CN115838763A - CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application - Google Patents
CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application Download PDFInfo
- Publication number
- CN115838763A CN115838763A CN202211102086.XA CN202211102086A CN115838763A CN 115838763 A CN115838763 A CN 115838763A CN 202211102086 A CN202211102086 A CN 202211102086A CN 115838763 A CN115838763 A CN 115838763A
- Authority
- CN
- China
- Prior art keywords
- cchfv
- pvax1
- expression vector
- eukaryotic expression
- recombinant eukaryotic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to the technical field of biomedicine, and particularly relates to a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, a construction method and application thereof, wherein a gene of a structural protein NP of a CCHFV strain is synthesized, and the gene is inserted into a pVAX1 plasmid vector by adopting a homologous recombination method to construct the pVAX-CCHFV-NP recombinant eukaryotic expression vector. The invention constructs the eukaryotic expression vector based on the complete antigens of the eukaryotic expression vector pVAX1 and NP, and obtains the CCHFV DNA vaccine with good immune effect.
Description
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, a construction method and application.
Background
The crimean-congo hemorrhagic fever virus (CCHFV) is a premna natural immunogenic virus, can be infected by biting of premna, is susceptible to human beings, has clinical symptoms similar to other types of hemorrhagic fever, has a latency period of about 2-12 days, and has higher lethality rate clinically manifested by sudden onset of illness, rising of body temperature, severe headache, nausea and vomiting and the like. Under the optical microscope, giemsa staining of basophilic cytoplasmic inclusion bodies, e.g., erythrocyte size, was observed in the infected tissues of the rat brain.
Although there are many studies on CCHFV vaccines, no vaccine with good therapeutic effect has been developed yet (reference: "guo leiming, dong mega yi, cheng linpeak. Research progress of kri-congo hemorrhagic fever virus vaccine [ J ]. Tropical journal of medicine, 2018,18 (10): 5"), so there is still a great need for the development of a vaccine against the kri-congo hemorrhagic fever virus.
The genome of CCHFV contains three parts of an M section, an S section and an L section, wherein the M section encodes envelope glycoproteins Gc and Gn which are key proteins for virus pathogenesis, and NP antigen is not a common material for CCHFV vaccines.
Disclosure of Invention
In order to solve the technical problems, the invention provides a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, a construction method and application.
The invention provides a construction method of a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-Gc, which synthesizes a gene of a structural protein NP of a CCHFV strain, and inserts the amplified gene into a pVAX1 plasmid vector by a homologous recombination method to construct the pVAX-CCHFV-NP recombinant eukaryotic expression vector as shown in SEO ID NO. 1.
Preferably, the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP is constructed, and the CCHFV strain is IbAr10200.
Preferably, in the method for constructing the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, the enzyme cutting sites for inserting the NP gene into the pVAX1 plasmid vector are EcoR I and Xba I.
Preferably, the method for constructing the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP,
preferably, the primer sequences of the PCR method used for identifying the pVAX-CCHFV-NP recombinant eukaryotic expression vector pVAX1-CCHFV-NP are as follows:
Primer-F：
5’-TCCAGTGTGGTGGAATTC ATGGAAAACAAGATCGAGGTG-3’；
Primer-R：
5’-TTAAACGGGCCCTCTAGA CTAGCTCGAGCATGCCCGG-3’。
the invention also provides a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP with the method as base.
The invention also provides an application of the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, and the pVAX1-CCHFV-NP is used for preparing a CCHFV vaccine.
Preferably, the above-mentioned recombinant eukaryotic expression vector pVAX1-CCHFV-NP of CCHFV is used for inhibiting infection of CCHFV tecVLP after immunization of organism, so that the pVAX1-CCHFV-NP is used for preparing the infection inhibitor of CCHFV tecVLP.
Preferably, the above-mentioned CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP is used for effectively promoting the expression of immune factors IFN-gamma, IL-2, IL-4 and IL-10 after immunizing organisms, so that the pVAX1-CCHFV-NP is used for preparing the expression promoter of the immune factors IFN-gamma, IL-2, IL-4 and IL-10.
Preferably, the above-mentioned CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP is used for preparing a cellular immune response promoter, wherein the pVAX-LAMP-CCHFV-NP is capable of effectively stimulating the body to generate cellular immune response represented by CTL killing after immunizing the body.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention constructs a recombinant eukaryotic expression vector pVAX1-CCHFV-NP on the basis of the eukaryotic expression vector pVAX1, and finally obtains the recombinant CCHFV DNA vaccine (namely pVAX 1-CCHFV-NP). After the immune animal tests, pVAX1-CCHFV-NP can effectively stimulate the organism to generate cellular immune response represented by CTL killing. In addition, the vaccine can effectively protect organisms from being attacked by CCHFV and has good animal protection effect. The results indicate that the pVAX1-CCHFV-NP vaccine has the potential of being used as a safe and efficient novel CCHFV vaccine.
Compared with the previous research and patent, the vector pVAX1 is used, has good safety and high expression level, and is approved by the FDA in the United states to be used in human DNA vaccines. In addition, the antigen studied by the inventor is NP protein rich in CCHFV neutralizing epitope, the complete antigen of NP is used in the invention, the immune response of the organism can be fully stimulated, and the invention is more superior regardless of the types of the antigens and the breadth under the same antigen.
Drawings
FIG. 1 shows the construction and identification results of pVAX-CCHFV-NP recombinant plasmid vector;
a, PCR result of pVAX-CCHFV-NP recombinant plasmid vector, wherein lane 1 is DNA Marker (5000 bp), and lane 2 is PCR result of pVAX-CCHFV-NP;
b, western-blot results, wherein lane 1 is protein Marker (11-245 kD), lane 2 is normal control cell, lane 3 is pVAX1 transfected cell, lane 4 is pVAX-CCHFV-NP transfected cell;
FIG. 2 shows immunofluorescence results;
FIG. 3 shows the result of detection of specific antibodies; * Denotes P < 0.01;
FIG. 4 shows the detection result of the secreted immune molecule of pVAX-CCHFV-NP immunized mouse; * P < 0.05, P < 0.01;
a, IFN-gamma detection result; b, detecting an IL-2 result; c, IL-4 detection results; d, detecting an IL-10 result;
FIG. 5 shows the results of evaluation of differentiation levels of splenic lymphocytes;
FIG. 6 is the evaluation of the cellular immune effect of pVAX-CCHFV-NP immunized mice; * P < 0.01, P < 0.001;
FIG. 7 illustrates protection effect detection;
wherein, A-C are the results of liver, spleen and kidney infection of mice by CCHFV tecVLP detected by qPCR respectively;
D-F are the results of the liver, spleen and kidney of mice infected with CCHFV tecVLP detected by the kit respectively.
Detailed Description
In order that those skilled in the art will better understand the technical solutions of the present invention to be implemented, the present invention will be further described with reference to the following specific embodiments and accompanying drawings.
In the description of the present invention, reagents used are commercially available and methods used are conventional in the art, unless otherwise specified. In the following experiments, DPBS was purchased from semer flies.
Example 1
A construction method of a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP comprises the following steps:
(1) Construction and identification of CCHFV recombinant plasmid vector
Entrust Shanghai's engineering to synthesize the gene of structural protein NP of CCHFV strain IbAr10200, the gene of NP is shown in SEQ ID NO.1, adopt homologous recombination method to insert the above-mentioned gene of NP between two enzyme cutting sites of EcoR I and Xba I of pVAX1 plasmid vector (note that the sequence of the large fragment is reserved after the enzyme cutting, used for connecting the gene of NP), construct pVAX-CCHFV-NP recombination eukaryotic expression vector.
The NP gene is shown as SEQ ID NO.1 (1494 bp):
ATGGAAAACAAGATCGAGGTGAATAACAAAGATGAGATGAACAGGTGGTTTGAAGAGTTCAAAAAAGGAAATGGACTTGTGGACACCTTCACAAACTCCTATTCCTTTTGCGAGAGTGTTCCCAATTTGGACAGGTTTGTGTTTCAGATGGCCAGTGCCACCGATGATGCACAGAAGGACTCCATCTACGCATCTGCTCTGGTGGAGGCAACAAAGTTTTGTGCACCTATATATGAGTGCGCATGGGTTAGCTCCACTGGCATTGTAAAAAAGGGACTTGAATGGTTCGAGAAAAATGCAGGAACCATTAAGTCCTGGGATGAAAGTTATACTGAGCTAAAGGTCGACGTCCCGAAAATAGAGCAGCTTACCGGTTACCAACAAGCTGCCTTGAAGTGGAGAAAAGACATAGGTTTCCGTGTCAATGCCAACACAGCAGCTCTGAGCAACAAAGTCCTCGCAGAATACAAAGTCCCTGGTGAGATTGTGATGTCTGTCAAAGAGATGCTGTCAGACATGATTAGGAGAAGGAACCTGATTCTAAACAGGGGTGGTGATGAGAACCCACGTGGCCCAGTGAGCCATGAGCATGTAGACTGGTGCAGGGAGTTTGTCAAAGGCAAATACATCATGGCCTTCAACCCACCATGGGGGGACATCAACAAGTCAGGCCGTTCAGGAATAGCACTTGTTGCAACAGGCCTTGCTAAGCTTGCAGAGACTGAAGGAAAGGGAATATTTGATGAAGCCAAAAAGACTGTGGAGGCCCTCAACGGGTATCTGGACAAGCATAAGGACGAAGTTGATAGAGCAAGCGCCGACAGCATGATAACAAACCTTCTTAAGCATATTGCCAAGGCACAGGAGCTCTATAAAAATTCATCTGCACTTCGTGCACAAAGCGCACAGATTGACACTGCTTTCAGCTCATACTATTGGCTTTACAAGGCTGGCGTGACTCCTGAAACCTTCCCGACGGTGTCACAGTTCCTCTTTGAGCTAGGGAAACAGCCAAGAGGTACCAAGAAAATGAAGAAGGCTCTTCTGAGCACCCCAATGAAGTGGGGGAAGAAGCTTTATGAGCTCTTTGCCGATGATTCTTTCCAGCAGAACAGGATTTACATGCATCCTGCCGTGCTTACAGCTGGTAGAATCAGTGAAATGGGAGTCTGCTTTGGGACAATCCCTGTGGCCAATCCTGATGATGCTGCCCAAGGATCTGGACACACTAAGTCTATTCTCAACCTCCGTACCAACACTGAGACCAATAATCCGTGTGCCAAAACCATCGTCAAGCTATTTGAAGTTCAAAAAACAGGGTTCAACATTCAGGACATGGACATAGTGGCCTCTGAGCACTTGCTACACCAATCCCTTGTTGGCAAGCAATCCCCATTCCAGAACGCCTACAACGTCAAGGGCAATGCCACCAGTGCTAACATCATTTAAAATACAAACTGCTCTGTACTCAACTTCCGGGCATGCTCGAGCTAG
after extracting plasmid (pVAX-CCHFV-NP recombination eukaryotic expression vector), adopting PCR method and gene sequencing method to identify whether the constructed vector is correct.
The primers used in the PCR method were as follows:
Primer-F：
5’-TCCAGTGTGGTGGAATTC ATGGAAAACAAGATCGAGGTG-3’，SEQ ID NO.2；
Primer-R：
5’-TTAAACGGGCCCTCTAGA CTAGCTCGAGCATGCCCGG-3’，SEQ ID NO.3。
the PCR amplification conditions were: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 30 seconds, 58 ℃ for 30 seconds, 72 ℃ for 1 minute, and a final extension at 72 ℃ for 10 minutes.
The PCR system was as follows:
reaction system (25. Mu.l): 10 × PCR buffer 2.5. Mu.l; 2.5mM dNTPs 1.0. Mu.l; 10 μ M of each of the upstream and downstream primers 0.5 μ l; phanta Max Super-Fidelity DNA polymerase 0.2. Mu.l of Novozan; plasmid 1.0. Mu.l; water was added to 25. Mu.l.
Transfecting the constructed pVAX-CCHFV-NP recombinant eukaryotic expression vector to cells, and identifying whether the corresponding antigen protein is correctly expressed by adopting an immunofluorescence method (the transfected cells are Hela cells) and a western-blot method (the transfected cells are 293T cells). The results are shown in FIGS. 1-2, which show that the recombinant plasmid vectors described above can correctly express the corresponding antigenic proteins.
(2) Method for immunizing mice by CCHFV recombinant plasmid vector
Mice were immunized with the pVAX-CCHFV-NP recombinant eukaryotic expression vector constructed as described above at a dose of 70. Mu.g/200. Mu.L/mouse, and the control group contained DPBS group and pVAX1 vector group, each of which contained 8 mice. The immunization is carried out in an intramuscular injection mode, and the immunization is carried out 3 times in total, and the intervals of each time are 3 weeks.
(3) Method for immunizing mice by CCHFV tecVLP infection recombinant plasmid vector
The immunized mice in (2) above were infected with the previously constructed CCHFV tecVLP (Stephanie Degnot, eric Bergeron, stuart Nichol, ali Mirazimi, friedemann Weber. A Virus-Like Particle System identities of the Endonuclear clean Domain of Crimean-Congo Hemorrhagic turbine Virus. Journal of Virology,2015,89 (11): 5957-5967) and 4 mice were challenged per group. The infection mode and dose were 500 μ L per mouse by intraperitoneal injection, mice were sacrificed 3 days after infection, and the main organs were taken: heart, liver, spleen, lung, kidney, brain.
(4) Evaluation of immune Effect of CCHFV recombinant plasmid vector
(4.1) evaluation of humoral immune Effect in immunized mice
And (3) killing 4 mice in each group after 3 times of immunization in the step (2), taking blood and spleen to obtain serum and spleen cells, detecting specific antibodies in the serum by an ELISA method, and detecting the titer of the neutralizing antibodies by a NanoLuc kit method. The detection results of the specific antibody and the neutralizing antibody of the pVAX-CCHFV-NP recombinant plasmid vector are shown in figure 3, and the results show that the level of the specific antibody in the serum of the mice of the pVAX-CCHFV-NP immune group is obviously increased compared with that of the control group.
(4.2) evaluation of cellular immune Effect in immunized mice
Detecting the level of IFN-gamma, IL-2, IL-4 and IL-10 immune molecules secreted by splenocytes of the mice immunized for 3 times in the step (2) by using an ELISPOT method, detecting the killing capacity of the splenocytes to corresponding target cells by using a CTL killing experiment, and detecting the differentiation level of splenic lymphocytes by using a flow method. The ELISPOT result in figure 4 shows that the pVAX-CCHFV-NP can promote the production of immune factors IFN-gamma, IL-2, IL-4 and IL-10 of the mice after immunizing the mice, and the pVAX-LAMP-CCHFV-NP can promote the cellular immune response of the mice after immunizing the mice. FIG. 5 shows that pVAX-CCHFV-NP immunized mice can promote the maturation and differentiation of splenic lymphocytes of mice. The CTL killing experiment result shown in figure 6 shows that the cellular immune response of the mice can be promoted after the mice are immunized by the pVAX-CCHFV-NP.
(4.3) evaluation of protective Effect of immunized mice
The content of CCHFV tecVLP in the major organs after infection of mice with CCHFV tecVLP in (3) above was examined by q-PCR and NanoLuc kit method. As a result, referring to FIG. 7, the mice in the pVAX-CCHFV-NP-immunized group were able to significantly resist the infection of the body by CCHFV tecVLP, thereby exerting a protective effect, as compared to the control group.
It should be noted that, when the present invention relates to a numerical range, it should be understood that two endpoints of each numerical range and any value between the two endpoints can be selected, and since the steps and methods adopted are the same as those in the embodiment, in order to prevent redundancy, the present invention describes a preferred embodiment. While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Claims (9)
1. A construction method of a CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP is characterized in that a gene of a structural protein NP of a CCHFV strain is synthesized, and the gene is inserted into a pVAX1 plasmid vector by a homologous recombination method as shown in SEO ID NO.1 to construct the pVAX-CCHFV-NP recombinant eukaryotic expression vector.
2. The method for constructing the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP according to claim 1, wherein the CCHFV strain is IbAr10200.
3. The method for constructing the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP according to claim 2, wherein the enzyme cutting sites for inserting the NP gene into the pVAX1 plasmid vector are EcoR I and Xba I.
4. The method for constructing the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP according to claim 3, wherein the primer sequences of the PCR method for identifying the pVAX-CCHFV-NP recombinant eukaryotic expression vector are as follows:
Primer-F：
5’-TCCAGTGTGGTGGAATTCATGGAAAACAAGATCGAGGTG-3’；
Primer-R：
5’-TTAAACGGGCCCTCTAGACTAGCTCGAGCATGCCCGG-3’。
5. the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP constructed according to the method of any one of claims 1 to 4.
6. The use of the CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP according to claim 5, wherein said pVAX1-CCHFV-NP is used for the preparation of a CCHFV vaccine.
7. The use of the recombinant eukaryotic expression vector pVAX1-CCHFV-NP according to claim 5, wherein said pVAX1-CCHFV-NP inhibits infection of CCHFV tecVLP after immunization of the body.
8. The use of the recombinant eukaryotic expression vector pVAX1-CCHFV-NP of claim 5, wherein the pVAX1-CCHFV-NP is effective in promoting the expression of the immune factors IFN-gamma, IL-2, IL-4 and IL-10 after immunizing an organism.
9. The use of the recombinant eukaryotic expression vector pVAX-LAMP-CCHFV-NP according to claim 5, wherein the pVAX-LAMP-CCHFV-NP is effective in stimulating the organism to generate cellular immune response typified by CTL killing after immunizing the organism.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211102086.XA CN115838763A (en) | 2022-09-09 | 2022-09-09 | CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211102086.XA CN115838763A (en) | 2022-09-09 | 2022-09-09 | CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115838763A true CN115838763A (en) | 2023-03-24 |
Family
ID=85574899
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211102086.XA Pending CN115838763A (en) | 2022-09-09 | 2022-09-09 | CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115838763A (en) |
-
2022
- 2022-09-09 CN CN202211102086.XA patent/CN115838763A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112626090B (en) | Nucleotide sequence for coding novel coronavirus antigen and application thereof | |
| CN111218459A (en) | Recombinant novel coronavirus vaccine taking human replication-defective adenovirus as vector | |
| US9675690B2 (en) | Nucleic acid molecule encoding hepatitis B virus core protein and surface antigen protein and vaccine comprising the same | |
| CN109182380B (en) | Preparation method and application of baculovirus-expressed classical swine fever E2 subunit vaccine | |
| CN113666990A (en) | T cell vaccine immunogen for inducing broad-spectrum anti-coronavirus and application thereof | |
| CN113201507A (en) | Recombinant pseudorabies virus and vaccine composition thereof | |
| Mourich et al. | Spermine compaction is an efficient and economical method of producing vaccination-grade DNA | |
| CN113293144A (en) | Recombinant F genotype mumps virus live vector measles vaccine | |
| US20220023413A1 (en) | Recombinant mumps virus vaccine expressing genotype g fusion and hemagglutinin-neuraminidase proteins | |
| CN115838763A (en) | CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-NP, construction method and application | |
| CN113476600B (en) | Use of AVC-29 as vaccine adjuvant and vaccine composition containing the adjuvant | |
| ES2546301T3 (en) | Composition containing Leishmania Lip2a | |
| CN112300290B (en) | Novel coronavirus polypeptide vaccine using papillomavirus viroid particle presentation antigen | |
| CN113150082B (en) | Method for constructing virus-like particle vaccine presenting peptide epitopes in different regions of RBM of SARS-COV-2 | |
| CN115948447A (en) | Recombinant eukaryotic expression vector pVAX-LAMP-CCHFV-NP, construction method and application | |
| US8465748B2 (en) | Vaccine compositions and methods containing an immunogen derived from equine arteritis virus | |
| CN115873901A (en) | Recombinant eukaryotic expression vector pVAX-LAMP-CCHFV-Gc, construction method and application | |
| CN115838762A (en) | CCHFV recombinant eukaryotic expression vector pVAX1-CCHFV-Gc, construction method and application | |
| CN110382518B (en) | Chimeric vaccine for serotype A foot and mouth disease virus | |
| CN109568574B (en) | Application of sPD1 protein and/or sPD1 gene as immune adjuvant | |
| CN111514287A (en) | Influenza A universal DNA vaccine and preparation method and application thereof | |
| EP2049154B1 (en) | Plasmid with immunological action | |
| Tsujimura et al. | Allergy vaccines using a Mycobacterium-secreted antigen, Ag85B, and an IL-4 antagonist | |
| CN113185586B (en) | T cell epitope polypeptide derived from SARS-CoV-2 coding protein and application thereof | |
| Gholami Parizad et al. | Immune Response in Mice Immunized with Recombinant PreS2/S-C18-27 Protein from Hepatitis B Virus Compared with Commercial Vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |