FIG. 34)
SEQ ID NO: 59: Nucleotide sequence of cDNA encoding hMAb1-H3 type heavy chain (FIG. 35)
SEQ ID NO: 60: amino acid sequence of hMAb1-H3 type heavy chain (FIG. 36)
SEQ ID NO: 61: nucleotide sequence of cDNA encoding hMAb1-H4 type heavy chain (FIG. 37)
SEQ ID NO: 62: Amino acid sequence of hMAb1-H4 type heavy chain (FIG. 38)
SEQ ID NO: 63: Nucleotide sequence of cDNA encoding hMAb1-L1 type light chain (FIG. 39)
SEQ ID NO: 64: amino acid sequence of hMAb1-L1 type heavy chain (FIG. 40)
SEQ ID NO: 65: Nucleotide sequence of cDNA encoding hMAb1-L2 type heavy chain (FIG. 41)
SEQ ID NO: 66: amino acid sequence of hMAb1-L2 type heavy chain (FIG. 42)
SEQ ID NO: 67: CDRH1 of hMAb1-H2 and H4 type heavy chain (FIG. 43)
SEQ ID NO: 68: CDRH2 of hMAb1-H2 and H4 type heavy chain (FIG. 44)
SEQ ID NO: 69: CDRH3 of hMAb1-H2 and H4 type heavy chain (FIG. 45)
SEQ ID NO: 70: CDRL1 of hMAb1-L2 type light chain (FIG. 46)
SEQ ID NO: 71: CDRL2 of hMAb1-L2 type light chain (FIG. 47)
SEQ ID NO: 72: CDRL3 of hMAb1-L2 type light chain (FIG. 48)

Claims (32)

Antibodies or functional fragments thereof having the following properties (I) to (III):
(I) binds to ROBO4 protein,
(II) suppress or inhibit vascular endothelial cell migration in the absence of cross-linking antibodies in vitro, and (III) suppress or inhibit angiogenesis in vivo.   The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a human ROBO4 protein.   2. The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a protein comprising an amino acid sequence of amino acid numbers 1 to 1007 of SEQ ID NO: 2 in the sequence listing.   2. The antibody or functional fragment thereof according to claim 1, wherein the ROBO4 protein is a protein comprising an amino acid sequence of amino acid numbers 46 to 1007 of SEQ ID NO: 2 in the sequence listing.   The antibody or functional fragment thereof according to claim 3 or 4, which binds to a site consisting of the amino acid sequence of amino acid numbers 132 to 209 of SEQ ID NO: 2 in the sequence listing.   The antibody or functional fragment thereof according to claim 1, which is a monoclonal antibody or a functional fragment thereof.   CDRH1 consisting of the amino acid sequence shown in SEQ ID NO: 44 (FIG. 25) in the sequence listing, amino acid sequence shown in SEQ ID NO: 46 (FIG. 26) in the sequence listing, or an amino acid sequence in which one amino acid is substituted in the amino acid sequence CDRH2, and a heavy chain comprising CDRH3 consisting of the amino acid sequence shown in SEQ ID NO: 48 (FIG. 27), and an amino acid sequence shown in SEQ ID NO: 50 (FIG. 28) or the amino acid CDRL1 consisting of an amino acid sequence in which 1 to 3 amino acids are substituted in the sequence, CDRL2 consisting of an amino acid sequence shown in SEQ ID NO: 52 (FIG. 29) in the sequence listing, and SEQ ID NO: 54 (FIG. 30) shown in the sequence listing. The light chain comprising CDRL3 consisting of the amino acid sequence described in any one of claims 1 to 6 Antibody or functional fragment thereof.   CDRH1 consisting of the amino acid sequence shown in SEQ ID NO: 44 (FIG. 25) in the sequence listing, the amino acid sequence shown in SEQ ID NO: 46 (FIG. 26) in the sequence listing, or the amino acid sequence shown in SEQ ID NO: 68 (FIG. 44) in the sequence listing And a heavy chain comprising CDRH3 consisting of the amino acid sequence shown in SEQ ID NO: 48 (FIG. 27) of the sequence listing, and an amino acid sequence or sequence shown in SEQ ID NO: 50 (FIG. 28) of the sequence listing CDRL1 consisting of the amino acid sequence shown in SEQ ID NO: 70 (FIG. 46) in the sequence listing, CDRL2 consisting of the amino acid sequence shown in SEQ ID NO: 52 (FIG. 29) in the sequence listing, and SEQ ID NO: 54 (FIG. 30) in the sequence listing. The antibody according to any one of claims 1 to 7, or a functional disruption thereof, comprising a light chain comprising CDRL3 comprising an amino acid sequence comprising .   The heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 31 of the Sequence Listing and the light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 33 of the Sequence Listing. The antibody or functional fragment thereof according to any one of the above. 9. The method according to claim 1, comprising any one heavy chain variable region selected from a) to d) below, and a light chain variable region selected from e) or f). The described antibody or functional fragment thereof:
a) a heavy chain variable region comprising the amino acid sequence represented by amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32) in the sequence listing;
b) a heavy chain variable region comprising the amino acid sequence represented by amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34) in the sequence listing;
c) a heavy chain variable region comprising the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 60 (FIG. 36), or d) amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) of the sequence listing. A heavy chain variable region comprising the amino acid sequence shown,
And e) a light chain variable region comprising the amino acid sequence shown by amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40), or f) amino acid numbers 21 to 134 of SEQ ID NO: 66 (FIG. 42) of the sequence listing A light chain variable region comprising the amino acid sequence shown in FIG. The antibody or the functional fragment thereof according to any one of claims 1 to 8, comprising any one of the combinations of the heavy chain variable region and the light chain variable region described in 1) to 6) below:
1) a heavy chain variable region comprising the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 56 (FIG. 32), and amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
2) The heavy chain variable region comprising the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34), and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
3) The heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 58 (FIG. 34) and the amino acid numbers 21 to 134 of SEQ ID NO: 66 (FIG. 42) A light chain variable region comprising an amino acid sequence,
4) The heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 60 (FIG. 36) and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) A light chain variable region comprising an amino acid sequence,
5) The heavy chain variable region consisting of the amino acid sequence shown by amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38) and the amino acid numbers 21 to 134 of SEQ ID NO: 64 (FIG. 40) Or 6) a heavy chain variable region consisting of the amino acid sequence shown in amino acid numbers 20 to 137 of SEQ ID NO: 62 (FIG. 38), and SEQ ID NO: 66 (SEQ ID NO: 66) 42) a light chain variable region comprising the amino acid sequence represented by amino acid numbers 21 to 134 of FIG.   The antibody or functional fragment thereof according to any one of claims 1 to 11, which is a chimeric antibody or a functional fragment thereof.   The antibody or functional fragment thereof according to any one of claims 1 to 11, which is a humanized antibody or a functional fragment thereof.   The antibody or functional fragment thereof according to any one of claims 1 to 13, comprising a heavy chain constant region of human IgG1 or human IgG2.   The antibody or the functional fragment thereof according to any one of claims 1 to 6, which binds to a site on an antigen recognized by the antibody according to any one of claims 7 to 14.   The antibody or functional fragment thereof according to any one of claims 1 to 6, which competes with any one of the antibodies according to claims 7 to 14 for binding to a ROBO4 protein. The antibody according to any one of claims 1 to 8, which comprises any one of the combinations of heavy chains and light chains according to the following 1) to 6):
1) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 56 (FIG. 32) and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
2) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 58 (FIG. 34), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
3) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 58 (FIG. 34) and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 66 (FIG. 42) of the sequence listing A light chain consisting of a sequence,
4) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 60 (FIG. 36), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain consisting of a sequence,
5) A heavy chain consisting of the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 62 (FIG. 38), and amino acids represented by amino acid numbers 21 to 239 of SEQ ID NO: 64 (FIG. 40) A light chain comprising the sequence, or 6) a heavy chain comprising the amino acid sequence represented by amino acid numbers 20 to 463 of SEQ ID NO: 62 (FIG. 38) in the sequence listing, and an amino acid number of SEQ ID NO: 66 (FIG. 42) in the sequence listing. A light chain consisting of the amino acid sequence shown in 21 to 239.   18. The antibody according to claim 17, comprising a heavy chain from which one to several amino acids on the carboxyl terminal side have been deleted.   The antibody according to any one of claims 1 to 6, wherein the amino acid sequence of any one of claims 10 to 14 and 17 is 95% or more identical.   The antibody or functional fragment thereof according to claim 15, which is a human antibody or a functional fragment thereof. The nucleotide according to any one of the following (I) to (III):
(I) a nucleotide comprising a base sequence encoding part or all of the amino acid sequence of the heavy chain or light chain of the antibody according to any one of claims 1 to 20,
(II) a nucleotide consisting of a base sequence comprising a base sequence encoding part or all of the amino acid sequence of the heavy chain or light chain of the antibody according to any one of claims 1 to 20, or (III) A nucleotide consisting of a base sequence encoding part or all of the amino acid sequence of the heavy chain or light chain of the antibody according to any one of 1 to 20.   A recombinant vector having the nucleotide according to claim 21 inserted therein.   A recombinant cell into which the nucleotide according to claim 21 or the recombinant vector according to claim 23 has been introduced.   A cell that produces the antibody according to any one of claims 1 to 20. The method for producing an antibody or a functional fragment thereof according to any one of claims 1 to 20, comprising the following steps (I) and (II):
(I) the step of culturing the cell according to claim 23 or 24; and (II) the antibody or the functional fragment thereof according to any one of claims 1 to 20 from the culture obtained in the step (I). The process of recovering.   The antibody manufactured by the manufacturing method of Claim 25, or its functional fragment.   A modified form of the antibody or functional fragment thereof according to any one of claims 1 to 20 and 26.   A pharmaceutical composition comprising the antibody according to any one of claims 1 to 20 and 26 or a functional fragment thereof, or the modified product according to claim 27 as an active ingredient.   29. The pharmaceutical composition according to claim 28, which is a therapeutic or prophylactic agent for angiogenic diseases.   Angiogenic diseases are exudative age-related macular degeneration, diabetic retinopathy, macular edema, benign or malignant tumor, atherosclerosis, posterior lens fibroproliferation, hemangioma, chronic inflammation, intraocular neovascular disease, 29. The pharmaceutical composition of claim 28, which is proliferative retinopathy, neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, psoriasis, acute inflammation, sepsis and obesity.   Angiogenic diseases are wet age-related macular degeneration, diabetic retinopathy, macular edema, posterior lens fibroproliferation, intraocular neovascular disease, proliferative retinopathy, neovascular glaucoma, and immune rejection of transplanted corneal tissue 30. A pharmaceutical composition according to claim 28.   An angiogenesis inhibitor comprising the antibody according to any one of claims 1 to 20 and 26 or a functional fragment thereof, or the modified product according to claim 27 as an active ingredient.