CN107151697B

CN107151697B - Method and kit for predicting the response of chronic hepatitis B patients to IFN alpha therapy

Info

Publication number: CN107151697B
Application number: CN201710121980.4A
Authority: CN
Inventors: 葛胜祥; 王邵娟; 熊丽霞; 刘永亮; 夏宁邵
Original assignee: Xiamen University
Current assignee: Xiamen University
Priority date: 2016-03-04
Filing date: 2017-03-03
Publication date: 2021-05-07
Anticipated expiration: 2037-03-03
Also published as: CN107151697A; WO2017148432A1

Abstract

The present invention relates to markers for predicting the response of chronic hepatitis b patients to IFN α therapy. The invention also relates to a method for predicting the response of a chronic hepatitis b patient to IFN α therapy comprising the step of determining the expression level of such markers in PBMCs of a chronic hepatitis b patient. The invention also relates to a kit for use in the above method.

Description

Method and kit for predicting the response of chronic hepatitis B patients to IFN alpha therapy

Technical Field

Background

Hepatitis B virus infection, especially chronic hepatitis B virus infection is one of the most important public health problems in the world, and currently, more than 3.5 hundred million chronic hepatitis B virus infected persons exist in the world. Chronic hepatitis B virus infection can cause Liver diseases such as Chronic Hepatitis B (CHB), cirrhosis (LC) and primary Hepatocellular carcinoma (HCC), and death caused by Chronic hepatitis B virus infection and related diseases caused by Chronic hepatitis B virus infection is more than 100 million people worldwide each year.

Most patients with chronic HBV infection show no obvious clinical symptoms, of which about 10-30% develop cirrhosis or liver cancer. Chronic HBV infection is a dynamic process whose natural history of infection can be divided into 4 distinct and not necessarily linked phases: 1) the immune tolerance stage is characterized in that HBeAg is positive, serum HBV DNA replication is active, ALT level is normal or low, and fibrosis generally does not occur; 2) an active immunization stage/immune clearance stage characterized by positive HBeAg but initially reduced levels, reduced HBV DNA replication, reduced serum HBsAg levels, and sustained ALT elevation or fluctuation. In this stage, the patient's CTL response is activated, and is liable to develop moderate or severe inflammatory reactions of variable duration and hepatic fibrosis; 3) in the inactive carrying stage, HBV DNA of a patient is in a low replication stage, the DNA level is extremely low or even undetectable, the HBsAg level is obviously reduced, the ALT level shows normal, liver tissues have no or only mild inflammation, HBeAg is negative, anti-HBe is positive, the HBV infection of the patient is subjected to immune control in the period, and the long-term and good prognosis is also predicted, and the probability of liver cirrhosis and even liver cancer of most patients is very low; 4) the HBeAg negative hepatitis stage belongs to the late stage of chronic hepatitis B, and is mainly characterized by that the HBV DNA and ALT levels are periodically fluctuated and active hepatitis, and the HBV virus with variant C region and/or Basic Core Promoter (BCP) is used as main component, and can not express or express very low level of HBeAg.

The HBV virus has no direct pathogenic effect on host cells, and the main pathogenic mechanism is that the HBV virus causes host immune response, and the immune response further causes damage to immune liver tissues. The treatment of chronic HBV infection requires administration of different antiviral treatments depending on the individual condition of the patient. The antiviral therapy aims to continuously inhibit HBV virus, prevent the development or transformation of hepatitis to fibrosis, cirrhosis and even liver cancer, prolong the life cycle of patients and improve the quality of life.

Currently, there are 8 drugs available for CHB antiviral therapy, including 6 nucleoside analogs: lamivudine (LAM), telbivudine (LdT), emtricitabine (FTC), Entecavir (ETV), Adefovir (ADV), Tenofovir (TDF); 2 kinds of interferon: interferon common (IFN α) and interferon polyethylene glycol (PEG-IFN α). The main role of nucleoside analogs is to inhibit replication of the HBV virus by inhibiting the activity of HBV polymerase. In 1976, Greenberg reports the curative effect of IFN alpha on treating chronic hepatitis B for the first time, IFN alpha is the drug which is firstly approved by FDA to treat chronic hepatitis B, PEG-IFN alpha is also the first choice drug for treating chronic hepatitis B, and the PEG-IFN alpha has double effects of resisting virus and regulating immunity. The major advantages of IFN α are its non-drug resistance and its immune-mediated control of HBV infection, thus giving patients a higher chance of HBeAg seroconversion, a longer lasting virological response and HBsAg clearance at the end of treatment, maintaining HBV DNA levels in patients at the lower limit of detection.

Antiviral treatments must ensure a certain degree of virological inhibition and be able to produce biochemical relief, histological recovery and prevent the occurrence of complications. The ideal therapeutic end point for HBV is HBsAg disappearance, but existing antiviral drugs have difficulty achieving this goal, so a more realistic therapeutic end point is the ability to induce a sustained virologic suppression state. The antiviral response can be divided into biochemical, serum, virological and histological levels. All responses can be assessed at some point during and after treatment. Clinical studies have shown that the response rate of CHB patients with conventional IFN α treatment for 6 months is only 25-40%. Determining the ability of a CHB patient to respond specifically to HBV may be predictive of the expected efficacy of treatment of a CHB patient. For a long time, due to the lack of a definite anti-HBV immune response index, the serum ALT level of a CHB patient is taken as an indirect substitute index for measuring the anti-HBV immunity of a host, but the prediction result is not ideal. If the treatment response prediction can be carried out before treatment, the method has very important significance for optimizing drug selection, improving treatment compliance and guaranteeing curative effect.

Therefore, there is a need in the art for markers that can predict the response of CHB patients to IFN α therapy simply, conveniently, rapidly, and with high accuracy and specificity.

Disclosure of Invention

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, cell culture, biochemistry, nucleic acid chemistry, immunology laboratory procedures used herein are all conventional procedures widely used in the relevant fields. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

As used herein, the term "IFN α" or "interferon α" includes all natural or recombinant interferon α, particularly preferably human interferon α, e.g., recombinant human interferon α, including but not limited to IFN α -1b (e.g., available from Schering Corporation, Kenilworth, n.j.)

Interferon a), IFN α -2a (e.g., available from Hoffmann-La Roche, Nutley, n.j.)

Interferon a) or IFN α -2b (e.g. available from Schering Corporation, Kenilworth, n.j.)

-a interferon); for example, a mixture of natural alpha-type interferons, including but not limited to IFN alpha-n 1 (e.g., available from Sumitomo, Japan)

Or Glaxo-Wellcome Ltd., London, Great Britain

Interferon alpha-n 1) or IFN alpha-n 3 (e.g., Alferon available from Interferon Sciences)

Interferon). In the present invention, the term "IFN alpha" or "alpha interferon" also includes any substance with IFN alpha biological activity, such as a mutant or modified IFN alpha, for example IFN alpha PEG derivatives (PEG IFN alpha). In the present invention, the term "IFN α" or "interferon α" is not limited by any particular source of availability, and may be obtained from commercially available sources or produced by conventional techniques known to those skilled in the art, including, but not limited to, biological source extraction and genetic engineering extraction, which are described in detail in, for example, "Pestka s.arch Biochem biophysis.1983 Feb 15; 221(1):1-37 "(which is incorporated herein by reference).

As used herein, the term "HBV antigen" refers to a protein present in Hepatitis B Virus (HBV) that can induce an immune response in the body, including hepatitis b virus core antigen (HBcAg), hepatitis b virus surface antigen (HBsAg), and hepatitis b virus E antigen (HBeAg).

As used herein, the term "HBcAg" refers to the core antigen protein of Hepatitis B Virus (HBV), which is well known to those skilled in the art (see, e.g., GENBANK accession number: CAM 31905.1).

In the present invention, when referring to the amino acid sequence of HBcAg, reference is made to SEQ ID NO:38, for the description. However, it is understood by those skilled in the art that mutations or variations (including, but not limited to, substitutions, deletions and/or additions, such as hbcags of different genotypes, subtypes of genes, or different serotypes, subtypes of sera) may be naturally occurring or artificially introduced in the amino acid sequence of HBcAg without affecting its biological function. Thus, in the present invention, the term "HBcAg" shall include all such sequences, including, for example, SEQ ID NO:38 and natural or artificial variants thereof. And, when describing the sequence fragment of HBcAg, it includes not only SEQ ID NO:38, and also includes the corresponding sequence fragments in natural or artificial variants thereof. For example, the expression "amino acid residues 1 to 183 of HBcAg" includes, SEQ ID NO:38, and the corresponding fragment in a variant (natural or artificial) thereof. In the present invention, the expression "corresponding fragments" refers to the fragments at equivalent positions in the sequences being compared when the sequences are optimally aligned, i.e., when the sequences are aligned for the highest percent identity.

In the present invention, the term "HBcAg" is not limited by any particular method of synthesizing a protein, and can be produced by conventional techniques known to those skilled in the art, such as DNA recombination techniques or chemical synthesis techniques.

As used herein, the expression "antigenic fragment of HBcAg" refers to an amino acid sequence fragment (i.e., polypeptide) of the HBcAg protein that is truncated and which has the same biological activity as the corresponding full-length protein, i.e., stimulates and activates PBMCs from chronic hepatitis b patients. For example, the amino acid sequence fragment shown by SEQ ID NO. 3-37 in the invention is the antigenic fragment of HBcAg. In the present invention, the antigenic fragment is not limited by any particular method for synthesizing the polypeptide, and can be produced by conventional techniques known to those skilled in the art, such as DNA recombination techniques or chemical synthesis techniques.

In the present invention, HBcAg or an antigenic fragment thereof (e.g., antigenic fragments having the amino acid sequences shown as SEQ ID NOS: 3-37, respectively) can be obtained by DNA recombination techniques, for example, by using a cell-free expression system obtained from polynucleotides encoding these proteins or polypeptides (cell-free expression systems include, for example, reticulocyte lysate-based expression systems, wheat germ extract-based expression systems, and Escherichia coli extract-based expression systems); or by using in vivo expression systems (e.g., E.coli prokaryotic expression systems, yeast eukaryotic expression systems) from polynucleotides encoding these proteins or polypeptides. Alternatively, HBcAg or an antigenic fragment thereof (e.g., antigenic fragments having the amino acid sequences shown as SEQ ID NOS: 3-37, respectively) can be produced by chemical synthesis. Methods for the chemical total synthesis of proteins or polypeptides are well known in the art (see, e.g., Raibaut L, et al, Top Curr chem.2015; 363: 103-54; Thapa P, et al. Molecules.2014; 19(9): 14461-83; Dawson PE, et al., Science, 1994; 266(5186): 776-9; and Wang P, et al., Tetrahedron Lett,1998,39(47): 88711-14; incorporated herein by reference) and include, but are not limited to: solid Phase Peptide Synthesis (SPPS) or liquid Phase stepwise Synthesis (e.g., Native Chemical Ligation (NCL), Azide method (Azide method), and Transfer activated Ester method (TAEC)).

As used herein, the expression "antigenic fragments having the amino acid sequences shown as SEQ ID NO. 3 to 37, respectively" refers to a combination of the antigenic fragment having the amino acid sequence shown as SEQ ID NO. 3, the antigenic fragment having the amino acid sequence shown as SEQ ID NO. 4, … the antigenic fragment having the amino acid sequence shown as SEQ ID NO. 36, and the antigenic fragment having the amino acid sequence shown as SEQ ID NO. 37.

As used herein, the term "immunological detection" refers to an assay that utilizes specific antigen-antibody interactions/binding affinities, which are generally useful for detecting the presence or level of a particular antigen or antibody in a sample. Such immunological assays are well known to those skilled in the art and include, but are not limited to, ELISA assays, Elispot assays, Western blots, surface plasmon resonance methods, and the like. For a detailed description of immunological assays, see, e.g., Fundamental Immunology, ch.7Paul, w., ed., 2 nd edition, Raven Press, n.y. (1989).

As used herein, the term "antibody" refers to an immunoglobulin molecule typically composed of two pairs of polypeptide chains, each pair having one "light" (L) chain and one "heavy" (H) chain. Antibody light chains can be classified as kappa and lambda light chains. Heavy chains can be classified as μ, δ, γ, α or ε, and the antibody isotypes are defined as IgM, IgD, IgG, IgA, and IgE, respectively. Within the light and heavy chains, the variable and constant regions are connected by a "J" region of about 12 or more amino acids, and the heavy chain also contains a "D" region of about 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of 3 domains (CH1, CH2, and CH 3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain CL. The constant region of the antibody may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1 q). The VH and VL regions can also be subdivided into regions of high denaturation, called Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, called Framework Regions (FRs). Each VH and VL are composed of, in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 are composed of 3 CDRs and 4 FRs arranged from amino terminus to carboxy terminus. The variable regions (VH and VL) of each heavy/light chain pair form the antibody binding sites, respectively. The assignment of amino acids to the various regions or domains follows either Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk (1987) J.mol.biol.196: 901-; chothia et al (1989) Nature 342: 878-883. The term "antibody" is not limited by any particular method of producing an antibody. For example, it includes, in particular, recombinant antibodies, monoclonal antibodies and polyclonal antibodies. The antibody may be of a different isotype, for example, an IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtype), IgA1, IgA2, IgD, IgE, or IgM antibody.

As used herein, an "antigen-binding fragment" of an antibody refers to one or more portions of a full-length antibody that retain the ability to bind to the same antigen to which the antibody binds (e.g., OAS2 or USP18), and that are capable of competing with the full antibody for specific binding to the antigen. See, generally, Fundamental Immunology, ch.7paul, w., ed., 2 nd edition, Raven Press, n.y. (1989), which is incorporated by reference herein in its entirety for all purposes. Antigen-binding fragments can be generated by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. In some cases, antigen-binding fragments include Fab, Fab ', F (ab')2, Fd, Fv, dAb, and Complementarity Determining Region (CDR) fragments, single chain antibodies (e.g., scFv), chimeric antibodies, diabodies (diabodies), and polypeptides comprising at least a portion of an antibody sufficient to confer upon the polypeptide the ability to specifically bind an antigen.

As used herein, the term "Aptamer (Aptamer)" refers to a single-stranded oligonucleotide capable of binding a target protein of interest or other biological target molecule with high affinity and high specificity, which can be folded to form a thermodynamically stable three-dimensional spatial structure such as a Stem-Loop (Stem-Loop), Hairpin (Hairpin), Pseudoknot (pseudokinot), or G-tetramer (G-tetramer), and specifically bind to the target protein of interest or other biological target molecule by, for example, structural complementarity, base stacking forces, van der waals forces, hydrogen bonding, or electrostatic interactions. The aptamer may be DNA or RNA, and may also comprise a nucleic acid analog (e.g., Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), diol nucleic acid (GNA), or Threose Nucleic Acid (TNA)). Methods for obtaining aptamers that bind to a particular target protein are well known in the art, such as the SELEX (systematic evolution of ligands by exogenous genetic engineering) screening technology.

As used herein, the term "targeting polypeptide" refers to a polypeptide molecule that can specifically bind to a target protein of interest. In the present invention, the targeting polypeptide may comprise natural amino acids, synthetic amino acids, or amino acid mimetics (mimetics) that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code and those amino acids which are subsequently modified, for example hydroxyproline, γ -hydroxyglutamate, O-phosphoserine, phosphothreonine or phosphotyrosine. In the present invention, the "specificity" between a targeting polypeptide and its target protein of interest can be determined based on the affinity that can be measured as the dissociation equilibrium constant (i.e., K) of the targeting polypeptide and the target protein of interest to which it binds_DValue) is described. K_DThe lower the value, the stronger the binding strength between the targeting polypeptide and the target protein of interest to which it binds. Greater than about 10, as is generally known in the art^-3K of M_DValues are generally considered to represent non-binding or non-specific binding. Depending on the particular target protein of interest, the targeting polypeptide that specifically binds to the target protein can be obtained by methods known to those skilled in the art, e.g., screening by phage display technology or protein microarray technology.

As used herein, the expression "response to IFN α therapy" refers to the occurrence of a viral or serological response after IFN/PEG-IFN therapy in patients with chronic hepatitis B. Wherein the virological response is <2000IU/ml HBV DNA 6 months after treatment and is maintained for 6 to 12 months after drug withdrawal; the serological response refers to negative conversion of HBeAg and appearance of anti-HBe (see EASL chronic hepatitis b clinical practice guideline (2012 edition)). Accordingly, the expression "non-responsive to IFN alpha therapy" refers to the case where the chronic hepatitis B patient, after receiving IFN/PEG-IFN therapy, does not meet the conditions described above.

As used herein, the term "statistically analyzed value" refers to a value obtained by statistically analyzing the detection results obtained by various detection methods. Various statistical analysis methods are known in the art (see, e.g., PCT international application WO2009064901, which is incorporated herein by reference) and include, but are not limited to, linear combinations of test results, linear regression models, Logistic regression models, Linear Discriminant Analysis (LDA) models, nearest neighbor models, or microarray Predictive Analysis (PAM). In general, it is particularly preferable that the statistical analysis value is a value obtained by performing statistical analysis by a Logistic regression model. The Logistic regression model is described in detail, for example, "huchun. joint detection of four tumor markers in ovarian cancer serum [ D ]. guangzhou: zhongshan university, 2008: 1-39 ", which is incorporated herein by reference in its entirety.

As used herein, the term "reference value" (also referred to as a best diagnosis threshold) refers to a value that is capable of reflecting the condition of a population of CHB patients who are not responsive to IFN α therapy. In the present invention, the reference value includes, for example, a normal value or a range of values determined based on the level of the marker in a sample of a CHB patient population that is not responsive to IFN α therapy or based on the fold change (relative expression level) of the level of the marker in a sample of a CHB patient population that is not responsive to IFN α therapy before and after stimulation with IFN α and/or HBV antigen; and, a value obtained by statistically analyzing a detection value (for example, a fold change in the level of the marker described above) obtained from a sample of a CHB patient population that does not respond to IFN α treatment (statistical analysis value). Methods for determining an optimal diagnostic threshold are well known in the art and include, but are not limited to, Receiver Operating Characteristic curve analysis (ROC) curve analysis, which is described in detail, for example, in "Habibzadeh F, et al, Biochem Med (Zagreb). 26(3) 297 & 307 "and" Chen Wei et al. selection of optimal operating points in the ROC curve [ J ]. Chinese hygiene statistics, 2006,23:157 & 158 ", which are all incorporated herein by reference.

As used herein, the term "Cycle threshold" refers to the number of cycles that the fluorescence signal in each reaction tube undergoes in a quantitative fluorescence PCR assay when it reaches a set threshold. The Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, and the more the initial copy number is, the smaller the Ct value is. A standard curve can be made using a standard with a known starting copy number, with the logarithm of the starting copy number as the abscissa and the Ct value as the ordinate. Therefore, once the Ct value of an unknown sample is obtained, the initial copy number of the sample can be calculated from the standard curve.

As used herein, the term "comparative Ct method" is a relative quantitative analysis of mRNA well known in the art and is described in detail in, for example, Livak KJ, et al methods.2001 Dec; 25(4) 402-8 (which is incorporated herein by reference). In the real-time PCR (quantitative PCR) reaction process, it can be assumed that each PCR cycle is doubled in amplification product, and the Ct value obtained in the exponential phase of the PCR reaction can reflect the copy number of the initial template, so if the Ct values of different samples to be tested are different by one cycle, it means that the copy numbers of the initial templates are 2 times different. Based on the method, the relative expression level of the target gene in the sample to be detected can be judged by comparing Ct values of different samples.

As used herein, the term "normalization" or "normalizing" refers to the elimination of differences in expression caused by variable yields that may exist in various steps of the detection method employed by comparing the expression levels of the same gene in different samples. Methods of normalization are known in the art and include, but are not limited to, the methods described in detail in PCT international application WO2013068422a1 or chinese patent application 201280035399.6, such as the comparative Ct method based on internal reference genes.

As used herein, the term "expression level" refers to a measurable amount of a gene product produced by a gene of interest in a sample from a subject, wherein the gene product may be a transcription product or a translation product. Thus, the expression "determining the expression level of a gene of interest" may refer to determining the level of mRNA of said gene or a fragment of said mRNA, or the level of cDNA of said gene or a fragment of said cDNA, or the level of a protein encoded by said gene or a polypeptide fragment thereof.

As used herein, the term "Peripheral Blood Mononuclear Cell (PBMC)" refers to a generic term for cells having a single nucleus in Peripheral blood, including but not limited to lymphocytes (T cells, B cells, NK cells), monocytes, or dendritic cells. Methods for obtaining PBMCs from peripheral blood are well known in the art and include, but are not limited to, Ficoll stratified fluid method or Percoll stratified fluid method. In the present invention, the term "reagent for separating PBMC" refers to a reagent required in the method for obtaining PBMC described above, for example, a solution of Ficoll-diatrizoate used in the Ficoll fractionation method. In the present invention, the term "PBMC separation device" refers to a device capable of separating PBMCs from a sample (e.g., peripheral blood) from a subject, such devices being known in the art, including but not limited to cell separation devices described in detail in chinese patent applications CN1958776A, CN102286360A and CN105132278A, which are all incorporated herein by reference.

As used herein, the term "peripheral blood buffy coat" refers to a component of peripheral anticoagulation blood that has been subjected to natural sedimentation, centrifugation or density gradient centrifugation, consisting essentially of leukocytes (including peripheral blood mononuclear cells) and platelets. After centrifugation, anticoagulated blood forms an upper layer of plasma, a lower layer of red blood cells and a thin layer of white membranous material between the two, which accounts for about 1% of the total volume of blood and is called as a white membranous layer.

As used herein, the term "subject" includes, but is not limited to, various animals, particularly preferably humans.

In the present invention, the term "diluent" is preferably an electrolyte solution capable of maintaining the osmotic pressure of cells, and the solution also has the function of maintaining physiological pH value, if necessary. Such solutions are well known in the art and include, but are not limited to, Alsever's Solution, Earle's Balanced Salt Solution (EBSS), Gey's Balanced Salt Solution (GBSS), Hanks ' balanced salt Solution (HBSS), Phosphate Buffered Saline (PBS), Duchen Phosphate Buffered Saline (DPBS), Puck's balanced salt Solution, Ringer's Balanced Salt Solution (RBSS), Simm's Balanced Salt Solution (SBSS), TRIS Buffered Saline (TBS), Tyrode's Balanced Salt Solution (TBSS), physiological saline, or Ringer's Solution. In certain embodiments, the diluent is phosphate buffer or physiological saline.

As used herein, the term "anticoagulant" refers to an agent or substance capable of preventing blood coagulation, such substances being well known in the art and including, but not limited to, heparin, EDTA, oxalates (e.g., sodium oxalate, potassium oxalate, ammonium oxalate), sodium citrate (sodium citrate).

As used herein, the term "culture broth" or "culture medium" refers to a nutrient capable of maintaining the activity of cells. Typically the nutrients contain amino acids, vitamins, carbohydrates, inorganic salts and the like. Such nutrients are well known in the art and include, but are not limited to, RPMI-1640 medium or DMEM medium. In the present invention, the purpose of adding culture broth or medium to a sample from the subject is to maintain the activity of cells in the sample, particularly PBMCs. Methods for maintaining the viability of cells in blood components are well known in the art and can be selected by those skilled in the art according to the actual need. In certain embodiments, when the sample is whole blood, a culture solution may be added, for example, glucose, sodium chloride, potassium chloride, and the like in a phosphate buffer or physiological saline in appropriate amounts; in certain embodiments, the culture medium is a phosphate buffer to which appropriate amounts of glucose and potassium chloride are added. In certain embodiments, when the sample is Peripheral Blood Mononuclear Cells (PBMC), peripheral blood buffy coat or other PBMC-containing blood component, a culture medium, such as a cell culture medium, for example, a cell culture medium suitable for maintaining the activity of blood cells, particularly PBMC, such as RPMI-1640 medium or DMEM medium, may be added.

After a follow-up study on the response of chronic hepatitis B patients to IFN alpha therapy, the inventors of the present application surprisingly found that OAS2 levels in PBMC samples before treatment of patients responding to IFN alpha therapy showed a significant difference compared to patients not responding to IFN alpha therapy, or that OAS2 and/or UPS18 levels in PBMC samples before treatment of patients responding to IFN alpha therapy showed a significant difference after in vitro induction compared to patients not responding to IFN alpha therapy, and thus OAS2 and/or UPS18 could be used as markers for predicting IFN alpha therapy response in CHB patients. Prior to this application, there has long been a lack in the art of well-defined anti-HBV immune response indicators to predict the response of CHB patients to IFN α therapy. Based on this finding, the present inventors have developed a novel method for predicting the therapeutic effect of IFN α on CHB patients or the response of CHB patients to IFN α therapy.

Thus, in one aspect, the invention provides a kit comprising a first agent capable of detecting the expression level of a marker, optionally further comprising IFN α and/or a stimulus; wherein the marker is selected from OAS2 or USP18 and the stimulus is selected from HBV antigen, an antigenic fragment of HBV antigen, or any combination thereof.

In certain preferred embodiments, the HBV antigen is HBcAg. In certain preferred embodiments, the HBcAg has an amino acid sequence as shown in SEQ ID NO 38. In certain preferred embodiments, the antigenic fragment has an amino acid sequence selected from the group consisting of: 3-37 of SEQ ID NO.

In a particularly preferred embodiment, the stimulus comprises antigenic fragments having the amino acid sequences shown in SEQ ID NO 3-37, respectively.

In certain preferred embodiments, the first agent is an agent capable of detecting the mRNA level of the marker. Such reagents are well known in the art and include, but are not limited to, nucleic acid probes that specifically bind to a target sequence, amplification targetsPrimers for target sequences, non-specific fluorescent dyes (e.g., SYBR Green I), or combinations thereof. In certain embodiments, the nucleic acid probe can be a singly labeled nucleic acid probe, such as a radionuclide (e.g., a fluorescent radionuclide)³²P、³H、³⁵S, etc.) labeled probe, biotin-labeled probe, horseradish peroxidase-labeled probe, digoxigenin-labeled probe, or probe labeled with a fluorophore (e.g., FITC, FAM, TET, HEX, TAMRA, Cy3, Cy5, etc.); the nucleic acid probe may also be a double-labeled nucleic acid probe, such as a Taqman probe, a molecular beacon, a displacement probe, a scorpion primer probe, a QUAL probe, a FRET probe, and the like. In certain embodiments, the first reagent comprises a Taqman probe. In certain embodiments, the cDNA of OAS2 has the nucleotide sequence set forth in SEQ ID NO. 1. In certain embodiments, the cDNA of USP18 has the nucleotide sequence shown as SEQ ID NO. 2.

In certain preferred embodiments, the first agent is an agent capable of detecting the protein level of the marker. Such agents are well known in the art and include, but are not limited to, antibodies, targeting polypeptides or nucleic acid aptamers capable of specifically binding to OAS2 or USP18 protein. In certain embodiments, such reagents carry a detectable label, e.g., an enzyme (e.g., horseradish peroxidase, alkaline phosphatase, etc.), a radionuclide (e.g., horseradish peroxidase, alkaline phosphatase, etc.), or a combination thereof³H、¹²⁵I、³⁵S、¹⁴C、³²P, etc.), fluorescent dyes (e.g., FITC, TRITC, PE, Texas Red, quantum dots, Cy7, Alexa 750, etc.), acridinium ester compounds, magnetic beads (e.g.,

) Colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads, and biotin for binding to the above-described label-modified avidin (e.g., streptavidin).

In certain preferred embodiments, the first reagent determines the protein level of OAS2 or USP18 in the sample by immunological detection. In certain preferred embodiments, the immunological assay is selected from an ELISA assay, an Elispot assay, a Western blot, or a surface plasmon resonance method. In certain embodiments, the first agent comprises an antibody or antigen-binding fragment thereof against OAS2 or USP18 protein.

In certain preferred embodiments, the kits of the invention comprise a first reagent capable of detecting the expression level of OAS2, optionally further comprising IFN α and/or a stimulus.

In certain preferred embodiments, the kits of the invention comprise a first reagent capable of detecting the expression level of USP18 and IFN α, optionally further comprising a stimulus.

In certain preferred embodiments, the kits of the invention further comprise a second reagent for pre-treating a sample containing PBMCs, wherein the second reagent comprises one or more reagents selected from the group consisting of: a diluent for diluting the sample (e.g., phosphate buffer or physiological saline); anticoagulants for preventing blood coagulation (e.g., heparin); agents (e.g., culture medium or broth) for maintaining PBMC activity; and, reagents for isolating PBMCs (e.g., lymphocyte isolates, such as a polysucrose-diatrizoate solution). In certain preferred embodiments, the second agent comprises an agent for maintaining PBMC activity (e.g., a culture medium or broth), and/or an agent for isolating PBMCs (e.g., a lymphocyte isolate, such as a ficoll-diatrizoate solution).

In certain preferred embodiments, the kits of the invention further comprise a blood collection device (e.g., a pyrogen-free evacuated blood collection tube) and/or a PBMC separation device (e.g., a PBMC cell separation tube).

In certain preferred embodiments, the kits of the invention further comprise reagents capable of detecting the expression level of an internal reference gene that is relatively constant in expression in various tissues and cells and that does not undergo altered expression under the action of a processing factor, such as a housekeeping gene; typically, the housekeeping gene encodes a protein necessary to sustain the essential vital activity of the cell, including but not limited to β -actin, GAPDH, 18S rRNA, β 2-MG, UBC, or α -tubulin. In certain preferred embodiments, the agent capable of detecting the expression level of an internal reference gene is an agent capable of detecting the mRNA level of the internal reference gene. In certain preferred embodiments, the agent capable of detecting the expression level of an internal reference gene is an agent capable of detecting the protein level of the internal reference gene.

In another aspect, the invention relates to the use of an agent capable of detecting the level of expression of a marker in the preparation of a kit for predicting the effect of treatment of IFN α in a subject with chronic hepatitis b or the response of said subject to treatment with IFN α; wherein the marker is selected from OAS2 or USP 18.

In certain preferred embodiments, the kit further comprises IFN α and/or a stimulus selected from HBV antigen, an antigenic fragment of HBV antigen, or any combination thereof.

In certain preferred embodiments, the agent capable of detecting the expression level of a marker is an agent capable of detecting the mRNA level of the marker. Such reagents are well known in the art and include, but are not limited to, nucleic acid probes that specifically bind to a target sequence, primers that amplify a target sequence, a non-specific fluorescent dye (e.g., SYBR Green I), or a combination thereof. In certain embodiments, the nucleic acid probe can be a singly labeled nucleic acid probe, such as a radionuclide (e.g., a fluorescent radionuclide)³²P、³H、³⁵S, etc.) labeled probe, biotin-labeled probe, horseradish peroxidase-labeled probe, digoxigenin-labeled probe, or probe labeled with a fluorophore (e.g., FITC, FAM, TET, HEX, TAMRA, Cy3, Cy5, etc.); the nucleic acid probe may also be a double-labeled nucleic acid probe, such as a Taqman probe, a molecular beacon, a displacement probe, a scorpion primer probe, a QUAL probe, a FRET probe, and the like. In some implementationsIn a mode, the reagent capable of detecting the expression level of the marker comprises a Taqman probe. In certain embodiments, the cDNA of OAS2 has the nucleotide sequence set forth in SEQ ID NO. 1. In certain embodiments, the cDNA of USP18 has the nucleotide sequence shown as SEQ ID NO. 2.

mRNA levels of the marker can be determined using mRNA detection methods known in the art, such as fluorescent quantitative PCR, Northern blot, in situ hybridization, or methods involving mRNA amplification (e.g., reverse transcription PCR) and quantitation (e.g., electrophoresis and staining) of the mRNA amplification product. In certain preferred embodiments, the agent capable of detecting the expression level of a marker quantitatively determines the mRNA level of the marker by PCR. In a specific embodiment, the reagent capable of detecting the expression level of the marker measures the mRNA level of the marker by fluorescent quantitative PCR.

In certain preferred embodiments, the agent capable of detecting the level of expression of a marker is an agent capable of detecting the level of protein of the marker. Such agents are well known in the art and include, but are not limited to, antibodies, targeting polypeptides or nucleic acid aptamers capable of specifically binding to OAS2 or USP18 protein. In certain embodiments, such reagents carry a detectable label, e.g., an enzyme (e.g., horseradish peroxidase, alkaline phosphatase, etc.), a radionuclide (e.g., horseradish peroxidase, alkaline phosphatase, etc.), or a combination thereof³H、¹²⁵I、³⁵S、¹⁴C、³²P, etc.), fluorescent dyes (e.g., FITC, TRITC, PE, Texas Red, quantum dots, Cy7, Alexa 750, etc.), acridinium ester compounds, magnetic beads (e.g.,

In certain preferred embodiments, the agent capable of detecting the expression level of a marker determines the protein level of OAS2 or USP18 in the sample by immunological detection. In certain preferred embodiments, the immunological assay is selected from an ELISA assay, an Elispot assay, a Western blot, or a surface plasmon resonance method. In certain embodiments, the agent capable of detecting the expression level of a marker comprises an antibody or antigen-binding fragment thereof against OAS2 or USP18 protein.

In certain preferred embodiments, the kit further comprises reagents capable of detecting the expression level of an internal reference gene that is relatively constant in expression in each tissue and cell and that does not undergo altered expression under the action of a processing factor, such as a housekeeping gene; typically, the housekeeping gene encodes a protein necessary to sustain the essential vital activity of the cell, including but not limited to β -actin, GAPDH, 18S rRNA, β 2-MG, UBC, or α -tubulin. In certain preferred embodiments, the agent capable of detecting the expression level of an internal reference gene is an agent capable of detecting the mRNA level of the internal reference gene. In certain preferred embodiments, the agent capable of detecting the expression level of an internal reference gene is an agent capable of detecting the protein level of the internal reference gene.

In certain preferred embodiments, the kit further comprises one or more reagents or devices selected from 1) -6):

1) a diluent for diluting the sample, such as phosphate buffer or physiological saline;

2) anticoagulants for preventing blood coagulation, such as heparin;

3) agents for maintaining PBMC activity, such as culture media or culture solutions;

4) reagents for isolating PBMCs, such as lymphocyte isolates, e.g., a polysucrose-diatrizoate solution;

5) blood collection devices, such as pyrogen-free vacuum blood collection tubes; and

6) PBMC separation devices, such as PBMC cell separation tubes.

In certain preferred embodiments, the kit comprises reagents for maintaining PBMC activity (e.g., culture medium or broth), and/or reagents for isolating PBMCs (e.g., lymphocyte isolates, such as a ficoll-diatrizoate solution).

In certain preferred embodiments, the kit predicts the therapeutic effect of IFN α on a subject with chronic hepatitis b or the response of the subject to IFN α therapy by a method comprising the steps of:

(1) determining the expression level of a marker in a sample from the subject using a reagent capable of detecting the expression level of the marker, wherein the marker is OAS 2; and

(2) comparing the expression level to a reference value, or performing a statistical analysis on the expression level to obtain a statistical analysis value, and comparing the statistical analysis value to the reference value, and determining whether the subject will respond to IFN α therapy;

wherein the sample comprises Peripheral Blood Mononuclear Cells (PBMCs), such as whole blood (e.g., anticoagulated whole blood), Peripheral Blood Mononuclear Cells (PBMCs), or a peripheral blood buffy coat.

In certain preferred embodiments, when said expression level is greater than said reference value, or when a statistically analyzed value of said expression level is greater than said reference value, it is indicative that said subject will respond to IFN α therapy, being eligible to receive IFN α therapy; when the expression level is not greater than the reference value, or when the statistically analyzed value of the expression level is not greater than the reference value, it indicates that the subject does not respond to the IFN α therapy and is not suitable for receiving the IFN α therapy.

In certain preferred embodiments, in step (2), the expression level is statistically analyzed using logistic regression model.

In certain preferred embodiments, in order to eliminate the difference between the initial values of the markers to be detected between samples and to make the samples comparable, the expression level values of the markers to be detected in different samples can be normalized, for example, the expression level values of the markers to be detected in the samples can be compared with the expression level values of the reference genes. Thus, in step (1), the expression level of the marker is a normalized expression level. The normalized expression levels can be obtained by the following exemplary methods: using an assay capable of detecting the expression level of an internal reference gene(ii) the expression level of the internal reference gene in a sample from the subject, and comparing the expression level of the marker to the expression level of the internal reference gene to obtain a normalized expression level of the marker. In a specific embodiment, in step (1), the expression level of the marker is a normalized mRNA level, which can be obtained by the following exemplary method: comparing the mRNA level of the marker in the sample to be tested with the mRNA level of the reference gene by using a comparative Ct method to obtain 2^-ΔCtValue (Δ Ct ═ Ct)_{Marker to be detected}-Ct_{Internal reference gene}) This value is the normalized mRNA level of the marker, i.e., the fold change in the expression level of the marker compared to the expression level of the reference gene.

In certain preferred embodiments, prior to step (1), the method further comprises one or more of the following steps: (a) obtaining a sample from the subject using a blood collection device; (b) treating a blood collection device or a sample from the subject with an anticoagulant; (c) treating a sample from the subject with an agent for maintaining PBMC activity; (d) diluting a sample from the subject with a diluent; and (e) isolating PBMCs from the sample from the subject using the reagents for isolating PBMCs or the PBMC isolation device.

(1) stimulating at least one sample from the subject with IFN α as a test sample and a sample that is not stimulated with IFN α as a control sample; or, co-stimulating at least one sample from the subject with IFN α and a stimulus as a test sample and a sample stimulated with the stimulus but not with IFN α as a control sample; wherein the stimulus is selected from an HBV antigen, an antigenic fragment of an HBV antigen, or any combination thereof;

(2) determining the expression level of said marker in each sample of step (1) using a reagent capable of detecting the expression level of the marker, and obtaining a fold change in the expression level of the marker in said test sample compared to the expression level of the marker in said control sample as the relative expression level of said marker in said test sample, wherein said marker is selected from OAS2 or USP 18; and

(3) comparing the relative expression level to a reference value, or performing a statistical analysis on the relative expression level to obtain a statistical analysis value, and comparing the statistical analysis value to the reference value, and determining whether the subject will respond to IFN α therapy;

In certain preferred embodiments, when the relative expression level is less than the reference value, or when a statistically analyzed value of the relative expression level is less than the reference value, it is indicative that the subject will respond to IFN α therapy, and is eligible to receive IFN α therapy; when the relative expression level is not less than the reference value, or when a statistically analyzed value of the relative expression level is not less than the reference value, it indicates that the subject does not respond to the IFN α therapy and is not suitable for receiving the IFN α therapy.

In certain preferred embodiments, in step (2), the fold change of the mRNA level of the marker in the test sample compared to the mRNA level of the marker in the control sample, i.e., the relative expression level of mRNA of the marker in the test sample, is obtained by the comparative Ct method.

In certain preferred embodiments, in step (3), the relative expression levels are statistically analyzed using logistic regression model.

In certain preferred embodiments, in order to eliminate the difference between the initial values of the markers to be detected between samples and to make the samples comparable, the expression level values of the markers to be detected in different samples can be normalized, for example, the expression level values of the markers to be detected in the samples can be compared with the expression level values of the reference genes. Thus, in step (2), the expression level of the marker is a normalized expression level. The normalized expression levels can be obtained by the following exemplary methods: determining the expression level of an internal reference gene in a sample from the subject using an agent capable of detecting the expression level of the internal reference gene and comparing the expression level of the marker to the expression level of the internal reference gene to obtain a normalized expression level of the marker. In a specific embodiment, in step (2), the expression level of the marker is a normalized mRNA level, which can be obtained by the following exemplary method: and comparing the mRNA level of the marker in the sample to be tested with the mRNA level of the internal reference gene by using a comparative Ct method to obtain the normalized mRNA level of the marker. Further, the fold change of the normalized mRNA level of the marker in the sample to be tested compared with the normalized mRNA level of the marker in the control sample, namely the relative mRNA expression level of the marker in the sample to be tested, is obtained by comparing the Ct method.

In another aspect, the present invention provides a method for predicting the therapeutic effect of IFN α on a subject with chronic hepatitis b or the response of the subject to IFN α therapy, or obtaining the results of a diagnostic assay for predicting the therapeutic effect of IFN α on a subject with chronic hepatitis b or the response of the subject to IFN α therapy, comprising the steps of:

(1) providing a sample from the subject;

(2) determining the expression level of a marker in the sample, wherein the marker is OAS 2; and

(3) comparing the expression level to a reference value, or performing a statistical analysis on the expression level to obtain a statistical analysis value, and comparing the statistical analysis value to the reference value, and determining whether the subject will respond to IFN α therapy;

In certain preferred embodiments, after step (3), the method further comprises the step of administering IFN α to the subject to treat chronic hepatitis b, wherein the subject is determined to be responsive to IFN α therapy.

In certain preferred embodiments, in step (2), the mRNA level or protein level of the marker is determined.

In certain preferred embodiments, in step (2), the mRNA level of the marker is determined. mRNA levels of the marker can be determined using mRNA detection methods known in the art, such as fluorescent quantitative PCR, Northern blot, in situ hybridization, or methods involving mRNA amplification (e.g., reverse transcription PCR) and quantitation (e.g., electrophoresis and staining) of the mRNA amplification product. In certain preferred embodiments, the mRNA level of the marker is quantitatively determined by PCR. In a specific embodiment, the mRNA level of the marker is determined by fluorescent quantitative PCR. In certain embodiments, the cDNA of OAS2 has the nucleotide sequence set forth in SEQ ID NO. 1. In certain embodiments, the cDNA of USP18 has the nucleotide sequence shown as SEQ ID NO. 2.

In certain preferred embodiments, in step (2), the protein level of the marker is determined. In certain preferred embodiments, in step (2), the protein level of the marker is determined by immunological detection. Further, in certain preferred embodiments, the immunological assay is selected from an ELISA assay, an El spot assay, a Western blot, or a surface plasmon resonance method. In certain embodiments, in step (2), antibodies or antigen-binding fragments thereof against OAS2 are used to detect protein levels of OAS 2.

In certain preferred embodiments, in step (3), the expression level is statistically analyzed using Logistic regression model.

In certain preferred embodiments, in order to eliminate the difference between the initial values of the markers to be detected between samples and to make the samples comparable, the expression level values of the markers to be detected in different samples can be normalized, for example, the expression level values of the markers to be detected in the samples can be compared with the expression level values of the reference genes. Thus, in step (2), the expression level of the marker is a normalized expression level. The normalized expression levels can be obtained by the following exemplary methods: determining the expression level of an internal reference gene in a sample from the subject using an agent capable of detecting the expression level of the internal reference gene and comparing the expression level of the marker to the expression level of the internal reference gene to obtain a normalized expression level of the marker. In a specific embodiment, in step (2), the expression level of the marker is a normalized mRNA level, which can be obtained by the following exemplary method: comparing the mRNA level of the marker in the sample to be tested with the mRNA level of the reference gene by using a comparative Ct method to obtain 2^-ΔCtValue (Δ Ct ═ Ct)_{Marker to be detected}-Ct_{Internal reference gene}) This value is the normalized mRNA level of the marker, i.e., the fold change in the expression level of the marker compared to the expression level of the reference gene.

In certain preferred embodiments, prior to step (1), further comprising one or more of the following steps: (a) obtaining a sample from the subject; (b) adding an anticoagulant, such as heparin, to a sample from the subject; (c) obtaining PBMCs or a PBMC-containing blood component (e.g., peripheral blood buffy coat) from a sample from the subject; (d) adding a culture fluid or medium to a sample from the subject; and, (e) diluting the sample from the subject.

(1) providing at least two samples from the subject;

(2) stimulating at least one sample with IFN alpha as a sample to be tested, and taking a sample without IFN alpha stimulation as a control sample; or, co-stimulating at least one sample from the subject with IFN α and a stimulus as a test sample and a sample stimulated with the stimulus but not with IFN α as a control sample; wherein the stimulus is selected from an HBV antigen, an antigenic fragment of an HBV antigen, or any combination thereof;

(3) determining the expression level of a marker in each sample of step (2) and obtaining a fold change in the expression level of the marker in the test sample compared to the expression level of the marker in the control sample as the relative expression level of the marker in the test sample, wherein the marker is selected from OAS2 or USP 18; and

(4) comparing the relative expression level to a reference value, or performing a statistical analysis on the relative expression level to obtain a statistical analysis value, and comparing the statistical analysis value to the reference value, and determining whether the subject will respond to IFN α therapy;

In certain preferred embodiments, after step (4), the method further comprises the step of administering IFN α to the subject to treat chronic hepatitis b, wherein the subject is determined to be responsive to IFN α therapy.

In certain preferred embodiments, in step (2), the HBV antigen is HBVcAg. In certain preferred embodiments, the HBVcAg has an amino acid sequence shown in SEQ ID NO: 38. In certain preferred embodiments, the antigenic fragment has an amino acid sequence selected from the group consisting of: 3-37 of SEQ ID NO. In a particularly preferred embodiment, the stimulus comprises antigenic fragments having the amino acid sequences shown in SEQ ID NO 3-37, respectively.

In certain preferred embodiments, in step (3), the mRNA level of the marker is determined. mRNA levels of the marker can be determined using mRNA detection methods known in the art, such as fluorescent quantitative PCR, Northern blot, in situ hybridization, or methods involving mRNA amplification (e.g., reverse transcription PCR) and quantitation (e.g., electrophoresis and staining) of the mRNA amplification product. In certain preferred embodiments, the mRNA level of the marker is quantitatively determined by PCR. In a specific embodiment, the mRNA level of the marker is determined by fluorescent quantitative PCR. In certain embodiments, the cDNA of OAS2 has the nucleotide sequence set forth in SEQ ID NO. 1. In certain embodiments, the cDNA of USP18 has the nucleotide sequence shown as SEQ ID NO. 2.

In certain preferred embodiments, in step (3), the protein level of the marker is determined. In certain preferred embodiments, in step (3), the protein level of the marker is determined by immunological detection. Further, in certain preferred embodiments, the immunological assay is selected from an ELISA assay, an Elispot assay, a Western blot, or a surface plasmon resonance method. In certain embodiments, in step (3), the protein level of the marker is detected using an antibody or antigen-binding fragment thereof against OAS2 or USP18 protein.

In certain preferred embodiments, in step (3), the fold change of the mRNA level of the marker in the test sample compared to the mRNA level of the marker in the control sample, i.e., the relative expression level of mRNA of the marker in the test sample, is obtained by the comparative Ct method.

In certain preferred embodiments, in step (4), the relative expression levels are statistically analyzed using Logistic regression models.

In certain preferred embodiments, in order to eliminate the difference between the initial values of the markers to be detected between samples and to make the samples comparable, the expression level values of the markers to be detected in different samples can be normalized, for example, the expression level values of the markers to be detected in the samples can be compared with the expression level values of the reference genes. Thus, in step (3), the expression level of the marker is a normalized expression level. The normalized expression levels can be obtained by the following exemplary methods: determining the expression level of an internal reference gene in a sample from the subject using an agent capable of detecting the expression level of the internal reference gene and comparing the expression level of the marker to the expression level of the internal reference gene to obtain a normalized expression level of the marker. In a specific embodiment, in step (3), the expression level of the marker is a normalized mRNA level, which can be obtained by the following exemplary method: and comparing the mRNA level of the marker in the sample to be tested with the mRNA level of the internal reference gene by using a comparative Ct method to obtain the normalized mRNA level of the marker. Further, the fold change of the normalized mRNA level of the marker in the sample to be tested compared with the normalized mRNA level of the marker in the control sample, namely the relative mRNA expression level of the marker in the sample to be tested, is obtained by comparing the Ct method.

The present invention also includes the following exemplary embodiments:

1. stimulators for inducing Interferon inducible genes (ISGs) in vitro comprising combinations of full length or partial fragments of HBV core antigen and/or IFN α.

2. A marker for predicting the effect of Interferon alpha treatment on patients with chronic hepatitis B, wherein the marker is Interferon inducible genes (ISGs).

3. The marker of item 2, wherein the interferon inducible gene is selected from OAS2 and USP 18.

4. A method of screening for a marker for predicting the effect of interferon-alpha treatment in a patient with chronic hepatitis b, the method comprising the steps of:

1) collecting whole blood samples of patients with chronic hepatitis B before medication, and separating PBMC;

2) inducing a PBMC sample by using HBV core antigen polypeptide or IFN alpha or the combination of the HBV core antigen polypeptide and the IFN alpha;

3) collecting induced PBMC samples, extracting RNA, and detecting ISGs mRNA level after reverse transcription;

4) collecting the response result of clinical IFN alpha treatment of the specimen, and screening ISGs;

wherein, comparing different ISGs mRNA levels under the same induction condition of an IFN alpha treatment response group and an unresponsive group, and the difference of the ISGs mRNA levels of the IFN alpha treatment response group and the unresponsive group can be used as the basis of treatment effect.

5. The method of item 4, wherein the HBV core antigen polypeptide fragment is a polypeptide fragment of amino acids 1 to 183 of HBV core antigen.

6. A kit for predicting the effect of interferon alpha treatment on a patient with chronic hepatitis b comprising a polypeptide fragment of HBV core antigen and an inducer of IFN α, and reagents for detecting the levels of markers OAS2 and USP 18.

7. The kit of item 6, wherein the HBV core antigen polypeptide is a polypeptide of amino acids 1 to 183 of HBV core antigen.

8. Use of a reagent for detecting the level of markers OAS2 and/or USP18 in the manufacture of a diagnostic for predicting the effect of interferon alpha treatment in a patient with chronic hepatitis B.

9. Use of a reagent for detecting the level of markers OAS2 and/or USP18 in the manufacture of a kit for predicting the effect of interferon alpha treatment in a patient with chronic hepatitis B.

10. Use of markers OAS2 and/or USP18 for predicting the effect of interferon alpha treatment in a patient with chronic hepatitis B.

11. The use of any one of items 8 to 10, wherein the detection of the marker OAS2 and/or USP18 comprises quantitative detection of mRNA levels of the markers OAS2 and/or USP 18.

12. The use of any of items 8-10, wherein the mRNA levels of markers OAS2 and/or USP18 are quantitatively detected by fluorescent PCR.

13. The use of any one of items 8-10, wherein the sequences of the primers and probes for detecting mRNA levels of markers OAS2 and/or USP18 are:

advantageous effects of the invention

The present invention found through a large number of experiments and repeated groping that the expression levels of OAS2 and/or USP18 were significantly different in the two populations of CHB patients who responded to IFN α therapy and those who did not respond to IFN α therapy, thereby establishing a simple, convenient, rapid and highly accurate and specific prediction method for predicting the therapeutic effect of IFN α on a subject suffering from chronic hepatitis b or the response of the subject to IFN α therapy.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

(1) for the first time, the expression level of OAS2 in PBMC of chronic hepatitis B patients without or after in vitro stimulation can be used for predicting the result of IFN alpha treatment of CHB patients;

(2) the expression level of USP18 after in vitro stimulation of PBMCs of chronic hepatitis B patients is found to be capable of being used for predicting the result of IFN alpha treatment of CHB patients for the first time;

(3) the operation is simple and convenient: for example, whole blood is collected, PBMCs are separated, the PBMCs are subpackaged to a cell culture plate, IFN α is added, and then the cells are cultured in a constant temperature incubator; culturing for a certain period of time, and detecting the level of mRNA or protein;

(4) the requirements on experimental conditions, technical capability of personnel, equipment and environment are not high;

(5) the accuracy of the IFN alpha treatment response result prediction is high;

(6) low cost, easy popularization and wide application range.

Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and do not limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Drawings

FIG. 1 shows that under different treatment conditions, OAS2mRNA levels of PBMCs from CHB patients differ significantly between the responder (Rs) and non-responder (NRs) to IFN α therapy. Among these, figure 1a shows that PBMCs were not induced in vitro and mRNA levels of OAS2 were significantly higher in the responder than in the non-responder. FIG. 1b shows that the relative expression level of mRNA of OAS2 in the responder is significantly lower than that in the non-responder after IFN α induction of PBMCs in vitro. (Note: p <0.05, p <0.0005)

FIG. 2 shows that USP18mRNA levels of PBMCs from CHB patients under different treatment conditions were significantly different between the IFN α treatment response group (Rs) and the non-response group (NRs). Wherein, figure 2a shows that the relative expression level of mRNA of the responder USP18 is significantly lower than that of the non-responder after IFN alpha in vitro induction of PBMC; (ii) a FIG. 2b shows that the relative mRNA expression level of the responder USP18 was significantly lower than that of the non-responder after the PBMC were co-induced by IFN α and HBcAg polypeptide library. (Note: p <0.001, p < 0.0005.)

FIG. 3 shows ROC curves for the OAS2N assay and the OAS2(IFNa + N-N) assay. The results show that both the OAS2N assay and the OAS2(IFNa + N-N) assay have good sensitivity and specificity for predicting the response of CHB patients to IFN α therapy.

FIG. 4 shows ROC curves for OAS2(IFNa + N-N) assay, USP18(IFNa + N-N) assay, and a combination of both. The results show that OAS2(IFNa + N-N) assay, USP18(IFNa + N-N) assay, and a combination of both assays have good sensitivity and specificity for predicting the response of CHB patients to IFN α treatment.

Sequence information

The sequence information to which the present invention relates is provided in table 1 below.

Table 1: sequence information

Nucleotide sequence of OAS2 cDNA (SEQ ID NO: 1)

ATGGGAAATGGGGAGTCCCAGCTGTCCTCGGTGCCTGCTCAGAAGCTGGGTTGGTTTATCCAGGAATACCTGAAGCCCTACGAAGAATGTCAGACACTGATCGACGAGATGGTGAACACCATCTGTGACGTCCTGCAGGAACCCGAACAGTTCCCCCTGGTGCAGGGAGTGGCCATAGGTGGCTCCTATGGACGGAAAACAGTCTTAAGAGGCAACTCCGATGGTACCCTTGTCCTCTTCTTCAGTGACTTAAAACAATTCCAGGATCAGAAGAGAAGCCAACGTGACATCCTCGATAAAACTGGGGATAAGCTGAAGTTCTGTCTGTTCACGAAGTGGTTGAAAAACAATTTCGAGATCCAGAAGTCCCTTGATGGGTTCACCATCCAGGTGTTCACAAAAAATCAGAGAATCTCTTTCGAGGTGCTGGCCGCCTTCAACGCTCTGAGCTTAAATGATAATCCCAGCCCCTGGATCTATCGAGAGCTCAAAAGATCCTTGGATAAGACAAATGCCAGTCCTGGTGAGTTTGCAGTCTGCTTCACTGAACTCCAGCAGAAGTTTTTTGACAACCGTCCTGGAAAACTAAAGGATTTGATCCTCTTGATAAAGCACTGGCATCAACAGTGCCAGAAAAAAATCAAGGATTTACCCTCGCTGTCTCCGTATGCCCTGGAGCTGCTTACGGTGTATGCCTGGGAACAGGGGTGCAGAAAAGACAACTTTGACATTGCTGAAGGCGTCAGAACCGTTCTGGAGCTGATCAAATGCCAGGAGAAGCTGTGTATCTATTGGATGGTCAACTACAACTTTGAAGATGAGACCATCAGGAACATCCTGCTGCACCAGCTCCAATCAGCGAGGCCAGTAATCTTGGATCCAGTTGACCCAACCAATAATGTGAGTGGAGATAAAATATGCTGGCAATGGCTGAAAAAAGAAGCTCAAACCTGGTTGACTTCTCCCAACCTGGATAATGAGTTACCTGCACCATCTTGGAATGTTCTGCCTGCACCACTCTTCACGACCCCAGGCCACCTTCTGGATAAGTTCATCAAGGAGTTTCTCCAGCCCAACAAATGCTTCCTAGAGCAGATTGACAGTGCTGTTAACATCATCCGTACATTCCTTAAAGAAAACTGCTTCCGACAATCAACAGCCAAGATCCAGATTGTCCGGGGAGGATCAACCGCCAAAGGCACAGCTCTGAAGACTGGCTCTGATGCCGATCTCGTCGTGTTCCATAACTCACTTAAAAGCTACACCTCCCAAAAAAACGAGCGGCACAAAATCGTCAAGGAAATCCATGAACAGCTGAAAGCCTTTTGGAGGGAGAAGGAGGAGGAGCTTGAAGTCAGCTTTGAGCCTCCCAAGTGGAAGGCTCCCAGGGTGCTGAGCTTCTCTCTGAAATCCAAAGTCCTCAACGAAAGTGTCAGCTTTGATGTGCTTCCTGCCTTTAATGCACTGGGTCAGCTGAGTTCTGGCTCCACACCCAGCCCCGAGGTTTATGCAGGGCTCATTGATCTGTATAAATCCTCGGACCTCCCGGGAGGAGAGTTTTCTACCTGTTTCACAGTCCTGCAGCGAAACTTCATTCGCTCCCGGCCCACCAAACTAAAGGATTTAATTCGCCTGGTGAAGCACTGGTACAAAGAGTGTGAAAGGAAACTGAAGCCAAAGGGGTCTTTGCCCCCAAAGTATGCCTTGGAGCTGCTCACCATCTATGCCTGGGAGCAGGGGAGTGGAGTGCCGGATTTTGACACTGCAGAAGGTTTCCGGACAGTCCTGGAGCTGGTCACACAATATCAGCAGCTCTGCATCTTCTGGAAGGTCAATTACAACTTTGAAGATGAGACCGTGAGGAAGTTTCTACTGAGCCAGTTGCAGAAAACCAGGCCTGTGATCTTGGACCCAGCCGAACCCACAGGTGACGTGGGTGGAGGGGACCGTTGGTGTTGGCATCTTCTGGCAAAAGAAGCAAAGGAATGGTTATCCTCTCCCTGCTTCAAGGATGGGACTGGAAACCCAATACCACCTTGGAAAGTGCCGGTAAAAGTCATCTAA

Nucleotide sequence of USP18 cDNA (SEQ ID NO: 2)

ATGAGCAAGGCGTTTGGGCTCCTGAGGCAAATCTGTCAGTCCATCCTGGCTGAGTCCTCGCAGTCCCCGGCAGATCTTGAAGAAAAGAAGGAAGAAGACAGCAACATGAAGAGAGAGCAGCCCAGAGAGCGTCCCAGGGCCTGGGACTACCCTCATGGCCTGGTTGGTTTACACAACATTGGACAGACCTGCTGCCTTAACTCCTTGATTCAGGTGTTCGTAATGAATGTGGACTTCACCAGGATATTGAAGAGGATCACGGTGCCCAGGGGAGCTGACGAGCAGAGGAGAAGCGTCCCTTTCCAGATGCTTCTGCTGCTGGAGAAGATGCAGGACAGCCGGCAGAAAGCAGTGCGGCCCCTGGAGCTGGCCTACTGCCTGCAGAAGTGCAACGTGCCCTTGTTTGTCCAACATGATGCTGCCCAACTGTACCTCAAACTCTGGAACCTGATTAAGGACCAGATCACTGATGTGCACTTGGTGGAGAGACTGCAGGCCCTGTATACGATCCGGGTGAAGGACTCCTTGATTTGCGTTGACTGTGCCATGGAGAGTAGCAGAAACAGCAGCATGCTCACCCTCCCACTTTCTCTTTTTGATGTGGACTCAAAGCCCCTGAAGACACTGGAGGACGCCCTGCACTGCTTCTTCCAGCCCAGGGAGTTATCAAGCAAAAGCAAGTGCTTCTGTGAGAACTGTGGGAAGAAGACCCGTGGGAAACAGGTCTTGAAGCTGACCCATTTGCCCCAGACCCTGACAATCCACCTCATGCGATTCTCCATCAGGAATTCACAGACGAGAAAGATCTGCCACTCCCTGTACTTCCCCCAGAGCTTGGATTTCAGCCAGATCCTTCCAATGAAGCGAGAGTCTTGTGATGCTGAGGAGCAGTCTGGAGGGCAGTATGAGCTTTTTGCTGTGATTGCGCACGTGGGAATGGCAGACTCCGGTCATTACTGTGTCTACATCCGGAATGCTGTGGATGGAAAATGGTTCTGCTTCAATGACTCCAATATTTGCTTGGTGTCCTGGGAAGACATCCAGTGTACCTACGGAAATCCTAACTACCACTGGCAGGAAACTGCATATCTTCTGGTTTACATGAAGATGGAGTGCTAA

HBcAg polypeptide library peptide fragment sequence (P1-P35) (SEQ ID NO:3 ~ 37)

P1:MDIDPYKEFGASVEL(SEQ ID NO：3)

P2:YKEFGASVELLSFLP(SEQ ID NO：4)

P3:ASVELLSFLPSDFFP(SEQ ID NO：5)

P4:LSFLPSDFFPSVRDL(SEQ ID NO：6)

P5:SDFFPSVRDLLDTAS(SEQ ID NO：7)

P6:SVRDLLDTASALYRE(SEQ ID NO：8)

P7:LDTASALYREALESP(SEQ ID NO：9)

P8:ALYREALESPEHCSP(SEQ ID NO：10)

P9:ALESPEHCSPHHTAL(SEQ ID NO：11)

P10:EHCSPHHTALRQAIL(SEQ ID NO：12)

P11:HHTALRQAILCWGEL(SEQ ID NO：13)

P12:RQAILCWGELMNLAT(SEQ ID NO：14)

P13:CWGELMNLATWVGSN(SEQ ID NO：15)

P14:MNLATWVGSNLEDPA(SEQ ID NO：16)

P15:WVGSNLEDPASRELV(SEQ ID NO：17)

P16:LEDPASRELVVSYVN(SEQ ID NO：18)

P17:SRELVVSYVNVNMGL(SEQ ID NO：19)

P18:VSYVNVNMGLKIRQL(SEQ ID NO：20)

P19:VNMGLKIRQLLWFHI(SEQ ID NO：21)

P20:KIRQLLWFHISCLTF(SEQ ID NO：22)

P21:LWFHISCLTFGRETV(SEQ ID NO：23)

P22:SCLTFGRETVLEYLV(SEQ ID NO：24)

P23:GRETVLEYLVSFGVW(SEQ ID NO：25)

P24:LEYLVSFGVWIRTPP(SEQ ID NO：26)

P25:SFGVWIRTPPAYRPP(SEQ ID NO：27)

P26:IRTPPAYRPPNAPIL(SEQ ID NO：28)

P27:AYRPPNAPILSTLPE(SEQ ID NO：29)

P28:NAPILSTLPETTVVR(SEQ ID NO：30)

P29:STLPETTVVRRRGRS(SEQ ID NO：31)

P30:TTVVRRRGRSPRRRT(SEQ ID NO：32)

P31:RRGRSPRRRTPSPRR(SEQ ID NO：33)

P32:PRRRTPSPRRRRSQS(SEQ ID NO：34)

P33:PSPRRRRSQSPRRRR(SEQ ID NO：35)

P34:RRSQSPRRRRSQSRE(SEQ ID NO：36)

P35:QSPRRRRSQSRESQC(SEQ ID NO：37)

Amino acid sequence of HBcAg (SEQ ID NO: 38)

MDIDPYKEFGATVELLSFLPSDFFPSVRGLLDTASALYREALESPEHCSPHHTALRQAILCWGELMTLATWVGVNLEDPASRDLVVSYVNTNMGLKFRQLLWFHISCLTFGRETVIEYLVSFGVWIRTPPAYRPPNAPILSTLPETTVVRRRGRSPRRRTPSPRRRRSQSPRRRRSQSRESQC

Primer (5 '-3') (SEQ ID NO: 39 to 74)

USP18-Forward:CAGACCCTGACAATCCACCT(SEQ ID NO：39)

USP18-Reverse:AGCTCATACTGCCCTCCAGA(SEQ ID NO：40)

OAS2-Forward:TCAGCGAGGCCAGTAATCTT(SEQ ID NO：41)

OAS2-Reverse:GCAGAACATTCCAAGATGGT(SEQ ID NO：42)

LGP1-Forward:GCAGGAAGACAGTGGAGAGC(SEQ ID NO：43)

LGP1-Reverse:GAGCCAGCACTTCTGGGTAG(SEQ ID NO：44)

LAP3-Forward:GGTGCCATGGATGTAGCTTT(SEQ ID NO：45)

LAP3-Reverse:AGAGAGGCATCCTCCAGACA(SEQ ID NO：46)

GIP3-Forward:CTCGCTGATGAGCTGGTCT(SEQ ID NO：47)

GIP3-Reverse:ATACTTGTGGGTGGCGTAGC(SEQ ID NO：48)

CEB1-Forward:GATTGCTGGAGGGAATCAAA(SEQ ID NO：49)

CEB1-Reverse:TTGGATTTCCCTTTTTGTGC(SEQ ID NO：50)

ATF5-Forward:AGCCCCCTGTCTTGGATACT(SEQ ID NO：51)

ATF5-Reverse:CGAGAAGGTTGAGGTGGAGA(SEQ ID NO：52)

GIP2-Forward:CGCAGATCACCCAGAAGATC(SEQ ID NO：53)

GIP2-Reverse:GCCCTTGTTATTCCTCACCA(SEQ ID NO：54)

OAS3-Forward:GTCAAACCCAAGCCACAAGT(SEQ ID NO：55)

OAS3-Reverse:GGGCGAATGTTCACAAAGTT(SEQ ID NO：56)

RPLP2-Forward:GCTGTAGCCGTCTCTGCTG(SEQ ID NO：57)

RPLP2-Reverse:AAAAAGGCCAAATCCCATGT(SEQ ID NO：58)

STXBP5-Forward:GTTCATCTGATGGGCTTCGT(SEQ ID NO：59)

STXBP5-Reverse:TTTGTTGTGGTGGTTCTCCA(SEQ ID NO：60)

Viperin-Forward:CTTTTGCTGGGAAGCTCTTG(SEQ ID NO：61)

Viperin-Reverse:CAGCTGCTGCTTTCTCCTCT(SEQ ID NO：62)

RPS28-Forward:CCGTGTGCAGCCTATCAAG(SEQ ID NO：63)

RPS28-Reverse:TTTACATTGCGGATGATGGA(SEQ ID NO：64)

PI3KAP1-Forward:CTGCAGAGAGCTTTCCATCC(SEQ ID NO：65)

PI3KAP1-Reverse:GTCTCTGGCTCATCGTCACA(SEQ ID NO：66)

MX1-Forward:GTGCATTGCAGAAGGTCAGA(SEQ ID NO：67)

MX1-Reverse:CTGGTGATAGGCCATCAGGT(SEQ ID NO：68)

DUSP1-Forward:CCAACCATTTTGAGGGTCAC(SEQ ID NO：69)

DUSP1-Reverse:ACCCTTCCTCCAGCATTCTT(SEQ ID NO：70)

ETEF1-Forward:AGCGGAAGGAGGAGAAAAAG(SEQ ID NO：71)

ETEF1-Reverse:GTACTCTTGGGCAGGTGAGC(SEQ ID NO：72)

β-actin-Forward:CAAAGACCTGTACGCCAACACA(SEQ ID NO：73)

β-actin-Reverse:GGAGTACTTGCGCTCAGGAGG(SEQ ID NO：74)

Probe (5 '-3') (SEQ ID NO: 75 to 92)

USP18-probe:TCTGCCACTCCCTGTACTTCCCC(SEQ ID NO：75)

OAS2-probe:AAAATATGCTGGCAATGGCTGAA(SEQ ID NO：76)

LGP1-probe:CTTGGGGAGGCCTCTCTGCAG(SEQ ID NO：77)

LAP3-probe:AATTCATCCTGGCTCTGGAACAA(SEQ ID NO：78)

GIP3-probe:TAGTGGCCACGCTGCAGAGC(SEQ ID NO：79)

CEB1-probe:TCCTACTCTGAATGAAGGGACTGTAA(SEQ ID NO：80)

ATF5-probe:AACGAGGCCGGGCAGGAGGA(SEQ ID NO：81)

GIP2-probe:TCTGGCTGTCCACCCGAGCG(SEQ ID NO：82)

OAS3-probe:TCAACAGTGGCTGCCAAGGG(SEQ ID NO：83)

RPLP2-probe:TGCTGCTGGTTCTGCCCCTG(SEQ ID NO：84)

STXBP5-probe:AACTCACCACTTAAACAGTCTCCAGG(SEQ ID NO：85)

Viperin-probe:TGGTCCCGCTGTTCTGCTGG(SEQ ID NO：86)

RPS28-probe:TTCTCAGGGACAGTGCACGCAG(SEQ ID NO：87)

PI3KAP1-probe:AGGCTGCTCTGCGGCGTGCG(SEQ ID NO：88)

MX1-probe:ATCCTGGGATTTTGGGGCTTTC(SEQ ID NO：89)

DUSP1-probe:AGCATCCCTGTGGAGGACAACC(SEQ ID NO：90)

ETEF1-probe:AGGAGGAGATGGATGAATGTGAGCA(SEQ ID NO：91)

β-actin-probe:CCGACAGGATGCAGAAGGAGATCAC(SEQ ID NO：92)

Detailed Description

The invention will now be described with reference to the following examples, which are intended to illustrate the invention, but not to limit it. Unless otherwise indicated, the experiments and methods described in the examples (e.g., molecular biology experiments and immunoassays) are performed essentially according to conventional methods well known in the art and described in various references. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, 2 nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates (1992), which is incorporated herein by reference in its entirety. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The examples are given by way of illustration and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.

Example 1 peripheral blood PBMC isolation and in vitro Induction culture

1.1 peripheral blood PBMC isolation

(1) Whole blood was centrifuged at 4000rpm for 10 min.

(2) The serum was aspirated and the remaining whole blood was diluted with an equal amount of PBS.

(3) A15 mL centrifuge tube was prepared, and an equal amount of lymphocyte separation medium (Ficoll-page Tm PLUS, GE Helathcare Life Sciences) to the whole blood was added.

(4) The diluted whole blood is slowly added on the lymphocyte separating medium along the tube wall, and the layered state is kept.

(5) The liquid was centrifuged at 1000g for 22min and the rate of acceleration and deceleration was minimized.

(6) Carefully sucking the white cloudy lymphocyte layer, adding the white cloudy lymphocyte layer into another centrifuge tube, adding PBS for dilution, centrifuging the mixture, taking 600g multiplied by 7min, and discarding the supernatant. Then PBS was added for dilution, and the mixture was centrifuged at 400 g.times.7 min, and the supernatant was discarded. The cells were resuspended in 1ml of culture medium.

(7) To a 1.5ml centrifuge tube was added 10. mu.l of the prepared sample cell suspension and 40. mu.l of 0.4% trypan blue, preparation 1: 5 cell dilutions. 10. mu.l of trypan blue/cell mixed suspension was added to a blood cell counting plate and viable cells were counted, wherein the number of cells per ml equals cell count × dilution multiple × 10⁴。

1.2 in vitro Induction culture of PBMCs with IFN alpha and/or a stimulus

The PBMC cells were seeded in 24-well plates at 5X 10 cells/well⁵Cells were cultured and 1ml of RPM1640 medium containing 10% fetal bovine serum was added. Four wells are provided for each specimen, wherein the first well is labeled N without addition of an inducing substance (including IFN. alpha. and HBcAg polypeptide library), and the second well is labeled N with addition of IFN. alpha (1X 10 of Andamen, Anhui's Biotechnology group, Inc.) (1X 10 of Anhui Kagaku Co., Ltd.)⁴IU/mL), the third well was added with a polypeptide library (synthesized by Shanghai bioengineering, Inc.) containing 35 HBcAg antigenic fragments (SEQ ID NOS: 3-37) (1. mu.g/strip/mL, 35 strips total), and the fourth well was added with the above IFN α and HBcAg polypeptide libraries. The culture plate is placed in a carbon dioxide incubator at 37 ℃ for induction culture for 24h, and then cells are collected.

Example 2 fluorescent quantitative PCR method for detecting mRNA level of Gene

The invention relates to a fluorescent quantitative PCR detection system established for 17 genes including USP18, OAS2, LGP1, LAP3, GIP3, CEB1, ATF5, GIP2, OAS3, RPLP2, STXBP5, Viperin, RPS28, PI3KAP1, MX1, DUSP1, ETEF1 and the like and internal reference beta-actin.

2.1 extraction of RNA from PBMC

(1) The PBMC cells obtained in example 1 were collected by centrifugation, and the supernatant was discarded; add 250. mu.l RPMI1640 medium and 750. mu.l Tripure to each well and mix well; to 1ml of the cells was added 200. mu.l of chloroform, the mixture was inverted and mixed, and the mixture was allowed to stand at 4 ℃ for 10 min.

(2) Centrifuge at 12,000rpm, 4 ℃ for 15 min.

(3) After the above treatment, the samples in each tube were divided into three layers, the uppermost layer (taking care not to absorb the protein layer) was aspirated and transferred to a new DEPC-treated EP tube, and equal volume of isopropanol was added, and the mixture was mixed by inversion and left at-20 ℃ for 15 min.

(4) Centrifuge at 12,000rpm at 4 ℃ for 10min and discard the supernatant.

(5) The mixture was washed twice with 1mL of 75% ethanol at 12,000rpm and 4 ℃ and centrifuged for 5 min.

(6) Discarding ethanol, air drying for 5-10min, dissolving RNA with 35 μ L DEPC water preheated at 55-60 deg.C, and freezing the extracted RNA in a refrigerator at-80 deg.C.

2.2 reverse transcription of RNA

The concentration and purity of the RNA sample was determined using a spectrophotometer. Taking 2 mu L of RNA sample, determining the absorbance values of A260 and A280 in A2 mu L RNase-free water calibration instrument, and detecting the ratio of A260 to A280 to evaluate the purity of the RNA sample, wherein the RNA purity is determined as follows: a260/280 is more than or equal to 1.80.

Reverse transcription system:

reverse transcription was performed at 42 ℃ for 30min by the reverse transcription system described above. The obtained cDNA is a template in a fluorescent quantitative PCR detection system and is stored at-20 ℃.

2.3 fluorescent quantitative PCR System establishment

(1) RT-PCR System:

and (3) amplification reaction process:

95 ℃ for 3min, then 95 ℃ for 10sec, 55 ℃ for 45sec, for a total of 39 cycles.

Primer software was used to design primers and probes for RT-PCR and were synthesized by Yingjun Biotechnology Ltd, the specific sequences are shown in Table 2 below:

TABLE 2 primers and probes for fluorescent quantitative PCR reactions

(2) Preliminary experiments with primers

The 18 sets of primers (table 2 above) designed by primer software were pre-tested, two templates (labeled CHB 1 and CHB 2, respectively) from CHB patients were randomly selected, and Ct values of the genes to be tested and the reference primers were detected by fluorescence quantitative PCR. The identification results are shown in Table 3, Ct values of the primers of the 17 sets of genes to be detected and the internal reference beta-actin primer are both between 15 and 35, which shows that the primers can be effectively amplified; meanwhile, effective amplification is not detected in the Neg group (without the template), and further indicates that 18 sets of primers listed in the above Table 2 can be used for fluorescent quantitative PCR detection of corresponding genes to be detected.

TABLE 3 preliminary experiments of primers in fluorescent quantitative PCR detection systems

Example 3 differential expression of OAS2, USP18 in CHB patients responding and non-responding to IFN α treatment

The invention has tracked 150 chronic hepatitis B specimens clinically altogether, among them receive IFN alpha treatment and have 24 weeks of treatment results totally 66 cases; among them, 47 cases showed no response to IFN α therapy, and 19 cases showed response to IFN α therapy. Table 4 shows the characteristic data of the study samples selected in this example, and the results show that there was no significant difference in age and sex between the response group (Rs) and the non-response group (NRs), and that there was no significant difference in ALT, AST and HBsAg, HBV DNA, HBeAg results before treatment.

TABLE 4 characteristics of the enrollment study specimens

Peripheral blood was collected from chronic hepatitis b patients who had not received IFN α treatment, PBMCs were extracted and processed according to the method of example 1 above and RNA was extracted according to the method of example 2, and fluorescence quantitative PCR was performed to detect and calculate mRNA levels of 17 genes to be tested (USP18, OAS2, LGP1, LAP3, GIP3, CEB1, ATF5, GIP2, OAS3, RPLP2, STXBP5, Viperin, RPS28, PI3KAP1, MX1, DUSP1, ETEF1) calculated by a relative quantification method (comparative Ct method) in such a manner that: subtracting the Ct value of the respective internal reference beta-actin from the measured Ct value of each target gene to obtain the delta Ct value of each target gene (delta Ct-Ct)_{Target gene}-Ct_{Internal reference gene}) Calculate 2^-ΔCtA value representing a fold of change in the expression amount of the gene in the test sample relative to the expression amount of the reference gene (i.e., a normalized mRNA level of the gene relative to the reference gene); then, the delta Ct value of the gene in the sample to be detected is subtracted from the delta Ct value of the gene in the control sample to obtain a delta Ct value (delta Ct is delta Ct)_{Sample to be tested}-ΔCt_{Control sample}) And finally 2^-ΔΔCtThe value is represented by the fold change in the expression level of the gene in the test sample relative to the expression level of the gene in the control sample (i.e., the relative expression level of the gene in the test sample relative to the mRNA of the gene in the control sample).

By comparing the difference in mRNA levels of the above respective genes in the responder group and the non-responder group, it was found that there was a significant difference in mRNA levels of OAS2 and USP18 among them between the responder group and the non-responder group. The results are shown in FIGS. 1 and 2, where PBMC cells of OAS2N group, which represent normalized mRNA levels of OAS2 relative to the reference gene in the test sample, were not induced in vitro; the conditions for in vitro induction of PBMCs of OAS2(IFNa + N-N), USP18(IFNa + N-N) and USP18(IFNa + HBcAg-HBcAg) are shown in Table 5, and the specific steps for in vitro induction culture are performed with reference to example 1.2, wherein OAS2(IFNa + N-N) represents the relative expression level of mRNA of OAS2 in the test sample relative to OAS2 in the control sample; the USP18(IFNa + N-N) group and the USP18(IFNa + HBcAg-HBcAg) group respectively represent the relative mRNA expression level of USP18 in the test sample relative to USP18 in the respective control samples.

TABLE 5 in vitro induction conditions of test and control samples in different groups

FIG. 1a shows the results of the OAS2N group testing, which shows that the OAS2 normalized mRNA levels in responder patients were significantly higher than in non-responder patients in PBMC samples from CHB patients not subjected to any in vitro induction prior to IFN α treatment. FIG. 1b shows the results of the test in OAS2(IFNa + N-N) group, showing that the relative expression level of mRNA in OAS2 in responder patients was significantly lower than that in non-responder patients in PBMC samples of CHB patients cultured by IFN α in vitro induction before receiving IFN α treatment.

FIG. 2a shows the results of the test in the USP18(IFNa + N-N) group, which shows that the relative mRNA expression level of USP18 in the responder patients is significantly lower than that in the non-responder patients in PBMC samples before IFN alpha treatment in CHB patients cultured by IFN alpha in vitro induction. FIG. 2b shows the results of detection in the USP18(IFNa + HBcAg-HBcAg) group, and the results show that the relative mRNA expression level of USP18 in patients with responder group is significantly lower than that in patients with non-responder group in PBMC samples before IFN alpha treatment in CHB patients cultured by in vitro induction with IFN alpha and HBcAg polypeptide library (containing HBcAg antigenic fragments shown in SEQ ID NO: 3-37).

The above results indicate that OAS2 levels were significantly elevated in pre-treatment PBMC samples from patients who responded to IFN α therapy compared to patients who did not respond to IFN α therapy; also, the pre-treatment PBMC samples of patients who responded to IFN α therapy had significantly reduced levels of OAS2 and/or UPS18 after in vitro induction with IFN α and/or HBcAg compared to patients who did not respond to IFN α therapy. Thus OAS2 and/or UPS18 may be used to predict response of CHB patients to IFN α therapy.

Example 4 ROC Curve analysis of the OAS2N and OAS2(IFNa + N-N) assays

Based on the experimental conditions of OAS2N and OAS2(IFNa + N-N) groups in example 3, the corresponding OAS2N and OAS2(IFNa + N-N) assays were established, respectively, and the main steps of the above two assays are shown in Table 6. In this example, the CHB patient sample described in example 3 was tested by the two methods described above, and two diagnostic indicators of the sample were obtained: OAS2 normalized mRNA levels and relative mRNA expression levels of OAS 2; the SPSS 17.0 software was then used to plot ROC curves to test the performance of the OAS2N assay or OAS2(IFNa + N-N) assay alone in predicting the effect of IFN α treatment on CHB patients or the response of CHB patients to IFN α treatment, using OAS2 normalized mRNA levels and the relative mRNA expression levels of OAS2 as diagnostic indices. The results of ROC curve analysis are shown in FIG. 3 and Table 7, and show that the area under the ROC curve (AUC) of OAS2N and OAS2(IFNa + N-N) assays were 0.774 and 0.814, respectively; the sensitivity is 72% and 71% respectively; the specificity was 80% and 83%, respectively.

The results show that 2 detection methods have higher sensitivity and specificity, and the single use of OAS2N detection method or OAS2(IFNa + N-N) detection method can be used for predicting the treatment effect of IFN alpha on CHB patients or the response of CHB patients to IFN alpha treatment, and has higher sensitivity and specificity.

TABLE 6 Main steps of OAS2N and OAS2(IFNa + N-N) assays

TABLE 7 ROC analysis of OAS2N assay, OAS2(IFNa + N-N) assay

Example 5 ROC Curve analysis of the OAS2(IFNa + N-N) assay, the USP18(IFNa + N-N) assay and a combination of the two

Based on the experimental conditions of OAS2(IFNa + N-N) and USP18(IFNa + N-N) in example 3, the corresponding OAS2(IFNa + N-N) and USP18(IFNa + N-N) assays were established, respectively, and the main steps of the above two assays are shown in Table 8. In this example, the CHB patient samples described in example 3 were tested by the two methods described above, and two diagnostic indicators were obtained: relative mRNA expression levels of OAS2 and USP 18; then using SPSS 17.0 software with the mRNA relative expression level of OAS2 or USP18 as diagnostic indicators, ROC curves were drawn to test the performance of OAS2(IFNa + N-N) assay or USP18(IFNa + N-N) assay alone in predicting the therapeutic effect of IFN α on CHB patients or the response of CHB patients to IFN α therapy; and the indexes are used as joint detection indexes, a statistical analysis value is obtained through a Logistic regression model, an ROC curve is drawn again according to the value, and the prediction performance of the joint detection of the indexes and the ROC curve is evaluated. The results of ROC curve analysis are shown in FIG. 4 and Table 9, and show that the areas under the ROC curve (AUC) of the 2 methods are 0.814 and 0.823, respectively; the sensitivity is 71 percent and 60 percent respectively; the specificity was 83% and 95%, respectively. The AUC of 2 methods combined detection can reach 0.861, and the sensitivity and specificity are respectively 74% and 89%. The results show that both OAS2(IFNa + N-N) test and USP18(IFNa + N-N) test and combined test have good sensitivity and specificity, and further that both OAS2N test or OAS2(IFNa + N-N) test alone or combined test have good sensitivity and specificity for predicting the treatment effect of IFN alpha on CHB patients or the response of CHB patients to IFN alpha treatment.

TABLE 8 Main Steps of OAS2(IFNa + N-N) and USP18(IFNa + N-N) assays

TABLE 9 ROC analysis of OAS2(IFNa + N-N) and USP18(IFNa + N-N) assays and combinations thereof

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

Sequence listing

<110> university of mansion

<120> method and kit for predicting response of chronic hepatitis B patient to IFN alpha therapy

<130> IDC160055

<150> 201610121177.6

<151> 2016-03-04

<160> 92

<170> PatentIn version 3.5

<210> 1

<211> 2064

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 1

atgggaaatg gggagtccca gctgtcctcg gtgcctgctc agaagctggg ttggtttatc 60

caggaatacc tgaagcccta cgaagaatgt cagacactga tcgacgagat ggtgaacacc 120

atctgtgacg tcctgcagga acccgaacag ttccccctgg tgcagggagt ggccataggt 180

ggctcctatg gacggaaaac agtcttaaga ggcaactccg atggtaccct tgtcctcttc 240

ttcagtgact taaaacaatt ccaggatcag aagagaagcc aacgtgacat cctcgataaa 300

actggggata agctgaagtt ctgtctgttc acgaagtggt tgaaaaacaa tttcgagatc 360

cagaagtccc ttgatgggtt caccatccag gtgttcacaa aaaatcagag aatctctttc 420

gaggtgctgg ccgccttcaa cgctctgagc ttaaatgata atcccagccc ctggatctat 480

cgagagctca aaagatcctt ggataagaca aatgccagtc ctggtgagtt tgcagtctgc 540

ttcactgaac tccagcagaa gttttttgac aaccgtcctg gaaaactaaa ggatttgatc 600

ctcttgataa agcactggca tcaacagtgc cagaaaaaaa tcaaggattt accctcgctg 660

tctccgtatg ccctggagct gcttacggtg tatgcctggg aacaggggtg cagaaaagac 720

aactttgaca ttgctgaagg cgtcagaacc gttctggagc tgatcaaatg ccaggagaag 780

ctgtgtatct attggatggt caactacaac tttgaagatg agaccatcag gaacatcctg 840

ctgcaccagc tccaatcagc gaggccagta atcttggatc cagttgaccc aaccaataat 900

gtgagtggag ataaaatatg ctggcaatgg ctgaaaaaag aagctcaaac ctggttgact 960

tctcccaacc tggataatga gttacctgca ccatcttgga atgttctgcc tgcaccactc 1020

ttcacgaccc caggccacct tctggataag ttcatcaagg agtttctcca gcccaacaaa 1080

tgcttcctag agcagattga cagtgctgtt aacatcatcc gtacattcct taaagaaaac 1140

tgcttccgac aatcaacagc caagatccag attgtccggg gaggatcaac cgccaaaggc 1200

acagctctga agactggctc tgatgccgat ctcgtcgtgt tccataactc acttaaaagc 1260

tacacctccc aaaaaaacga gcggcacaaa atcgtcaagg aaatccatga acagctgaaa 1320

gccttttgga gggagaagga ggaggagctt gaagtcagct ttgagcctcc caagtggaag 1380

gctcccaggg tgctgagctt ctctctgaaa tccaaagtcc tcaacgaaag tgtcagcttt 1440

gatgtgcttc ctgcctttaa tgcactgggt cagctgagtt ctggctccac acccagcccc 1500

gaggtttatg cagggctcat tgatctgtat aaatcctcgg acctcccggg aggagagttt 1560

tctacctgtt tcacagtcct gcagcgaaac ttcattcgct cccggcccac caaactaaag 1620

gatttaattc gcctggtgaa gcactggtac aaagagtgtg aaaggaaact gaagccaaag 1680

gggtctttgc ccccaaagta tgccttggag ctgctcacca tctatgcctg ggagcagggg 1740

agtggagtgc cggattttga cactgcagaa ggtttccgga cagtcctgga gctggtcaca 1800

caatatcagc agctctgcat cttctggaag gtcaattaca actttgaaga tgagaccgtg 1860

aggaagtttc tactgagcca gttgcagaaa accaggcctg tgatcttgga cccagccgaa 1920

cccacaggtg acgtgggtgg aggggaccgt tggtgttggc atcttctggc aaaagaagca 1980

aaggaatggt tatcctctcc ctgcttcaag gatgggactg gaaacccaat accaccttgg 2040

aaagtgccgg taaaagtcat ctaa 2064

<210> 2

<211> 1119

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 2

atgagcaagg cgtttgggct cctgaggcaa atctgtcagt ccatcctggc tgagtcctcg 60

cagtccccgg cagatcttga agaaaagaag gaagaagaca gcaacatgaa gagagagcag 120

cccagagagc gtcccagggc ctgggactac cctcatggcc tggttggttt acacaacatt 180

ggacagacct gctgccttaa ctccttgatt caggtgttcg taatgaatgt ggacttcacc 240

aggatattga agaggatcac ggtgcccagg ggagctgacg agcagaggag aagcgtccct 300

ttccagatgc ttctgctgct ggagaagatg caggacagcc ggcagaaagc agtgcggccc 360

ctggagctgg cctactgcct gcagaagtgc aacgtgccct tgtttgtcca acatgatgct 420

gcccaactgt acctcaaact ctggaacctg attaaggacc agatcactga tgtgcacttg 480

gtggagagac tgcaggccct gtatacgatc cgggtgaagg actccttgat ttgcgttgac 540

tgtgccatgg agagtagcag aaacagcagc atgctcaccc tcccactttc tctttttgat 600

gtggactcaa agcccctgaa gacactggag gacgccctgc actgcttctt ccagcccagg 660

gagttatcaa gcaaaagcaa gtgcttctgt gagaactgtg ggaagaagac ccgtgggaaa 720

caggtcttga agctgaccca tttgccccag accctgacaa tccacctcat gcgattctcc 780

atcaggaatt cacagacgag aaagatctgc cactccctgt acttccccca gagcttggat 840

ttcagccaga tccttccaat gaagcgagag tcttgtgatg ctgaggagca gtctggaggg 900

cagtatgagc tttttgctgt gattgcgcac gtgggaatgg cagactccgg tcattactgt 960

gtctacatcc ggaatgctgt ggatggaaaa tggttctgct tcaatgactc caatatttgc 1020

ttggtgtcct gggaagacat ccagtgtacc tacggaaatc ctaactacca ctggcaggaa 1080

actgcatatc ttctggttta catgaagatg gagtgctaa 1119

<210> 3

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P1

<400> 3

Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu

1 5 10 15

<210> 4

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P2

<400> 4

Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser Phe Leu Pro

1 5 10 15

<210> 5

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P3

<400> 5

Ala Ser Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro

1 5 10 15

<210> 6

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P4

<400> 6

Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu

1 5 10 15

<210> 7

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P5

<400> 7

Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser

1 5 10 15

<210> 8

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P6

<400> 8

Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu

1 5 10 15

<210> 9

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P7

<400> 9

Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro

1 5 10 15

<210> 10

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P8

<400> 10

Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro

1 5 10 15

<210> 11

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P9

<400> 11

Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu

1 5 10 15

<210> 12

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P10

<400> 12

Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu

1 5 10 15

<210> 13

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P11

<400> 13

His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu

1 5 10 15

<210> 14

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P12

<400> 14

Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Asn Leu Ala Thr

1 5 10 15

<210> 15

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P13

<400> 15

Cys Trp Gly Glu Leu Met Asn Leu Ala Thr Trp Val Gly Ser Asn

1 5 10 15

<210> 16

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P14

<400> 16

Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala

1 5 10 15

<210> 17

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P15

<400> 17

Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser Arg Glu Leu Val

1 5 10 15

<210> 18

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P16

<400> 18

Leu Glu Asp Pro Ala Ser Arg Glu Leu Val Val Ser Tyr Val Asn

1 5 10 15

<210> 19

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P17

<400> 19

Ser Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu

1 5 10 15

<210> 20

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P18

<400> 20

Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys Ile Arg Gln Leu

1 5 10 15

<210> 21

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P19

<400> 21

Val Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile

1 5 10 15

<210> 22

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P20

<400> 22

Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe

1 5 10 15

<210> 23

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P21

<400> 23

Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val

1 5 10 15

<210> 24

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P22

<400> 24

Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val

1 5 10 15

<210> 25

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P23

<400> 25

Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp

1 5 10 15

<210> 26

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P24

<400> 26

Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro

1 5 10 15

<210> 27

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P25

<400> 27

Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro

1 5 10 15

<210> 28

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P26

<400> 28

Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu

1 5 10 15

<210> 29

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P27

<400> 29

Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu

1 5 10 15

<210> 30

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P28

<400> 30

Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Arg

1 5 10 15

<210> 31

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P29

<400> 31

Ser Thr Leu Pro Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser

1 5 10 15

<210> 32

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P30

<400> 32

Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr

1 5 10 15

<210> 33

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P31

<400> 33

Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg

1 5 10 15

<210> 34

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P32

<400> 34

Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser

1 5 10 15

<210> 35

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P33

<400> 35

Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg

1 5 10 15

<210> 36

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P34

<400> 36

Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg Glu

1 5 10 15

<210> 37

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> P35

<400> 37

Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg Glu Ser Gln Cys

1 5 10 15

<210> 38

<211> 183

<212> PRT

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 38

Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu

1 5 10 15

Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Gly Leu Leu Asp

20 25 30

Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys

35 40 45

Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu

50 55 60

Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala

65 70 75 80

Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys

85 90 95

Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg

100 105 110

Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr

115 120 125

Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro

130 135 140

Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr

145 150 155 160

Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser

165 170 175

Gln Ser Arg Glu Ser Gln Cys

180

<210> 39

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 39

cagaccctga caatccacct 20

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 40

agctcatact gccctccaga 20

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 41

tcagcgaggc cagtaatctt 20

<210> 42

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 42

gcagaacatt ccaagatggt 20

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 43

gcaggaagac agtggagagc 20

<210> 44

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 44

gagccagcac ttctgggtag 20

<210> 45

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 45

ggtgccatgg atgtagcttt 20

<210> 46

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 46

agagaggcat cctccagaca 20

<210> 47

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 47

ctcgctgatg agctggtct 19

<210> 48

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 48

atacttgtgg gtggcgtagc 20

<210> 49

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 49

gattgctgga gggaatcaaa 20

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 50

ttggatttcc ctttttgtgc 20

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 51

agccccctgt cttggatact 20

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 52

cgagaaggtt gaggtggaga 20

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 53

cgcagatcac ccagaagatc 20

<210> 54

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 54

gcccttgtta ttcctcacca 20

<210> 55

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 55

gtcaaaccca agccacaagt 20

<210> 56

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 56

gggcgaatgt tcacaaagtt 20

<210> 57

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 57

gctgtagccg tctctgctg 19

<210> 58

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 58

aaaaaggcca aatcccatgt 20

<210> 59

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 59

gttcatctga tgggcttcgt 20

<210> 60

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 60

tttgttgtgg tggttctcca 20

<210> 61

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 61

cttttgctgg gaagctcttg 20

<210> 62

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 62

cagctgctgc tttctcctct 20

<210> 63

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 63

ccgtgtgcag cctatcaag 19

<210> 64

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 64

tttacattgc ggatgatgga 20

<210> 65

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 65

ctgcagagag ctttccatcc 20

<210> 66

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 66

gtctctggct catcgtcaca 20

<210> 67

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 67

gtgcattgca gaaggtcaga 20

<210> 68

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 68

ctggtgatag gccatcaggt 20

<210> 69

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 69

ccaaccattt tgagggtcac 20

<210> 70

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 70

acccttcctc cagcattctt 20

<210> 71

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 71

agcggaagga ggagaaaaag 20

<210> 72

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 72

gtactcttgg gcaggtgagc 20

<210> 73

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 73

caaagacctg tacgccaaca ca 22

<210> 74

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 74

ggagtacttg cgctcaggag g 21

<210> 75

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 75

tctgccactc cctgtacttc ccc 23

<210> 76

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 76

aaaatatgct ggcaatggct gaa 23

<210> 77

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 77

cttggggagg cctctctgca g 21

<210> 78

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 78

aattcatcct ggctctggaa caa 23

<210> 79

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 79

tagtggccac gctgcagagc 20

<210> 80

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 80

tcctactctg aatgaaggga ctgtaa 26

<210> 81

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 81

aacgaggccg ggcaggagga 20

<210> 82

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 82

tctggctgtc cacccgagcg 20

<210> 83

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 83

tcaacagtgg ctgccaaggg 20

<210> 84

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 84

tgctgctggt tctgcccctg 20

<210> 85

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 85

aactcaccac ttaaacagtc tccagg 26

<210> 86

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 86

tggtcccgct gttctgctgg 20

<210> 87

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 87

ttctcaggga cagtgcacgc ag 22

<210> 88

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 88

aggctgctct gcggcgtgcg 20

<210> 89

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 89

atcctgggat tttggggctt tc 22

<210> 90

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 90

agcatccctg tggaggacaa cc 22

<210> 91

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 91

aggaggagat ggatgaatgt gagca 25

<210> 92

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 92

ccgacaggat gcagaaggag atcac 25

Claims

1. Use of a reagent capable of detecting the expression level of a marker and IFN α, wherein the marker is OAS2 or the markers are OAS2 and USP18, for the preparation of a diagnostic kit for predicting the therapeutic effect of IFN α on a subject with chronic hepatitis b or the response of the subject to IFN α therapy in a PBMC sample.

2. The use of claim 1, wherein the agent capable of detecting the expression level of a marker is an agent capable of determining the mRNA level of the marker.

3. The use of claim 1, wherein the kit further comprises one or more reagents or devices selected from 1) -6):

1) a diluent for diluting the sample;

2) an anticoagulant for preventing blood coagulation;

3) an agent for maintaining PBMC activity;

4) reagents for isolating PBMCs;

5) a blood collection device; and

6) PBMC separation device.

4. The use of claim 3, which is characterized by one or more of the following features:

(1) the diluent is selected from phosphate buffer or normal saline;

(2) the anticoagulant is selected from heparin;

(3) the agent for maintaining PBMC activity is selected from a culture medium or a culture solution;

(4) the reagent for isolating PBMCs is selected from lymphocyte isolates;

(5) the blood sampling device is a pyrogen-free vacuum blood sampling tube;

(6) the PBMC separation device is a PBMC cell separation tube.

5. The use of claim 1, wherein the kit predicts the therapeutic effect of IFN α on a subject with chronic hepatitis b or the response of the subject to IFN α therapy by a method comprising the steps of:

(1) stimulating at least one sample from the subject with IFN α as a test sample and a sample that is not stimulated with IFN α as a control sample;

(2) determining the expression level of the marker in each sample in step (1) using a reagent capable of detecting the expression level of the marker, and obtaining a fold change in the expression level of the marker in the test sample compared to the expression level of the marker in the control sample, as the relative expression level of the marker in the test sample; and

wherein the sample comprises Peripheral Blood Mononuclear Cells (PBMCs).

6. The use of claim 5, wherein the sample is selected from whole blood, Peripheral Blood Mononuclear Cells (PBMCs), or a peripheral blood buffy coat.

7. The use of claim 5, wherein the mRNA level of the marker is quantified by PCR.

8. The use according to claim 5, wherein the fold change of the mRNA level of the marker in the test sample compared with the mRNA level of the marker in the control sample, i.e., the relative mRNA expression level of the marker in the test sample, is obtained by a comparative Ct method.

9. The use of claim 5, wherein the relative expression levels are statistically analyzed using a Logistic regression model.