CN115845046A - Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine - Google Patents
Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine Download PDFInfo
- Publication number
- CN115845046A CN115845046A CN202211605066.4A CN202211605066A CN115845046A CN 115845046 A CN115845046 A CN 115845046A CN 202211605066 A CN202211605066 A CN 202211605066A CN 115845046 A CN115845046 A CN 115845046A
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- vaccine
- cgamp
- sodium salt
- immune response
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides application of 2'3' -cGAMP sodium salt in preparation of a medicine for enhancing immune response of a DC hepatitis B vaccine, and belongs to the field of immunology. The invention discovers that 2'3' -cGAMP sodium salt can be used as an adjuvant to enhance the response of DC to a hepatitis B vaccine, and 2'3' -cGAMP sodium salt combined with the hepatitis B vaccine can promote the expression of DC surface maturation marker molecules in the immune response of the DC hepatitis B vaccine, induce the transcription of IFN beta, IL-1 beta, IL-6 and IL-8, and provide a new visual angle for improving the immune effect of the hepatitis B vaccine. The invention also provides a DC hepatitis B vaccine adjuvant which comprises 2'3' -cGAMP sodium salt with effective dose concentration. The invention also provides a preparation method of the DC hepatitis B vaccine adjuvant.
Description
Technical Field
The invention belongs to the field of immunology, and particularly relates to application of 2'3' -cGAMP sodium salt in preparation of a medicine for enhancing immune response of a DC hepatitis B vaccine.
Background
Hepatitis B Virus (HBV) infection is prevalent worldwide and is a major public health problem. According to the WHO estimate, about 2.96 million chronic HBV infected people worldwide die from cirrhosis and hepatocellular carcinoma every year by about 80 million people. The important measure for preventing HBV infection is to inoculate hepatitis B vaccine, which has great effect on preventing and treating hepatitis B, but 5-10% of the individuals in general population still have hepatitis B surface antibody (HBsAb) in vivo after immunization, which cannot reach protective level, and becomes susceptible population. Therefore, the research on the mechanism related to hepatitis B vaccine unresponsiveness is carried out, and the development of a novel adjuvant for improving the response rate of the hepatitis B vaccine is the key to be researched in the field.
The immune response mechanism of hepatitis B vaccine is complex, and the influencing factors are numerous. Previous studies have shown that the main factors of hepatitis b vaccine immune failure are: physical factors such as age, sex, etc.; host genetic factors such as genetic polymorphisms and the like; immune factors include innate immunity and specific immunity; environmental exposure factors such as smoking, drinking, etc.; etiological characteristics such as genetic variation and epigenetic changes that occur during viral replication and translation; vaccine factors such as vaccine purity and adjuvant; inoculation factors, such as inoculation route, times and the like. After entering the body, the hepatitis B vaccine can activate the natural immunity of the body, start specific immunity, generate antibodies and memory B cells and protect the body from HBV infection. In the immune response process of hepatitis B vaccine, natural immunity and specific immunity are the most important two links. Researchers have found that T cell defects in specific immunity, including insufficient Th cell numbers and functions, cause cytokine secretion reduction and overexpression of regulatory T cells, and B cell defects, including maturation of memory B cells and dysfunction of antibody class switching, affect the immune response of hepatitis B vaccines, but natural immunity has been less studied in the immune response of hepatitis B vaccines. The natural immune signal path is a bridge for connecting natural immunity and specific immunity and plays an important role in the immune response process of the hepatitis B vaccine. The innate immune signaling pathway participates in and regulates the initiation of specific immune responses, affects the strength and type of specific immune responses, and thus, restoring or enhancing innate immune signaling pathway functions associated with specific immunity may contribute to the immune response of hepatitis b vaccines.
2’3’-cGAMP(cyclic[G(2’,5’)pA(3’,5’)p]) Is an endogenous cGAMP in mammalian cells that is produced in response to DNA in the cytoplasm. 2'3' -cGAMP binds STING with high affinity and is a STING agonist. 2'3' -cGAMP sodium salt is 2'3' -cGAMP sodium salt form, formula C 20 H 22 N 10 O 13 P 2 2Na, molecular weight 718.38, molecular structure:
there are no reports of 2'3' -cGAMP sodium salt in relation to the immune response of hepatitis b vaccine.
Disclosure of Invention
In view of this, the invention aims to provide an application of 2'3' -cGAMP sodium salt in preparing a medicine for enhancing DC hepatitis B vaccine immune response, and 2'3' -cGAMP sodium salt and a hepatitis B vaccine can promote the expression of DC surface maturation marker molecules in the immune response of the DC hepatitis B vaccine and induce the transcription of IFN beta, IL-1 beta, IL-6 and IL-8.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides application of 2'3' -cGAMP sodium salt in preparation of a medicine for enhancing immune response of a DC hepatitis B vaccine.
Preferably, the medicament is a DC hepatitis B vaccine adjuvant.
Preferably, 2'3' -cGAMP sodium salt promotes expression of DC surface maturation marker molecules in DC hepatitis b vaccine immune responses.
Preferably, the DC surface maturation marker molecules include CD86, CD80, CD11c.
Preferably, 2'3' -cGAMP sodium salt induces transcription of IFN beta, IL-1 beta, IL-6, IL-8 from DC cells in immune response of DC hepatitis B vaccine.
Preferably, the 2'3' -cGAMP sodium salt effective dose concentration is 18-22 μ g/ml.
Preferably, the mass ratio of 2'3' -cGAMP sodium salt to the hepatitis B vaccine is 18-22.
The invention also provides a DC hepatitis B vaccine adjuvant which comprises 2'3' -cGAMP sodium salt with effective dose concentration.
The invention also provides a preparation method of the DC hepatitis B vaccine adjuvant, which comprises the following steps: 2'3' -cGAMP sodium salt is dissolved in endotoxin free water.
The invention also provides the application of the DC hepatitis B vaccine adjuvant or the DC hepatitis B vaccine adjuvant prepared by the preparation method in preparing a medicament for enhancing the immune response of the DC hepatitis B vaccine.
The invention has the beneficial effects that:
the invention discovers that 2'3' -cGAMP sodium salt combined hepatitis B vaccine can promote the expression of DC surface maturation marker molecules CD86, CD80 and CD11c in the immune response of the DC hepatitis B vaccine, induce the transcription of DC cells IFN beta, IL-1 beta, IL-6 and IL-8 in the immune response of the DC hepatitis B vaccine, and improve the survival rate of CD4+ T cells, thereby enhancing the immune response of the DC hepatitis B vaccine in organisms.
Detailed Description
The invention provides application of 2'3' -cGAMP sodium salt in preparation of a medicine for enhancing immune response of a DC hepatitis B vaccine. The source of 2'3' -cGAMP sodium salt is not limited in the present invention.
The invention provides 2'3' -cGAMThe sodium salt of P is 2'3' -cGAMP in the form of sodium salt and has the chemical formula C 20 H 22 N 10 O 13 P 2 2Na, molecular weight 718.38, commercially available.
The drug of the invention is a DC hepatitis B vaccine adjuvant. The invention discovers that 2'3' -cGAMP sodium salt as a hepatitis B vaccine adjuvant can effectively enhance the immune response of the DC hepatitis B vaccine.
2'3' -cGAMP sodium salt as adjuvant of hepatitis B vaccine can activate STING signal path in DC, the invention simulates hepatitis B vaccine inoculation by treating DC with hepatitis B vaccine, and reflects immune response condition of organism DC to hepatitis B vaccine by analyzing surface maturation marker molecule level of DC, cytokine mRNA level in DC and activation condition of promoting CD4+ T cell proliferation of STING excitant 2'3' -cGAMP sodium salt combined hepatitis B vaccine, finding that 2'3' -cGAMP sodium salt combined hepatitis B vaccine can promote expression of DC surface maturation marker molecules CD86, CD80, CD11c in immune response of DC hepatitis vaccine, inducing transcription of DC cell IFN beta, IL-1 beta, IL-6, IL-8 in immune response of DC hepatitis B vaccine, thereby enhancing immune response of DC hepatitis B vaccine in organism, and providing new visual angle for improving immune effect of hepatitis B vaccine.
The 2'3' -cGAMP sodium salt effective dose concentration of the invention is 18-22 mug/ml, preferably 19-21 mug/ml, and more preferably 20 mug/ml.
When the 2'3' -cGAMP sodium salt and the DC hepatitis B vaccine are mixed and injected for use, the mass ratio of the 2'3' -cGAMP sodium salt to the DC hepatitis B vaccine is 18-22, and the preferable ratio is 20.
The invention also provides a DC hepatitis B vaccine adjuvant which comprises 2'3' -cGAMP sodium salt with effective dose concentration of 18-22 mu g/ml.
The invention also provides a preparation method of the DC hepatitis B vaccine adjuvant, which comprises the following steps: 2'3' -cGAMP sodium salt is dissolved in endotoxin free water. The adjuvant of the DC hepatitis B vaccine is prepared and used at present, and the adjuvant is prepared before the DC hepatitis B vaccine is injected and is mixed with the DC hepatitis B vaccine for injection. The DC hepatitis B vaccine is a recombinant hepatitis B vaccine (saccharomyces cerevisiae) and contains an aluminum adjuvant.
The invention also provides the application of the DC hepatitis B vaccine adjuvant or the DC hepatitis B vaccine adjuvant prepared by the preparation method in preparing a medicament for enhancing the immune response of the DC hepatitis B vaccine.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The hepatitis B vaccine in the specific embodiment of the invention is a recombinant hepatitis B vaccine (saccharomyces cerevisiae) with the specification of 1ml per vaccine, contains 60 mu g of HBsAg, and is purchased from Shenzhen kangtai biological product, inc.
Specific examples 2'3' -cGAMP sodium salt of the present invention was purchased from invivogen as 5mg (5X 1 mg) 2'3' -cGAMP sodium salt lyophilized powder.
2'3' -cGAMP sodium salt concentrate preparation: adding 10ml of endotoxin-free water into 2'3' -cGAMP sodium salt freeze-dried powder, preparing triple-distilled water by using a water purifier, and performing autoclaving to obtain the 2'3' -cGAMP sodium salt concentrated solution, wherein the concentration of the 2'3' -cGAMP sodium salt concentrated solution is 500 mu g/ml.
In the specific embodiment of the invention, flow cytometry data is analyzed by adopting CytExpert software, an Excel2016 software is adopted to establish a database, SPSS23 software is adopted to analyze data, quantitative data which obeys normal distribution is described by Mean plus or minus SD, and when two groups of data are compared, t test is adopted to compare the quantitative data which obeys normal distribution between groups; when multiple groups of data are compared, if the data obey normal distribution and the homogeneity of the variance, variance analysis is adopted, and the multiple groups of data are compared in pairs by adopting an SNK method. Differences of P <0.05 were statistically significant.
In the following examples, unless otherwise specified, all methods are conventional.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
1. Experimental grouping and intervention
Inducing THP-1 to be immature DC in vitro, adjusting cell concentration to 5 × 10 5 Pieces/ml, divided into 6 groups of 3 replicate wells per group:
experimental group 1 (control group): adding PBS;
experimental group 2 (2'3' -cGAMP sodium salt): adding 2'3' -cGAMP sodium salt to the final concentration of 20 mug/ml, acting for 72h, and detecting the activation condition of the STING signal pathway;
experimental group 3 (LPS group, lipopolysaccharide): adding PBS, acting for 48h, adding LPS to the final concentration of 1 mug/ml, acting for 24h, and detecting the maturation condition of the LPS induced DC;
experimental group 4 (2'3' -cGAMP sodium salt + LPS group): adding 2'3' -cGAMP sodium salt to a final concentration of 20 mu g/ml, acting for 48 hours, adding LPS to a final concentration of 1 mu g/ml, acting for 24 hours, and detecting the maturation condition of 2'3' -cGAMP sodium salt + LPS induced DC;
experimental group 5 (hepatitis b vaccine group): adding PBS, acting for 48h, adding hepatitis B vaccine to a final concentration of 1 μ g/ml, acting for 24h, and detecting the immunoreaction condition of the DC hepatitis B vaccine;
experimental group 6 (2'3' -cGAMP sodium salt + hepatitis b vaccine group): adding 2'3' -cGAMP sodium salt to the final concentration of 20 mu g/ml, acting for 48h, adding hepatitis B vaccine to the final concentration of 1 mu g/ml, acting for 24h, and detecting the immune response condition of the DC hepatitis B vaccine.
Complete medium/working solution/diluent preparation containing 2'3' -cGAMP sodium salt: to 12.5ml of complete medium, 1ml of 2'3' -cGAMP sodium salt concentrated solution was added, at which time the concentration of 2'3' -cGAMP sodium salt in the medium used for the half-amount changing solution was 40. Mu.g/ml; the complete medium containing 2'3' -cGAMP sodium salt described above was added to the medium by half-way change, and finally 2'3' -cGAMP sodium salt in the cell culture plate was 20 μ g/ml.
2. Mixed lymphocyte assay
Separating PBMCs of a filter disc by a density gradient centrifugation method, sorting CD4+ T cells by magnetic beads, co-culturing the sorted CD4+ T cells and the DC of the 6 groups, developing a mixed lymphocyte experiment, reflecting the proliferation condition of the CD4+ T cells by the survival rate of the CD4+ T cells, and reflecting the activation condition of the CD4+ T cells by the IL-2 level in the supernatant:
(1) PBMC isolation:
cutting off two ends of the leukocyte filter disc, sucking 40ml PBS placed at room temperature by using a 50ml syringe, and reversely blowing about 40ml of leukocyte-containing filter disc blood from the filter disc to obtain a blood sample for extracting PBMC;
taking 8 15ml sterile centrifuge tubes, sucking 5ml human whole blood mononuclear cell separating medium in each tube, slowly adding 5ml blood sample along the tube wall, superposing on the separating medium, horizontally centrifuging at room temperature 2115rpm (800 Xg) for 20min;
layering can be seen after centrifugation, wherein the white cloudy layer is a lymphocyte layer, carefully sucking all the middle white cloudy lymphocyte layer into another sterile centrifuge tube by using a sterile pipette, adding 8ml of PBS for washing, and centrifuging at 1500rpm and 5min (402 Xg, 5 min);
the suspension was resuspended in 10ml of prepared RMPI1640 complete medium to obtain a cell suspension.
(2) Culturing PBMC: adjusting PBMC concentration to 1.2 × 10 6 Per ml, cultured in RPMI1640 containing 10% fetal bovine serum, 1% cyan, streptomycin and 89%, at 37 ℃ in 5% CO 2 And performing conventional culture in a cell incubator for 24 hours.
(3) Pretreatment of cells:
PBMC is observed under a mirror, photographed and counted;
all cells were screened through a 40 μm cell screen to ensure a single cell suspension; after centrifugation at 300g for 10 minutes, the supernatant was discarded and resuspended in 80. Mu.l of PBS (1X 10 each) 7 Individual cells were resuspended in 80 μ Ι pbs); each 1 × 10 7 Adding 20 mul of magnetic bead sorting solution into each cell, uniformly mixing, and incubating for 15 minutes in a refrigerator at 4 ℃; 1ml of PBS (per 1X 10 of the total volume) was added 7 Adding 1ml PBS to each cell) to stop reaction, centrifuging for 10 minutes at 300g, and removing supernatant; 500 μ l PBS resuspended cells.
(4) Passing through an LS separation column:
placing a magnetic frame and an LS sorting column according to the specification, placing a 15ml sterile centrifuge tube under the sorting column for receiving waste liquid, and rinsing the sorting column with 3ml PBS;
after the liquid flows out, a needle head is arranged below the sorting column;
40 μm cell screen was placed on LS sort column, 500 μ l of resuspended cells were screened into the column, 10 μ l of cells that had not passed through the sort column were aspirated immediately after screening for PBMC counting prior to sorting and CD4+ T ratio (10 μ l cell suspension +90 μ l PBS) was recorded as original group;
after 500. Mu.l of the resuspended cells had been drained, 3ml of PBS was added to the sorting column to wash the column and allow the unlabeled cells to flow out; repeat 3 times, 3 × 3ml pbs;
taking down the sorting column from the magnetic frame, clamping the sorting column on a new 15ml centrifuge tube, adding 5ml PBS, immediately forcibly pushing down at a constant speed to enable the liquid to flow down, and collecting the cells, namely the CD4+ T cells;
obtaining 5ml of CD4+ T cell suspension, centrifuging 300g for 10 minutes, discarding the supernatant, re-suspending with 500 mu l of complete culture medium, sucking 10 mu l of cell suspension, supplementing 90 mu l of PBS as a positive group, and culturing after counting the residual CD4+ T cells for subsequent experiments;
labeling CD4 antibodies with the original group and the positive group, counting in an up-flow manner, detecting the proportion of CD4+ T cells, and calculating the purity (the ratio of CD4+ T cells after passing through the column and the yield: the yield = the proportion of CD4+ T cells after passing through the column x the total number of cells after passing through the column (positive group)/the proportion of CD4+ T cells before passing through the column x the total number of cells before passing through the column (original group));
the purity of the sorted CD4+ T cells in the experiment is 92.75-97.33%, and the yield is 81.00-96.36%. The obtained CD4+ T cells were adjusted to a cell concentration of 1.2X 10 6 Per ml, cultured in RPMI1640 medium containing 10% fetal bovine serum, 1% cyan, streptomycin and 89%, at 37 ℃ with 5% CO 2 A cell culture box.
(5) Co-culturing: mitomycin C treatment was given to the groups of correspondingly treated DCs at a final concentration of 25. Mu.g/mL, after 2h the DCs were collected, washed 3 times with PBS to remove residual mitomycin C, and co-cultured with CD4+ T cells in PBMC obtained by CD4 MicroBeads magnetic bead sorting. In the experiment of co-culture of allogeneic CD4+ T cells and DCs, 100. Mu.l of CD4+ T cells (2X 10) were added to each well of a 96-well plate 5 ) Allogeneic, correspondingly treated 100 μ l DC cells (2 × 10) were added in the ratio of 10 4 ). The survival of the groups of CD4+ T cells measured by CCK8 after 3 days reflects the proliferation of CD4+ T cells.
3. Detection method
(1) Flow Cytometry (FCM) detection of STING Signal pathway related proteins (STING, NF-. Kappa.Bp 65, pNF-. Kappa.Bp 65, IRF3, pIRF 3):
collecting each group of cells, setting corresponding protein tubes, protein isopipes and protein naked cell tubes, centrifuging for 5 minutes at 1200rpm, discarding supernatant, and leaving 100 mul of cell suspension;
fixing: adding 100 mu l of IC Fixation Buffer into each tube, and incubating for 15 minutes at room temperature;
breaking cell membranes: add 1ml 1 x Permeabilization Buffer to each tube, incubate 5 minutes at room temperature, 1200rpm, centrifuge for 5 minutes, discard the supernatant, leave 100. Mu.l cell suspension;
breaking nuclear membrane, adding antibody: adding 1ml fresh Foxp3 membrane breaking reagent into tubes of NF-kappa Bp65 isotype, pNF-kappa Bp65 isotype, IRF3 isotype, pIRF3 isotype, NF-kappa Bp65, pNF-kappa Bp65 and IRF3, pIRF3 respectively, incubating at room temperature for 15 minutes, centrifuging at 1200rpm for 5 minutes, discarding the supernatant, and leaving 100 mul of cell suspension; add 1. Mu.l antibody to "STING isotype" tube, add 2.5. Mu.l antibody to "STING" tube, incubate 15 minutes at room temperature in the dark;
1 mul and 2 mul of corresponding antibodies are added into tubes of 'NF-kappa Bp65 isotype and pNF-kappa Bp65 isotype', and 4 mul and 7 mul of corresponding antibodies are added into tubes of 'NF-kappa Bp65 and pNF-kappa Bp 65'; adding 1 μ l and 0.5 μ l of corresponding antibodies into the tube of the "IRF3 isotype and pIRF3 isotype", adding 3 μ l and 1.5 μ l of corresponding antibodies into the tube of the "IRF3 pIRF3", and incubating for 15 minutes at room temperature in a dark place;
adding PBS: adding 1ml of the mixture and centrifuging at 1200rpm for 5 minutes respectively, and discarding the supernatant;
resuspension detection: each 200. Mu.l PBS was added for resuspension and assayed on a CytoFlex flow cytometer.
(2) Flow Cytometry (FCM) detection of DC surface marker molecules (CD 11c, HLA-DR, CD80, CD 86):
collecting each group of cells, setting corresponding surface marker molecular tubes, surface marker molecule homotypic tubes and surface marker molecule naked cell tubes, centrifuging at 1200rpm for 5 minutes, discarding supernatant, and leaving 100 mul of cell suspension;
adding an antibody: 2. Mu.l of the CD86 isotype antibody is added into the "CD86 isotype" tube, and 2. Mu.l of the CD86 antibody is added into the "CD86" tube; 2 mul of 3 corresponding antibodies of the same type are added into a tube of the 'CD 80 type, the HLA-DR type and the CD11c type', and 2 mul of 3 corresponding antibodies are added into a tube of the 'CD 80 type, the HLA-DR type and the CD11 c' type; incubating for 15 minutes at room temperature in dark;
adding PBS: adding 1ml of the mixture and centrifuging at 1200rpm for 5 minutes respectively, and discarding the supernatant;
resuspending and loading on a machine: each 200. Mu.l PBS was added for resuspension and assayed on a CytoFlex flow cytometer.
(3) Real-time fluorescence quantitative reverse transcription-polymerase chain reaction (RT-qPCR) detection of relative expression quantity of mRNA (messenger ribonucleic acid) of molecules related to STING signal pathway
1) Extracting total RNA: total RNA was extracted from cells using TRIgent, and the procedures were performed exactly as described in the specification.
2) Reverse transcription: using the extracted total RNA as a template according to a kit GoScript TM The Reverse Transcription Mix, oligo (dT) indicated that cDNA was synthesized, the amount of total RNA added was 1. Mu.g, the volume of RNA template was calculated based on the concentration, 20. Mu.l of the system components were as follows,
GoScript TM Reaction Buffer Oligo(dT)——4μl
GoScript TM Enzyme Mix——2μl
Template RNA——X
Nuclease-Free Water——(14μl-X)
note: x = total RNA amount (1000 ng)/RNA concentration per sample (ng/. Mu.l)
The reaction conditions are as follows: 25-5 min; 42-30 min; 85-5 min.
3)qPCR：
Design and synthesis of primers:
the mRNA and internal reference beta-actin sequences are as follows,
STING
upstream GCCCTGTTGCTGCTGTCCATC (SEQ ID NO. 1)
Downstream GGATGTTCAGTGCCTGCGAGAG (SEQ ID NO. 2)
NF-κB
Upstream AGGCTCCTGTGCGTGTCTCC (SEQ ID NO. 3)
Downstream TCGTCTGTATCTGGCAGGTACTGG (SEQ ID NO. 4)
IRF3
Upstream GCAGGAGGATTTCGGAATCTTC (SEQ ID NO. 5)
Downstream GGAAATTCCTCTTCCAGGTTGG (SEQ ID NO. 6)
β-actin
Upstream TGGCACCCAGCACAATGAA (SEQ ID NO. 7)
Downstream CTAAGTCATAGTCCGCCTAGAAGCA (SEQ ID NO. 8)
qPCR reaction:
the qPCR 20. Mu.l reaction system was as follows,
2×QuantiFast SYBR Green PCR MasterMix——10μl
Primer F(10μM)——0.4μl
Primer R(10μM)——0.4μl
Template cDNA——2μl
RNase free water——7.2μl
reaction conditions are as follows: hot-StartActivation 95 ℃ 10min → Desation 39 cycles 95 ℃ 15s → Annealing/Extension 60 ℃ 1min → Dissociation 65 ℃.
4) Determination of results
And (3) automatically detecting the amount of the fluorescent product by the system before the end of each cycle, and drawing a melting curve to judge the specificity of the amplified product after all cycles are finished. After the C (t) value of each sample is normalized by the internal reference gene beta-actin, the relative expression amounts of STING, NF-kappa B and IRF3 mRNA are calculated according to 2-delta C (t).
The results are shown in tables 1 to 3.
TABLE 1 expression of STING signaling pathway in DCs under the action of PBS and 2'3' -cGAMP sodium salt
As shown in Table 1, after the stimulation of STING by 2'3' -cGAMP sodium salt, the relative expression quantity of STING mRNA in 2'3' -cGAMP sodium salt group is higher than that in the control group on mRNA level, the difference is statistically significant (P < 0.05), the relative expression quantities of NF-kB mRNA and IRF3 mRNA are numerically higher than that in the control group, and the difference is not statistically significant (P > 0.05); in the percentage of protein expression positive cells, 2'3' -cGAMP sodium salt group STING, NF-kappa Bp65, pNF-kappa Bp65 and the proportion of the pIRF3 in the NF-kappa Bp65 as well as the percentage of protein positive cells in the pIRF3 are all higher than those in a control group, and the difference has no statistical significance (P > 0.05); on the mean fluorescence intensity of the proteins, the 2'3' -cGAMP sodium salt group STING, NF-kappa Bp65, pNF-kappa Bp65, IRF3 and pIRF3 mean fluorescence intensities are all higher than those of the control group, and the difference is statistically significant (P < 0.05). The results indicate that 2'3' -cGAMP sodium salt can activate STING-NF-kB and STING-IRF3 signal pathways in DC and promote phosphorylation of NF-kB and IRF3 at the downstream.
TABLE 2 expression of DC surface molecules and cytokines by LPS alone and 2'3' -cGAMP sodium salt + LPS
As shown in Table 2, after 2'3' -cGAMP sodium salt activates STING signal path in DC, the expression percentage of DC surface molecules is higher in 2'3' -cGAMP sodium salt + LPS group DC surface molecules CD86, CD80, CD11c and HLA-DR than in LPS group, and the difference is statistically significant (P < 0.05); on the average fluorescence intensity of DC surface molecule expression, the average fluorescence intensity of DC surface molecules CD86, CD80, CD11c and HLA-DR is higher than that of LPS group, and the difference has statistical significance (P < 0.05); in the relative expression of the DC cytokine mRNA, the relative expression of 2'3' -cGAMP sodium salt + LPS group IL-6 and IL-8 mRNAs is higher than that of LPS group, and the difference is statistically significant (P < 0.05). It was shown that 2'3' -cGAMP sodium salt promotes LPS-induced DC maturation, enhancing partial cytokine transcription. TABLE 3 expression of DC surface molecules and cytokines by hepatitis B Virus simplex and 2'3' -cGAMP sodium salt + hepatitis B Virus
As shown in table 3, after 2'3' -cGAMP sodium salt activates STING signal pathway, the DC surface molecule expression percentage of 2'3' -cGAMP sodium salt + hepatitis b vaccine group DC surface molecules CD86, CD80, CD11c are all higher than that of hepatitis b vaccine group, and the difference is statistically significant (P < 0.05); on the average fluorescence intensity of DC surface molecule expression, the average fluorescence intensity of 2'3' -cGAMP sodium salt + hepatitis B vaccine group DC surface molecules CD86, CD80, CD11c and HLA-DR is higher than that of the hepatitis B vaccine group, and the difference has statistical significance (P < 0.05); in the relative expression quantity of the DC cytokine mRNA, the relative expression quantities of 2'3' -cGAMP sodium salt + hepatitis B vaccine group IFN beta, IL-1 beta, IL-6, IL-8 and IL-10 mRNAs are all higher than those of the hepatitis B vaccine group, and the difference has statistical significance (P is less than 0.05). The 2'3' -cGAMP sodium salt combined hepatitis B vaccine is shown to promote the expression of DC surface maturation marker molecules CD86, CD80 and CD11c in the immune response of the DC hepatitis B vaccine and induce the transcription of IFN beta, IL-1 beta, IL-6 and IL-8.
(4) Cell proliferation-toxicity response (CCK 8) assay for CD4+ T cell survival:
taking 100. Mu.l of each group of cell suspensions (all suspension cells) treated correspondingly into a 96-well plate, adding 10. Mu.l of CCK8 reagent to each well, and determining the content of CO at 37 ℃ and 5% 2 After 2h incubation (4 h incubation for detecting T cell proliferation), absorbance (OD) at 450nm was measured using a microplate reader, and the survival rate of CD4+ T cells was calculated, and the results are shown in Table 4. Each set was provided with 3 wells as replicates.
Cell viability = [ (As-Ab)/(Ac-Ab) ]. Times.100%.
As: OD value of experimental group; ac: OD value of the control group; ab: blank OD values.
TABLE 4 Effect of hepatitis B vaccine alone and 2'3' -cGAMP sodium salt + hepatitis B vaccine stimulated DCs on survival of CD4+ T cells (%)
Note: cell viability was calculated as a comparison of the non-co-cultured CD4+ T cell groups, with the same letters indicating no statistical difference between groups (P > 0.05) and different letters indicating statistical difference between groups (P < 0.05)
In the proliferation condition of CD4+ T cells, the survival rate of the CD4+ T cells has statistical significance (P < 0.05) in the three groups of the control group, the hepatitis B vaccine group and the 2'3' -cGAMP sodium salt + hepatitis B vaccine group, and two-by-two comparison shows that the survival rate of the CD4+ T cells in the 2'3' -cGAMP sodium salt + hepatitis B vaccine group is higher than that in the control group and the hepatitis B vaccine group (P < 0.05), and the survival rate of the CD4+ T cells in the control group and the hepatitis B vaccine group is not statistically significant (P > 0.05).
Example 2
This example demonstrates the experimental results for different concentrations of 2'3' -cGAMP sodium salt.
The mean fluorescence intensity of the molecular protein of the STING signaling pathway was measured by treating DCs with PBS (control), 5 μ g/ml2'3' -cGAMP sodium salt, and 10 μ g/ml2'3' -cGAMP sodium salt, respectively, for 12h, 24h, and 48h for each treatment group (other specific experimental steps are the same as in example 1), and the results are shown in table 5.
TABLE 5 μ g/ml and 10 μ g/ml2'3' -cGAMP sodium salt activated DC STING pathway molecular protein mean fluorescence intensity at different time points
Note: the average fluorescence intensity values of the STING proteins in the present invention were all reduced by 1000 times
As shown by the results in Table 5, the average fluorescence intensities of the 2'3' -cGAMP sodium salt group STING and pIRF3 proteins at 12h, 24h, 48h, 5. Mu.g/ml and 10. Mu.g/ml were lower than those of the control group at the protein expression level. The mean fluorescence intensity of IRF3 protein in 12h and 24h, 5. Mu.g/ml and 10. Mu.g/ml 2'3' -cGAMP sodium salt group is lower than that in the control group; at 48h, both 5. Mu.g/ml and 10. Mu.g/ml 2'3' -cGAMP sodium salt group IRF3 protein mean fluorescence intensities were slightly higher than the control group, with no statistical difference (P > 0.05). It was shown that the treatment of DC with 5. Mu.g/ml and 10. Mu.g/ml 2'3' -cGAMP sodium salt did not result in a poor activation of the DC STING signaling pathway regardless of the duration of action, and thus could not be used as an optimal concentration for hepatitis B vaccine adjuvants.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.
Claims (10)
1.2'3' -cGAMP sodium salt in the preparation of medicine for enhancing DC hepatitis B vaccine immune response.
2. The use of claim 1, wherein the medicament is a DC hepatitis B vaccine adjuvant.
3. The use of claim 2, wherein 2'3' -cGAMP sodium salt promotes expression of DC surface maturation marker molecules in DC hepatitis b vaccine immune responses.
4. The use of claim 3, wherein the DC surface maturation marker molecules comprise CD86, CD80, CD11c.
5. The use according to claim 2, wherein 2'3' -cGAMP sodium salt induces transcription of DC cells IFN β, IL-1 β, IL-6, IL-8 in DC hepatitis b vaccine immune response.
6. The use of claim 2, wherein the effective dose concentration of 2'3' -cGAMP sodium salt is 18-22 μ g/ml.
7. The use according to claim 2, wherein the mass ratio of 2'3' -cGAMP sodium salt to hepatitis b vaccine is 18-22.
8. A DC hepatitis B vaccine adjuvant characterized by comprising 2'3' -cGAMP sodium salt in effective dose concentration.
9. The preparation method of the DC hepatitis B vaccine adjuvant is characterized by comprising the following steps: 2'3' -cGAMP sodium salt is dissolved in endotoxin free water.
10. Use of the DC hepatitis b vaccine adjuvant according to claim 8 or the DC hepatitis b vaccine adjuvant prepared by the preparation method according to claim 9 in the preparation of a medicament for enhancing the immune response of the DC hepatitis b vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211605066.4A CN115845046A (en) | 2022-12-14 | 2022-12-14 | Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211605066.4A CN115845046A (en) | 2022-12-14 | 2022-12-14 | Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115845046A true CN115845046A (en) | 2023-03-28 |
Family
ID=85672768
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211605066.4A Pending CN115845046A (en) | 2022-12-14 | 2022-12-14 | Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115845046A (en) |
-
2022
- 2022-12-14 CN CN202211605066.4A patent/CN115845046A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Piccioli et al. | Functional specialization of human circulating CD16 and CD1c myeloid dendritic-cell subsets | |
| DUAN et al. | Decreased numbers and impaired function of circulating dendritic cell subsets in patients with chronic hepatitis B infection (R2) | |
| Huang et al. | Ribonucleic acid synthesis of vesicular stomatitis virus: III. Multiple complementary messenger RNA molecules | |
| CN111481662A (en) | Individual specific therapeutic vaccine for tumor and preparation method thereof | |
| CN101424692B (en) | Quantitative determination method for hepatitis b virus specificity cell toxicity T lymphocyte | |
| CN105483083B (en) | The conversion amplification method of double negative t cells | |
| JP5295950B2 (en) | Methods and reagents for detecting susceptibility to graft-versus-host disease or transplant-related death | |
| CN105861531B (en) | Chimeric antigen receptor T cell and preparation method thereof | |
| CN110257478A (en) | A kind of rapid screening method of effective neoantigen peptide of tumour individuation vaccine | |
| CN115845046A (en) | Application of 2'3' -cGAMP sodium salt in preparation of medicine for enhancing immune response of DC hepatitis B vaccine | |
| CN108796065A (en) | Applications of the FAM127A in disease of pregnancy | |
| CN110433285B (en) | Individualized tumor antigen peptide vaccine and preparation method thereof | |
| CN112300988A (en) | T cell sorting preparation technology based on tumor neoantigen and application thereof | |
| CN116421629A (en) | Application of stem cell exosomes in medicaments for preventing or treating aging | |
| CN113025571B (en) | Treatment method of human peripheral blood T lymphocytes, immunogen preparation and application | |
| JP2005514065A (en) | In vivo nucleic acid level determination method | |
| CN114306582A (en) | Application of gamma interferon-induced lysosome sulfhydryl reductase GILT in enhancing anti-tumor immune response | |
| CN115197911B (en) | Preparation and application of baby dendritic cells | |
| Riol et al. | Optimized lymphocyte protein extraction performed simultaneously with DNA and RNA isolation: application to the study of factors affecting DNA, RNA, and protein recovery from lymphocytes of the oldest individuals | |
| CN107151697B (en) | Method and kit for predicting the response of chronic hepatitis B patients to IFN alpha therapy | |
| CN105368776B (en) | The method that blood platelet is extracted in staged centrifugation | |
| CN110585427A (en) | Composition for improving immunity of organism and application of composition in resisting adult T cell leukemia or nasopharyngeal carcinoma | |
| CN113730569A (en) | Vaccine immunologic adjuvant and application thereof in preparation of vaccine | |
| CN109762911A (en) | Molecular labeling and its application of the PTPRJ gene as the immune-related shape of pig | |
| Xu et al. | Functional Analysis and Proteomics Profiling of Extracellular Vesicles From Swine Plasma Infected by African Swine Fever Virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |